ID: 964503173

View in Genome Browser
Species Human (GRCh38)
Location 3:157370528-157370550
Sequence ATGCTAGCACTGTGAAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964503173_964503179 24 Left 964503173 3:157370528-157370550 CCCCAACTTCACAGTGCTAGCAT 0: 1
1: 0
2: 1
3: 17
4: 157
Right 964503179 3:157370575-157370597 TGCTGCTGGAACACCTAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 91
964503173_964503178 10 Left 964503173 3:157370528-157370550 CCCCAACTTCACAGTGCTAGCAT 0: 1
1: 0
2: 1
3: 17
4: 157
Right 964503178 3:157370561-157370583 ACTGCAATAAATAATGCTGCTGG 0: 1
1: 1
2: 0
3: 23
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964503173 Original CRISPR ATGCTAGCACTGTGAAGTTG GGG (reversed) Intronic
900038844 1:440177-440199 ATGGTAGCACTGAGTAATTGCGG - Intergenic
900060277 1:675153-675175 ATGGTAGCACTGAGTAATTGCGG - Intergenic
901897675 1:12328521-12328543 CTGCAAGCAGTGTGAAGTTGAGG + Intronic
913060078 1:115196745-115196767 ATGGTAGAGCTGTGTAGTTGAGG + Intergenic
913142174 1:115952342-115952364 ATGCTAGCACTTTGAGGCTGAGG - Intergenic
913208627 1:116564866-116564888 ATCCTAGCACTGAGAGGCTGAGG - Intronic
919807366 1:201388138-201388160 ATCCCAGCACTGGGAAGTTGAGG + Intronic
921436336 1:215127697-215127719 ATGCAAGCTCTATGAAGTTAGGG + Intronic
922124397 1:222708618-222708640 ATCCTAGCACTGGGAAGCTGAGG - Intronic
1063561659 10:7133934-7133956 ATCCTAGCCCTTTGAAGTTAGGG - Intergenic
1064539652 10:16392426-16392448 ATGTAAGCTCTGTGAAGGTGGGG - Intergenic
1065126814 10:22581859-22581881 ATCCCAGCACTGGGAGGTTGAGG + Intronic
1065774064 10:29102974-29102996 ATGGTAGCACTGCTAAGTTGTGG - Intergenic
1068163499 10:53298794-53298816 ATGCTAGCACTGGAGAGTGGTGG - Intergenic
1069001955 10:63276711-63276733 ATCCCAGCACTGGGAGGTTGAGG - Intronic
1069123282 10:64596558-64596580 AAGCTAGAAGTGTGAAGGTGAGG - Intergenic
1070500153 10:77065190-77065212 AGGTGAGCACTGTGAAGATGGGG - Intronic
1072650206 10:97289364-97289386 ATCCTAGCACTTTGAGGCTGAGG - Intronic
1072991206 10:100195888-100195910 ATGCTATCACTGTGTATCTGTGG + Intronic
1073567798 10:104550219-104550241 ATCCTAGCACTGGGAGGCTGAGG - Intergenic
1074070215 10:110060035-110060057 ATGCTAGAAATGTGAAGTGAAGG + Intronic
1076965052 11:76088-76110 ATGGTAGCACTGAGTAATTGCGG - Intergenic
1078452013 11:11447454-11447476 ATGCCAGCTCTGTGAAGCAGGGG + Intronic
1079044209 11:17085422-17085444 ATGGTAACAGTGTGAAGGTGTGG - Intronic
1079270911 11:18985119-18985141 ATGCTAACACTGTAAAGGGGTGG - Intergenic
1083388650 11:62332221-62332243 ATGCCAGCACTGGGAGGTGGGGG + Intergenic
1084433353 11:69123619-69123641 ATGCCAGCTCTGTGAGGTTGAGG + Intergenic
