ID: 964503959

View in Genome Browser
Species Human (GRCh38)
Location 3:157378167-157378189
Sequence TTGGCCAACAGCGACTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964503957_964503959 -9 Left 964503957 3:157378153-157378175 CCACGTCATTAAAATTGGCCAAC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 964503959 3:157378167-157378189 TTGGCCAACAGCGACTTTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 79
964503955_964503959 5 Left 964503955 3:157378139-157378161 CCAAACTTCTGAAACCACGTCAT 0: 1
1: 0
2: 1
3: 9
4: 104
Right 964503959 3:157378167-157378189 TTGGCCAACAGCGACTTTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 79
964503954_964503959 25 Left 964503954 3:157378119-157378141 CCAGCTGCAGAGACTGTAAACCA 0: 1
1: 0
2: 0
3: 15
4: 159
Right 964503959 3:157378167-157378189 TTGGCCAACAGCGACTTTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964503959 Original CRISPR TTGGCCAACAGCGACTTTGT GGG Intronic
901744128 1:11361345-11361367 TTGGCCACCAGTGCCATTGTGGG + Intergenic
908737071 1:67288099-67288121 TCAGCCACCAGCCACTTTGTCGG + Intergenic
909668972 1:78166878-78166900 TTGGCCAAGAGCTTCATTGTTGG - Intergenic
910789262 1:91034164-91034186 GTGGCCAACACTGAATTTGTAGG + Intergenic
913216934 1:116628533-116628555 TTGGGCAACAGGGACTGTGAAGG + Intronic
916885358 1:169062061-169062083 TTGGACATCAGCTACTCTGTTGG - Intergenic
918446378 1:184621294-184621316 TTGGCCAACAGCAGCTATTTTGG + Exonic
924628074 1:245712045-245712067 TGGGCCATCAGGGACTTTGGGGG - Intergenic
1065133119 10:22642765-22642787 CTGGACCACAGAGACTTTGTTGG - Intronic
1070719534 10:78746584-78746606 TTGGCCAACAGCGAACCTCTGGG - Intergenic
1074218687 10:111413885-111413907 CTGGCTAACATGGACTTTGTGGG + Intergenic
1075391498 10:122095793-122095815 GTGGCCAGCAGCGACTGTATTGG - Intronic
1075762084 10:124864659-124864681 TTGGCCAAAAGCCACTTGGGAGG + Intergenic
1078720815 11:13881505-13881527 TTGGCCCACAGTGAGTTCGTTGG - Intergenic
1083600034 11:63941155-63941177 TAGGCCAGAAGAGACTTTGTAGG - Intronic
1084236383 11:67790544-67790566 TTGGCCAAAAGGGACATGGTGGG - Intergenic
1092407290 12:8229951-8229973 TTGGCCAAAAGGGACATGGTGGG - Intergenic
1093711774 12:22335659-22335681 ATGGCTAACAGCGACTCTCTCGG - Intronic
1097706786 12:62877011-62877033 TTGGGCAACAGTGTGTTTGTAGG - Intronic
1108468163 13:50739819-50739841 TTGGCCAAAAGGGACTAGGTAGG - Intronic
1116853964 14:49935813-49935835 TTGGTCAACAGCCACTCTGCTGG - Intergenic
1128869556 15:71143390-71143412 TTGGCCCACAGGGTCATTGTAGG + Intronic
1133237592 16:4394731-4394753 TTGCCCTACAGAGACCTTGTAGG - Intronic
1133347965 16:5083061-5083083 TTGGCCAAAAGGGACATGGTGGG - Intronic
1134091003 16:11391753-11391775 TTGGGCAGTAGCCACTTTGTGGG - Exonic
1140107986 16:71978328-71978350 TTGGACAACAGAAACATTGTTGG - Exonic
1141988223 16:87593853-87593875 TAGGCCAAAAGGGAATTTGTTGG + Intergenic
1144640792 17:16935467-16935489 TTGGTCAGCAGCGGCCTTGTCGG - Intronic
1150246228 17:63677617-63677639 TTGGCCAACAGAGGGTTTGTAGG - Intronic
1157984604 18:52422854-52422876 TTGGTCAACAGCCACTTTTCTGG + Intronic
1167846998 19:52172818-52172840 TTGGCCAACAATGATTTTTTAGG - Intergenic
1168712448 19:58509653-58509675 ATGGCCATCAGGGACTGTGTGGG + Intronic
932280203 2:70484832-70484854 TTGAACAAAAGCAACTTTGTTGG - Intronic
932685599 2:73866694-73866716 CTGGCCAACAGCGAATTTAATGG + Exonic
937883433 2:126884933-126884955 GTGGCCCACAGCGGCTCTGTCGG - Intergenic
