ID: 964503109

View in Genome Browser
Species Human (GRCh38)
Location 3:157369992-157370014
Sequence GATTTCTGTAAAATTACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964503109_964503111 15 Left 964503109 3:157369992-157370014 CCAGAGGTAATTTTACAGAAATC 0: 1
1: 0
2: 3
3: 21
4: 195
Right 964503111 3:157370030-157370052 TAATCCCCTAAATATTAACTTGG 0: 1
1: 0
2: 0
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964503109 Original CRISPR GATTTCTGTAAAATTACCTC TGG (reversed) Intronic
903456398 1:23490138-23490160 GATTGCTGCAAAGTGACCTCTGG - Intergenic
904722266 1:32519179-32519201 GTTTTCTGTAAAACAGCCTCAGG - Intronic
904951518 1:34244725-34244747 GATATCTGTATAATTACACCAGG + Intergenic
906432503 1:45766460-45766482 AATTTCTGTAGAATTACCAGAGG + Intergenic
909458335 1:75875998-75876020 GTGTTGTATAAAATTACCTCAGG + Intronic
910363730 1:86441490-86441512 GCTTTCAGTAGAATTTCCTCTGG + Exonic
911249689 1:95560728-95560750 GAATTCTGTAGAATTTGCTCAGG - Intergenic
911557007 1:99356718-99356740 GATTTCTTTAAGATTTCCTGAGG - Intergenic
913220173 1:116653729-116653751 GATTTTTCTAAAATGAACTCAGG + Intronic
915262304 1:154685684-154685706 GATTTCTGCAAAATTATATTGGG + Intergenic
916209793 1:162351022-162351044 AAATTATGTAAAATTACCTTTGG + Intronic
916989344 1:170225681-170225703 GATTTCTATAAAATCAGCTCTGG - Intergenic
917559146 1:176126838-176126860 GATTTCTATAAAATATCCTTGGG - Intronic
918737326 1:188081477-188081499 AATTTTTATAAAATTACTTCAGG - Intergenic
918843113 1:189570390-189570412 CATTTATGTAAAATTATCTAAGG + Intergenic
919033819 1:192280024-192280046 GATTTCTGCAAAATACTCTCTGG - Intergenic
919966921 1:202536968-202536990 GTTAACTGTAAAATTGCCTCAGG - Intronic
921299790 1:213740011-213740033 CATTTCTAGAAACTTACCTCTGG - Intergenic
924656618 1:245978464-245978486 TAATTCTGGAAACTTACCTCTGG - Intronic
1063490955 10:6463460-6463482 AAATCCAGTAAAATTACCTCTGG + Intronic
1064889851 10:20158825-20158847 GCTTTCTCTAAAATTTCCTATGG - Intronic
1065356405 10:24846155-24846177 GATTCCTGTGAACTCACCTCGGG - Intergenic
1066792941 10:39086104-39086126 GTTTTCTGTGAAACTACCTTGGG + Intergenic
1069737005 10:70663274-70663296 GTTTGCTCTAAAATGACCTCGGG + Intergenic
1070839165 10:79471237-79471259 GCTATCTGGAAAATTACCTCTGG - Intergenic
1072620866 10:97078376-97078398 GGTTTCTGCAACATTAACTCTGG - Intronic
1075008312 10:118846281-118846303 GCTGTCTGTAAAATTCCATCAGG - Intergenic
1077595467 11:3527849-3527871 CATTTCTCTCAAATTAACTCCGG - Intergenic
1079477004 11:20841656-20841678 GTTTCCTGTAAGATTTCCTCTGG - Intronic
1080901360 11:36495369-36495391 AATTTTTGTAAGATTACCTTTGG - Intronic
1080937032 11:36875052-36875074 TATTTCTATAATATTTCCTCTGG - Intergenic