1085364849 11:75930643-75930665 AAACAAGCACTGTGAAGTTATGG - Intronic
1085419232 11:76341358-76341380 ATGCTGTCACTTTGAAGTGGTGG - Intergenic
1085484381 11:76849480-76849502 ATTCTGGCACTGTGGAGCTGTGG + Intergenic
1085815779 11:79735647-79735669 ATGCTAGCAATGAGAAGGAGTGG - Intergenic
1085852989 11:80143143-80143165 ATGAAGGCACTGTGATGTTGAGG - Intergenic
1090245478 11:125213149-125213171 ATGATAGCATTTTGAAGATGGGG - Intronic
1092613882 12:10198861-10198883 ATGCTATCACTGAGTAGTGGTGG + Intergenic
1093123143 12:15297191-15297213 ATGCAATCAGTGTTAAGTTGTGG + Intronic
1102178749 12:110895623-110895645 TTCCTAGCTCTGTGACGTTGAGG + Intronic
1104589520 12:130073217-130073239 GTGCACGCACTGTGAAGATGGGG + Intergenic
1105363995 13:19747581-19747603 ATTCTAGCACTGGGAAGCTGAGG - Intronic
1110774939 13:79396927-79396949 ATCCTAGCACTGGGAGGCTGAGG + Intronic
1115816152 14:37166532-37166554 GTGCTTGCCTTGTGAAGTTGTGG + Intronic
1116630570 14:47326048-47326070 ATGACAGCAATGTGAATTTGAGG + Intronic
1117992752 14:61450889-61450911 ATGTTGGCACTTTGTAGTTGTGG - Exonic
1118278694 14:64409375-64409397 ATTCTAGAACAGAGAAGTTGTGG + Intronic
1123580984 15:21714768-21714790 ATGCCACCACTGTGGAATTGGGG - Intergenic
1123617633 15:22157391-22157413 ATGCCACCACTGTGGAATTGGGG - Intergenic
1123975847 15:25553910-25553932 ATCCCAGCACTGGGAAGCTGAGG + Intergenic
1130722408 15:86401820-86401842 ATGCTAGCACCGTGCTGTTTTGG + Intronic
1132291618 15:100707566-100707588 ATGCTATCACTTTGAGGTTTTGG - Intergenic
1132443073 15:101887428-101887450 ATGGTAGCACTGAGTAATTGCGG + Intergenic
1132458948 16:40116-40138 ATCCTAGCACTTTGAGGCTGAGG - Intergenic
1132757356 16:1492422-1492444 ATTCCAGCACTGGGAAGCTGAGG - Intergenic
1133614332 16:7462119-7462141 CTACTACCTCTGTGAAGTTGTGG + Intronic
1137420791 16:48332073-48332095 ATGATACCACTGTGAACTTCTGG - Intronic
1137455035 16:48611555-48611577 ATGCAACCACAGTGAACTTGTGG + Intronic
1138481497 16:57306219-57306241 TTGCTAGCTCTGTGACCTTGGGG + Intergenic
1139486896 16:67262891-67262913 AAGGCAGCACTGTGGAGTTGTGG + Intronic
1139514768 16:67446520-67446542 CTGCCAGCACTGTGGGGTTGGGG - Intronic
1139607385 16:68029391-68029413 ATCCTAACACTGGGAGGTTGAGG - Intronic
1142000110 16:87659469-87659491 ATCCCAGCACTGGGAGGTTGAGG + Intronic
1143276117 17:5712158-5712180 AGAATAGCACAGTGAAGTTGAGG + Intergenic
1146586059 17:34082757-34082779 CTGCTACCACTTTTAAGTTGAGG + Intronic
1147848144 17:43419823-43419845 ATCCCAGCACTGTGAGGCTGAGG - Intergenic
1149760848 17:59228630-59228652 ATCCCAGCACTGTGAAGCTGAGG + Intronic
1151981210 17:77510347-77510369 GTGCCATCACGGTGAAGTTGAGG + Intergenic