939881593 2:147637518-147637540 TTGGCCAACAGCATCTATGCTGG + Intergenic
940149889 2:150588288-150588310 TTGGCCAACAGCCAATTTGTAGG - Intergenic
943447705 2:188009438-188009460 CTGGCCAAGAGAGACTGTGTAGG + Intergenic
946020662 2:216637732-216637754 TTGGCCAAGAGCCATTGTGTGGG - Intronic
1170899014 20:20442301-20442323 TTGGCCAAGAGATACTTGGTGGG + Intronic
1183955353 22:41376935-41376957 TGGGGCAGCAGTGACTTTGTGGG - Intronic
953369846 3:42378116-42378138 TGAGCCAACAGCCACTTTGGTGG + Intergenic
954458658 3:50613427-50613449 TTGGCCAGAAGCCACTTTCTTGG + Intronic
955797747 3:62655422-62655444 ATGGCCAACAGAGATTTTTTTGG - Intronic
959572904 3:107904702-107904724 TTGGCTCACAGCCACTTTGAAGG + Intergenic
960019485 3:112932825-112932847 TTTGCCAACAGTGAGCTTGTGGG - Intronic
961302518 3:125931228-125931250 TTGGCCAAAAGGGACATGGTGGG + Intronic
961847685 3:129781233-129781255 TTGACCAACAGAGTATTTGTCGG - Intronic
961885951 3:130096555-130096577 TTGGCCAAAAGGGACATGGTGGG - Intronic
964503959 3:157378167-157378189 TTGGCCAACAGCGACTTTGTGGG + Intronic
967863009 3:194166992-194167014 GGGGCCAACAGCGTCCTTGTGGG + Intergenic
968995137 4:3940699-3940721 TTGGCCAAAAGGGACATGGTGGG - Intergenic
969758851 4:9168093-9168115 TTGGCCAAAAGGGACATGGTGGG + Intergenic
969818826 4:9705563-9705585 TTGGCCAAAAGGGACATGGTGGG + Intergenic
970530145 4:16973483-16973505 TTGGGCCACAGCGACTTCTTTGG + Intergenic
977135033 4:93293618-93293640 TTTGGCAACAACTACTTTGTAGG - Intronic
991410450 5:66340386-66340408 TTGACAAACAGCTGCTTTGTGGG + Intergenic
997024830 5:130046498-130046520 CTGGTGAACAGCTACTTTGTGGG + Intronic
999406843 5:151314204-151314226 TTGCCCAACAGGGACTCTGTAGG + Intergenic
1010344659 6:74797928-74797950 TTGGAAAACAGTGAATTTGTAGG + Intergenic
1017251320 6:152283277-152283299 TTGGCTAACAGTGACTAAGTAGG + Intronic
1018682583 6:166276108-166276130 TTGGACAACAGAGCCATTGTTGG - Intergenic
1020319400 7:6929022-6929044 TTGGCCAAAAGGGACATGGTGGG - Intergenic
1028111536 7:86948194-86948216 TTGGCCAACATCTATCTTGTAGG - Intronic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1034504172 7:151472851-151472873 TTGACCCACAGCGAGCTTGTAGG - Intronic
1034516770 7:151587158-151587180 TTGGCAAACAGCCACTTATTTGG + Intronic
1036055541 8:5249375-5249397 TTGGCAGCCAGAGACTTTGTGGG - Intergenic
1036847658 8:12180871-12180893 TTGGCCAAAAGGGACATGGTGGG - Intergenic
1036869026 8:12423186-12423208 TTGGCCAAAAGGGACATGGTGGG - Intergenic
1040613632 8:49012422-49012444 TAGGCCCACAGGGAATTTGTAGG + Intergenic
1044093889 8:88038157-88038179 TTGTACACCAGCTACTTTGTGGG - Exonic
1045116453 8:98988121-98988143 TGGGACAACAGCTACTTGGTTGG + Intergenic
1048374002 8:133805965-133805987 TTGAGCAACAGCAGCTTTGTTGG - Intergenic
1053556524 9:39143483-39143505 TTGGCCCCCAGCTAGTTTGTGGG - Intronic
1053820637 9:41963782-41963804 TTGGCCCCCAGCTAGTTTGTGGG - Intronic
1054089502 9:60831910-60831932 TTGGCCCCCAGCTAGTTTGTGGG - Intergenic
1054110913 9:61107468-61107490 TTGGCCCCCAGCTAGTTTGTGGG - Intergenic
1054609944 9:67223657-67223679 TTGGCCCCCAGCTAGTTTGTGGG + Intergenic
1056276066 9:84995443-84995465 TTGGGCAACTGGGATTTTGTAGG - Intronic
1061681397 9:132244136-132244158 TTGGACAACTGAGGCTTTGTGGG - Exonic
1187194284 X:17067719-17067741 TTGGCAAACACCCACATTGTGGG + Intronic
1187254586 X:17630517-17630539 TTGGCCAACAGCAAGTCTCTGGG - Intronic
1190925341 X:54898703-54898725 TTGGACAACATCCACTTTGTTGG - Intergenic
1200215408 X:154366025-154366047 TTGGCCAACAGTGACAGTGTAGG + Exonic