1080975457 11:37334380-37334402 GGTTTCTGTAAAGTCACCCCAGG - Intergenic
1084251364 11:67901823-67901845 CATTTCTCTCAAATTAACTCCGG - Intergenic
1084821477 11:71694210-71694232 CATTTCTCTCAAATTAACTCCGG + Intergenic
1086223088 11:84473620-84473642 GATTTTTTTTCAATTACCTCTGG - Intronic
1086923037 11:92609150-92609172 GATTTCTGAATAATTAACTGTGG + Intronic
1087431365 11:98059749-98059771 TATTTATGTAATTTTACCTCAGG + Intergenic
1087502236 11:98972247-98972269 GTTAACTGTAAAATAACCTCAGG - Intergenic
1088065523 11:105713688-105713710 GATTGTTGTTAAATTACTTCAGG + Intronic
1090506836 11:127323931-127323953 AATTTCTACAAAATAACCTCTGG + Intergenic
1090697712 11:129265458-129265480 GATTTCTGAACACTTAACTCGGG - Intronic
1091683996 12:2548560-2548582 GAGTTCTATAAAATGACATCTGG + Intronic
1092421624 12:8336621-8336643 CATTTCTCTGAAATTAACTCCGG - Intergenic
1097320614 12:58222190-58222212 GATTTCTGTATCATTACTTTAGG + Intergenic
1099753792 12:86813646-86813668 TATTTCTGAAAAATTGCCTTAGG + Intronic
1100307692 12:93366228-93366250 GAATTCTGTGAAATAACATCTGG - Intergenic
1101012431 12:100464889-100464911 GCTTTCTGTGAAATGTCCTCAGG - Intergenic
1102262697 12:111454244-111454266 GTTATCTGCAAAACTACCTCAGG - Intronic
1104183818 12:126409014-126409036 GGTTTCTCTAAAGTTAGCTCAGG - Intergenic
1104700059 12:130896346-130896368 GATTTCTATGAAAATACTTCAGG + Intergenic
1105544667 13:21342724-21342746 GATTTCCACAAAATTACCTGTGG - Intergenic
1105982339 13:25531003-25531025 GATTCTTGTAAAATTGCCTCAGG - Intronic
1106417841 13:29560349-29560371 GTTAACTGTAAAATCACCTCAGG - Intronic
1106908378 13:34434058-34434080 GATTTCTGTAAAAATAATTCTGG + Intergenic
1108543900 13:51471812-51471834 GTTAACTGTAAAATAACCTCAGG + Intergenic
1109795886 13:67312459-67312481 TATTTTTGTGAAATCACCTCAGG + Intergenic
1110178618 13:72588146-72588168 GATATCTGAATAATTACCTTAGG - Intergenic
1110236797 13:73225473-73225495 GTTTTCATTAAAATTAACTCTGG - Intergenic
1110389058 13:74951415-74951437 TATTTCTGTAAAATTGCCATTGG - Intergenic
1111781298 13:92728971-92728993 TATTTCTGTAATATTAGCCCAGG + Intronic
1112469841 13:99677623-99677645 GATTTCTCCAAAATTACTTTGGG - Intronic
1112513022 13:100026802-100026824 TATTTCTGTAAAGTTACACCAGG + Intergenic
1113629363 13:111871467-111871489 GCTTTCTGTAAACTTGCCTTTGG + Intergenic
1117169964 14:53084557-53084579 GATTTCTGTAATATAAGCTATGG + Intronic
1118656637 14:67957557-67957579 TATTTCTCTAAAACTTCCTCTGG - Intronic
1119513746 14:75231913-75231935 GATGTCAGAAAGATTACCTCTGG + Intergenic
1119797762 14:77414617-77414639 TGTTTCTGGAAAATTAACTCAGG - Intronic
1121167388 14:91818437-91818459 GATTTCTGTAAATTTGCTTTGGG - Intronic