1153223734 18:2882498-2882520 ATCCCAGCACTTTGAGGTTGGGG + Intronic
1153996151 18:10443484-10443506 TTTCTAGCACTATGAAGATGTGG - Intergenic
1156199558 18:34814432-34814454 ATCCTAGCACTGAGAGGCTGAGG + Intronic
1156849893 18:41714020-41714042 ATTCTACCACTGTGAAGTTGAGG + Intergenic
1160641857 19:145718-145740 ATGGTAGCACTGAGTAATTGCGG - Intergenic
1162650399 19:12084311-12084333 ATCCTAGCACTGTGAGGCTGAGG - Intergenic
1165050379 19:33137765-33137787 ATGACTGCACTGTGAAGCTGTGG + Exonic
1166522236 19:43488203-43488225 ATGCCAGCACTTTGAGGCTGAGG + Intronic
1168095727 19:54113941-54113963 ATCCTAGCACTGGGAGGCTGAGG - Intronic
924986498 2:275644-275666 ATGCTAGCTGTGTGAACTCGGGG - Intronic
925187527 2:1859525-1859547 GTGCAAGAACTGTGAAGTTATGG + Intronic
926729129 2:16021800-16021822 ATGCCAGGGCTGTGAAGATGTGG - Intergenic
926760337 2:16273095-16273117 TTTCTAGCTCTGTGAATTTGGGG - Intergenic
928964611 2:36964966-36964988 TTGCTAGCTCTGTGACCTTGAGG - Intronic
932839337 2:75067231-75067253 ATCTAAGAACTGTGAAGTTGAGG - Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934130801 2:88947091-88947113 TTGCTAGATCTGTGCAGTTGGGG + Intergenic
934132812 2:88966052-88966074 TTGCTAGAACTGTGCAGTTGGGG + Intergenic
935200901 2:100855762-100855784 CTGCTAGCCCTGTGAGTTTGGGG - Intronic
935378384 2:102423367-102423389 ATGTTAGCACTGTGAGTCTGTGG + Intronic
939548336 2:143581780-143581802 ATTCTGGGAATGTGAAGTTGGGG - Intronic
940943688 2:159592398-159592420 ATCCCAGCACTGGGAAGCTGAGG - Intronic
944772592 2:202929556-202929578 ATGCCAGTACTGTGATGTTTTGG + Intronic
1173515724 20:43664348-43664370 TTACTAGCACTGTGACCTTGGGG + Intergenic
1173634760 20:44545568-44545590 ATCCTAGCACTGGGAGGCTGAGG + Intronic
1176934995 21:14857336-14857358 TTGGTAGCTCTGTTAAGTTGGGG + Intergenic
1178309603 21:31518711-31518733 ATGCTTACACTGGGAAGGTGGGG + Intronic
1178310425 21:31525609-31525631 CTGCTAGCAGTGTGACTTTGGGG - Intronic
1181172455 22:21017327-21017349 GTGAGAGCACTGTGAATTTGGGG - Intronic
1181863848 22:25840086-25840108 TTGCCAGCTCTGTGAAGTTGTGG + Intronic
1182331966 22:29557368-29557390 ATCCCAGCACTATGAAGTTGAGG - Intronic
1183017912 22:35005105-35005127 ATGCTAGGGCTGAGAAGCTGAGG - Intergenic
1183822718 22:40359781-40359803 ATCCTAGCACTTTGAGGCTGAGG - Intronic
953882583 3:46698931-46698953 ATCCTAACACTGGGAAGTTGAGG - Intergenic
954641239 3:52099312-52099334 ATGCCAGCACTCTGGAGCTGTGG + Intronic
957427764 3:80063160-80063182 ATGCTTGCATTGTGAATTTTAGG + Intergenic
959701005 3:109299105-109299127 ATCCTAGCACTGGGAGGCTGAGG + Intronic
961131922 3:124476730-124476752 ATGATTGCTCTGGGAAGTTGGGG + Intronic
964211111 3:154229076-154229098 ATACATGCACTGTGAAGTGGAGG - Intronic
964437043 3:156664439-156664461 AAGCCAGAATTGTGAAGTTGTGG - Intergenic
964503173 3:157370528-157370550 ATGCTAGCACTGTGAAGTTGGGG - Intronic
966359026 3:179114518-179114540 ATCCTAACACTGTGAGGCTGAGG + Intergenic
971787033 4:31117779-31117801 ATGGTAGGACTGTGATGTAGAGG + Intronic
972230112 4:37062616-37062638 ATACTATTACTGTGAAGTTTAGG + Intergenic
975531849 4:75407583-75407605 ATACTATCACTTTGAAGTTGAGG + Intergenic
981773232 4:148334456-148334478 ATGCTTGAACTGGGAAGTGGAGG + Intronic
987105288 5:14632829-14632851 ATCCCAGCAGTGTGAAGTTATGG - Intergenic
987438123 5:17922747-17922769 ATGCTAAAACTGTGAAGTGCAGG + Intergenic
987490193 5:18570325-18570347 ATGCAAGCACTGTGGTGTTCTGG - Intergenic
989613222 5:43314732-43314754 ATGGAACCACTGTGAAGTGGTGG + Intergenic
990286386 5:54304259-54304281 TTGCTAGCTGTGTGAACTTGAGG + Intronic
992402578 5:76425177-76425199 ATGCTAGCTCAGTTAAGTTGGGG + Intronic
997985698 5:138499815-138499837 ATCCTAGCACTGGGAGGCTGAGG + Intergenic
998073748 5:139219408-139219430 ATGCTAACACTGAGAGGGTGAGG + Intronic
999516353 5:152305668-152305690 CTCCCAGCACTGTGGAGTTGGGG + Intergenic
1000983623 5:167843270-167843292 ATGCTTGCTCTGAGAATTTGAGG + Intronic
1001688186 5:173611427-173611449 TTGCTAGCATTTTGAATTTGAGG - Intronic
1002735003 5:181378766-181378788 ATGGTAGCACTGAGTAATTGCGG + Intergenic
1002749523 6:95356-95378 ATGGTAGCACTGAGTAATTGCGG - Intergenic
1003669022 6:8138622-8138644 ATGCTTCCACTGAGAAATTGTGG + Intergenic
1007467306 6:42063013-42063035 ATGTAAGCACAGTGAAGATGAGG - Intronic
1008162432 6:48094983-48095005 ATGCAAGCACTGTCATTTTGGGG + Intergenic
1014585399 6:123191808-123191830 ATTCTAGCACTGTAAAAATGTGG + Intergenic
1014952506 6:127573717-127573739 TTACTAGCAATGTGAATTTGAGG - Intronic
1015238926 6:131002314-131002336 CTGCTAGCACTATGGAGTCGAGG + Intronic
1016239424 6:141911658-141911680 ATGCTAAGACTGTGCAGTTTTGG + Intergenic
1018204118 6:161420941-161420963 AAGCAAGCTCTGTGGAGTTGAGG - Intronic
1019239262 6:170651083-170651105 ATGGTAGCACTGAGTAATTGCGG + Intergenic
1019957250 7:4425123-4425145 ATCCCAGCACTTTGAGGTTGAGG + Intergenic
1021152156 7:17165112-17165134 ATGCTATCACTGTATACTTGTGG - Intergenic
1022436422 7:30390207-30390229 ATGTAAGCACTGTGAAGTCAAGG + Intronic
1023208198 7:37774464-37774486 ATGCTAGTACTGTGCTGTTTTGG + Intronic
1026168057 7:67928601-67928623 AAGCCTGCACTGAGAAGTTGTGG + Intergenic
1028147357 7:87332779-87332801 ATCCCAGCACTGGGAAGCTGAGG + Intergenic
1030740374 7:113102276-113102298 TTGCTAGCTGTGTGATGTTGGGG + Intergenic