1129171134 15:73808793-73808815 CATTTCTGTGAAGTGACCTCTGG - Intergenic
1131044995 15:89307241-89307263 CATTTCTTTAAAAATTCCTCAGG - Intronic
1132275721 15:100561927-100561949 GATTTCTGGAACATTGCCTTTGG + Intronic
1133376660 16:5292943-5292965 CATTTCTCTCAAATTAACTCCGG + Intergenic
1137369609 16:47892838-47892860 GAATTCAGTAAAATTACATCCGG - Intergenic
1139087202 16:63601736-63601758 GATTTCTGTAGAATTAAGGCTGG - Intergenic
1139151715 16:64389534-64389556 GATTTTTTTAAAATTACATTTGG + Intergenic
1140615595 16:76659043-76659065 GATATATGTAAACTTACCTCGGG + Intergenic
1141001223 16:80310011-80310033 GATTTCTTTGAAATTCCCTCTGG + Intergenic
1142478042 17:201280-201302 GGTTTCTGTAATATCACCTGTGG + Intergenic
1151437272 17:74105625-74105647 GATTTCAGGAAAATGACCTTTGG + Intergenic
1155791672 18:29978704-29978726 TATTTCTGTAAATTTATCTTAGG - Intergenic
1156504437 18:37580225-37580247 GATTTTTGTAAAAATAATTCTGG - Intergenic
1156604330 18:38647978-38648000 TATTTCTTTAAAATTACTTACGG - Intergenic
1159268226 18:66112082-66112104 TATTTCTGTAAAATTACTTCAGG + Intergenic
1159467739 18:68806595-68806617 TATTTCTGTAAAATTCTCTGTGG + Intronic
1165663103 19:37599694-37599716 CATCTCTGTACAATTTCCTCTGG - Exonic
1166623356 19:44325578-44325600 TATTTCTGTGAAATTTCCTTAGG - Intergenic
925014519 2:512100-512122 GTTTTCTGTAAACATACCACTGG - Intergenic
926792906 2:16593546-16593568 AATTTTTGTAGAATTACCTGAGG - Intronic
928239888 2:29577195-29577217 GATGTTTGTAAAATAAACTCTGG + Intronic
928873739 2:36012479-36012501 ACTTTCTGTAAATATACCTCAGG + Intergenic
929859133 2:45660931-45660953 GATTTCAGTTATATTTCCTCTGG - Intronic
930055194 2:47246453-47246475 GATGTCAATAAAATGACCTCAGG - Intergenic
931184952 2:59940811-59940833 GATTTTTTTAAAAGTCCCTCTGG + Intergenic
932975876 2:76598949-76598971 GAATTTTGTAAATTTACCTCAGG - Intergenic
933144114 2:78830371-78830393 GATTTATTTAAAGTTACTTCAGG + Intergenic
935477879 2:103546998-103547020 CATTTCTGTAAAATTTCCTCAGG + Intergenic
936483854 2:112909886-112909908 GATTTCTGTTAAATTCCATAAGG - Intergenic
936785214 2:116086868-116086890 ATTTTCTTAAAAATTACCTCTGG + Intergenic
937637273 2:124170393-124170415 GATTTCTGAAAAGCTAACTCAGG - Intronic
938819487 2:134941174-134941196 TATTTCTGTAAAGTTACACCAGG + Intronic
938884324 2:135627900-135627922 TCTTTCTCTAAAATTACTTCTGG + Intronic
939006932 2:136799709-136799731 TATTTCTTTCAAATTAACTCAGG - Intronic
939295147 2:140253663-140253685 GCTTTCAGTAAAATTTTCTCTGG - Intronic
939395012 2:141617504-141617526 TATTTCTATAAAATTTTCTCTGG + Intronic
940467652 2:154052297-154052319 GAGTTATGTAAGATGACCTCAGG - Intronic