1032390125 7:131550402-131550424 ATCCTAGCACTGGGAGGCTGAGG + Intronic
1035355786 7:158275348-158275370 CTGCCAGCACAGTGAAGCTGTGG - Intronic
1035508508 8:155525-155547 ATGGTAGCACTGAGTAATTGCGG - Intergenic
1038293624 8:26271434-26271456 ATCCCAGCACTGGGAGGTTGAGG - Intergenic
1038561119 8:28581002-28581024 ATACTTTCACTGTGAAGGTGAGG + Intergenic
1038914571 8:32006374-32006396 ATATTAGCCCTGTGAAATTGGGG - Intronic
1039663404 8:39492706-39492728 ATGCTAGGATTGTGATGTTTGGG - Intergenic
1043482028 8:80663587-80663609 ATGCTGGCACTGTTGATTTGGGG + Intronic
1043780495 8:84328006-84328028 ATGCTTTCACTGTGAAAGTGTGG - Intronic
1044164715 8:88967636-88967658 ATGCAAGAGCTGTGAAGGTGTGG + Intergenic
1047993962 8:130315842-130315864 AAGCTAGCACTTGGAAGTTAGGG - Intronic
1048480528 8:134787097-134787119 ATCCTAGCACTGGGAGGCTGAGG - Intergenic
1051369599 9:16347054-16347076 ATCATACCACTGAGAAGTTGGGG - Intergenic
1052196748 9:25726306-25726328 ATGTTGGGACTATGAAGTTGAGG + Intergenic
1055165804 9:73191512-73191534 ATGCTAGGATTGTGATGTTTGGG + Intergenic
1055179935 9:73373930-73373952 ATGCTTTCTCTGTGTAGTTGAGG - Intergenic
1055726843 9:79239468-79239490 ATGCTAGCAATCTGAAGTATTGG + Intergenic
1057768457 9:97944486-97944508 ATGCTTCCAATGAGAAGTTGAGG - Intronic
1057918576 9:99076735-99076757 ATGCTGGCAGTGGGAACTTGGGG + Intergenic
1058336897 9:103840981-103841003 CTGCTAGTAAAGTGAAGTTGTGG + Intergenic
1060182613 9:121544883-121544905 ATCCCAGCACTGGGAAGCTGAGG + Intergenic
1060334097 9:122705389-122705411 AAGCTAGCAATGAGAAGTTAAGG + Intergenic
1060692889 9:125680122-125680144 ATGCTAATAGTGTGAAGTCGGGG - Intronic
1062759470 9:138331374-138331396 ATGGTAGCACTGAGTAATTGCGG + Intergenic
1203599917 Un_KI270748v1:2146-2168 ATGGTAGCACTGAGTAATTGCGG + Intergenic
1188707822 X:33357291-33357313 ATGCTGGCACTGTGATGTGGGGG - Intergenic
1188713841 X:33435908-33435930 ATTCTAATACTGTAAAGTTGGGG + Intergenic
1192317191 X:70062270-70062292 ATCCTAGCACTGGGCATTTGCGG + Intergenic
1193772881 X:85608468-85608490 ATGCAAGCTCTATGAAGGTGTGG + Intergenic
1195058032 X:101165682-101165704 ATGCCAGCATTGAGAAGTAGAGG + Intergenic
1196839456 X:119845469-119845491 ATGTTATCAGTGTGAATTTGTGG - Intronic
1197596339 X:128468589-128468611 ATTCTTACAATGTGAAGTTGGGG + Intergenic
1198389930 X:136163456-136163478 ATGCTAGCTATGTGAAGAAGAGG + Intronic
1199210415 X:145202794-145202816 ATGCTAACTATGTGAAGTTGTGG + Intergenic
1199855354 X:151755039-151755061 ATGCTATCACTTTGAGGTTCAGG - Intergenic
1200704897 Y:6434295-6434317 ATTCCAGGACTGTGAAGTGGTGG + Intergenic
1201029214 Y:9730413-9730435 ATTCCAGGACTGTGAAGTGGTGG - Intergenic