942692934 2:178606511-178606533 GATTTCTGGGAGATTCCCTCTGG + Intronic
942765752 2:179454522-179454544 GTTATCTGTAAAATGGCCTCAGG + Intronic
943541765 2:189224293-189224315 TATTTCTGGAAAATTACCTGGGG - Intergenic
944904772 2:204251664-204251686 GATTTCTGGAATATTACCTTGGG - Intergenic
948070453 2:235117477-235117499 GCTTTCTCTGAAATTACTTCAGG - Intergenic
948324284 2:237100341-237100363 GATATCTCTAAAATTTGCTCTGG + Exonic
1169302195 20:4452737-4452759 GGTTTCTGAAAAATGTCCTCAGG - Intergenic
1169762936 20:9116257-9116279 GAATTCTGAAAAGTTACTTCTGG - Intronic
1170143409 20:13147640-13147662 TATTTCTGAAAAATTAACCCAGG - Intronic
1173089126 20:39953390-39953412 CATTTCTGTAGTGTTACCTCTGG - Intergenic
1174776622 20:53348871-53348893 GATTTTTGCAAAATTTCTTCAGG + Intronic
1177262526 21:18749467-18749489 GATTTTTGTAAAATTTAGTCTGG + Intergenic
1177460354 21:21400931-21400953 GATTTCTTTAAAATTACCCTGGG - Intronic
1177610454 21:23440752-23440774 TATTTCTGTAAAGTCACCTGTGG - Intergenic
1177816406 21:25982091-25982113 GATGTCTGTAACATTCTCTCTGG - Intronic
1183003395 22:34880113-34880135 GATTTCTGTGACATTTCCTACGG - Intergenic
950309857 3:11947908-11947930 GATTTCTGCAAATCTCCCTCAGG + Intergenic
951620774 3:24599990-24600012 AATTTCCCTAAAATTACATCAGG - Intergenic
951963186 3:28351694-28351716 GATTAATGTCATATTACCTCAGG + Intronic
957065628 3:75519575-75519597 CATTTCTCTCAAATTAACTCCGG - Intergenic
958116462 3:89225560-89225582 GTTTTCTGTAAAATTATTTGGGG - Intronic
961287701 3:125819846-125819868 CATTTCTCTCAAATTAACTCCGG + Intergenic
961899367 3:130196146-130196168 CATTTCTCTCAAATTAACTCCGG - Intergenic
962089169 3:132224886-132224908 GTTTACTGTAAAATAGCCTCAGG + Intronic
964459435 3:156907040-156907062 CATGTCTGTAAAAATATCTCAGG - Intronic
964503109 3:157369992-157370014 GATTTCTGTAAAATTACCTCTGG - Intronic
964822071 3:160781724-160781746 GCCTTCTGAAAAATTACCACTGG - Intronic
965966665 3:174499949-174499971 AATTTCTGTAAAAATCCTTCTGG + Intronic
966034161 3:175390299-175390321 GATTTCTTCAAAATTACCTCTGG + Intronic
966905175 3:184518390-184518412 GATATCTGATAAATGACCTCAGG - Intronic
968539040 4:1153547-1153569 GAATTCTGTAAAACCACTTCTGG + Intergenic
969010213 4:4055662-4055684 CATTTCTCTCAAATTAACTCCGG - Intergenic
972657147 4:41075249-41075271 GATTACTGTAAAATTATTTTTGG - Intronic
972726384 4:41749380-41749402 GATTTCTTTAAAAATACACCTGG + Intergenic
973309215 4:48689562-48689584 GATTTCTGTAAACTTATGTGTGG - Intronic
974251313 4:59388475-59388497 GATCACTGTAAAAGCACCTCTGG - Intergenic
975359021 4:73445022-73445044 GATTTCAGTAAAATTAACTTTGG - Exonic
977156942 4:93585976-93585998 GGTTTATGTAAAATCACCACAGG - Intronic
980499070 4:133625388-133625410 GTTGTCTTTAAAATTCCCTCAGG - Intergenic
983987432 4:174076710-174076732 TATTTCTGCAAAATTACGTTGGG + Intergenic
984062581 4:175009197-175009219 TATTTCTGTAAAAATGCCACTGG + Intergenic
984082633 4:175267196-175267218 TATTTCTTTAAAATTACCACAGG + Intergenic
988186443 5:27870266-27870288 GTTTACTGTAAAATAGCCTCAGG + Intergenic
989737606 5:44727659-44727681 AATTACTTTAAAATAACCTCTGG + Intergenic
992962998 5:81973744-81973766 AAGTTCTGTAACATTTCCTCTGG - Intronic
993547017 5:89224781-89224803 TATTTCTGTAAAAATACCATTGG + Intergenic
993656610 5:90585576-90585598 GATCCCTTTAAAATGACCTCAGG - Intronic
994513861 5:100744561-100744583 GACTTCTTTAATATTATCTCTGG - Intergenic
996579632 5:125016766-125016788 GATTTCTGTGAAATTATATTTGG + Intergenic
997244273 5:132333131-132333153 GATATCTGAAAAATGACTTCAGG - Intronic
1006163173 6:32049677-32049699 GACTTCTCTGAAATGACCTCAGG - Intronic
1006293090 6:33155580-33155602 GACTTGTGTAAAATTTCCCCAGG - Intergenic
1008477359 6:51946694-51946716 GATTTTTATAAAATTACCCAAGG - Intronic
1008747656 6:54692156-54692178 GGCTTCTATAAAATTTCCTCAGG - Intergenic
1010293804 6:74171997-74172019 TATTTCTGAAGAATTTCCTCTGG + Intergenic
1010498774 6:76568355-76568377 CATTGCTATAAAATTACCTGAGG + Intergenic
1010599816 6:77810314-77810336 GGATTCTGTAAGATTATCTCTGG + Intronic
1011053826 6:83184346-83184368 CATTTCTGTTAAATAACTTCAGG - Intronic
1012537608 6:100318161-100318183 GATTTCTCTAAAGTTACCTTAGG - Intergenic
1012570436 6:100719325-100719347 GATTTCTTTAAAAATAGGTCTGG - Intronic
1012596289 6:101044861-101044883 GTTTTCTGTAAAATGAACTTGGG + Intergenic
1012746325 6:103093842-103093864 GATTACTTTAAAATTAGCTATGG + Intergenic
1014543189 6:122700738-122700760 GCTTTCTGTAAAATCACCTGTGG + Intronic
1018771906 6:166977795-166977817 GAATGCTGTAAAAATACCTAAGG - Intergenic
1020808341 7:12819606-12819628 GTTTTCTGTAAAATTAACAGAGG + Intergenic
1021193200 7:17645405-17645427 AATTTCTGCAAAATTATTTCTGG - Intergenic
1021431631 7:20565893-20565915 TATTTCTATAAAAATACCTTTGG - Intergenic
1024208124 7:47181150-47181172 GATCTCTGTATAAAGACCTCAGG - Intergenic
1027345280 7:77253283-77253305 GATCTCTGTCAAGTTTCCTCTGG + Intronic
1028369034 7:90070210-90070232 GAATTGTGTTAAATAACCTCTGG + Intergenic
1029069323 7:97882224-97882246 CATTTCTCTCAAATTAACTCCGG - Intergenic
1029233706 7:99094352-99094374 GAGTTATTTAAAATTACCTGTGG - Intronic
1030289021 7:107854081-107854103 AATCTCTGTAAAATGACCTCCGG - Intergenic
1030875894 7:114812904-114812926 GCTTTTTGTAAAAGTACCTTTGG + Intergenic
1030959734 7:115902208-115902230 GACTTCTGAAAAAATACTTCTGG - Intergenic
1031021060 7:116627989-116628011 AATTTCTATAAAACTACCTAGGG + Intergenic
1032181048 7:129678255-129678277 TATTTTTATAAAATTAGCTCTGG - Intronic
1032190389 7:129762150-129762172 GCTTTCTATAAAAATAGCTCTGG - Intergenic
1032214621 7:129948379-129948401 CGATTCTGTAAAATTAACTCAGG + Intronic
1036530072 8:9576980-9577002 AATTTATGTAATAGTACCTCTGG + Intronic
1036885022 8:12545615-12545637 TATTTCTCTCAAATTATCTCCGG - Intergenic
1037509532 8:19567977-19567999 GAGTTCTCTAAAAGTAGCTCAGG + Intronic
1037640623 8:20738992-20739014 GCTTTCTGTAGAAATACCTTAGG + Intergenic
1039356725 8:36826001-36826023 AATTTCTATTAATTTACCTCTGG + Intronic
1040467621 8:47709839-47709861 GATTTCTGTAAGATTATCTGAGG - Intronic
1040729715 8:50428800-50428822 GATTTTTGTAAAATTATCTAGGG + Intronic
1042988499 8:74611754-74611776 GATTTCTGCAAATTTACATGAGG - Intronic
1043095797 8:75970398-75970420 GATTTTTTAAAAATTTCCTCTGG - Intergenic
1043277163 8:78412941-78412963 GGTTTCTGTAAAATTACTTTGGG - Intergenic
1043285765 8:78528483-78528505 GATGTTTCTAAAATTAACTCTGG + Intronic
1045080935 8:98625223-98625245 GATTACTGACAAATTACCTCTGG + Intronic
1046336803 8:112801179-112801201 GATTGCTGGAAAATTACATCAGG + Intronic
1046562751 8:115860046-115860068 AATTTCTGTTAAATAATCTCAGG - Intergenic
1046674250 8:117091123-117091145 GATTTCTGTGATTTTGCCTCAGG - Intronic
1047822279 8:128534482-128534504 CAATTCTGTACAATTACCTTTGG + Intergenic
1048658037 8:136564378-136564400 AATTTCTGTAAAAATACATGGGG - Intergenic
1051414726 9:16827118-16827140 AATTACTGTAAAGTTACATCTGG + Intronic
1052949919 9:34200160-34200182 GATTTTTGGAAAAATACCTGAGG + Intronic
1055464887 9:76554935-76554957 GTTAACTGTAAAATAACCTCAGG - Intergenic
1058607692 9:106741247-106741269 TATTTCTGTAATCTTACCACAGG - Intergenic
1187188510 X:17010783-17010805 GACTTCTGTAAAAACTCCTCTGG - Intronic
1188638698 X:32470261-32470283 TATTTCTTTAAAATTGTCTCTGG + Intronic
1189502447 X:41575903-41575925 GCTTTCTGAAAAAGTAACTCAGG + Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1194351996 X:92832549-92832571 AATTTCTGTAACATTTTCTCTGG - Intergenic
1194686205 X:96920486-96920508 GAGTTATGTATTATTACCTCTGG + Intronic
1194845506 X:98802454-98802476 GATTCCTGTAAAACTACAGCAGG + Intergenic
1195058408 X:101169642-101169664 GTTTACTGTAAAACAACCTCAGG + Intergenic
1195112955 X:101665731-101665753 GATTTCTGGGAAATGAACTCTGG + Intergenic
1195243518 X:102976527-102976549 GATTGCTTTAACATTACCTAAGG - Intergenic
1200660304 Y:5949235-5949257 AATTTCTGTAACATTTTCTCTGG - Intergenic
1201470839 Y:14333638-14333660 GATTTCTATAAAATAGCATCAGG - Intergenic
1201649782 Y:16272981-16273003 TATTCCTATAAAAATACCTCAGG - Intergenic
1201686937 Y:16715326-16715348 GTATTTTGTAAAATTCCCTCAGG - Intergenic