ID: 964505584

View in Genome Browser
Species Human (GRCh38)
Location 3:157395424-157395446
Sequence ACATGGACGTCCACTCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 7, 2: 199, 3: 281, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964505584_964505588 16 Left 964505584 3:157395424-157395446 CCTTTGTGAGTGGACGTCCATGT 0: 1
1: 7
2: 199
3: 281
4: 243
Right 964505588 3:157395463-157395485 AACCTCCTTCTCTGACACCATGG 0: 1
1: 0
2: 25
3: 272
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964505584 Original CRISPR ACATGGACGTCCACTCACAA AGG (reversed) Intronic
900285599 1:1898444-1898466 ACATGCACGTGTACACACAAGGG + Intergenic
900729740 1:4248395-4248417 ACATGGTCCTCAACTTACAATGG - Intergenic
900756596 1:4439488-4439510 ACAGGGACCCCCACTGACAAAGG - Intergenic
900838557 1:5027451-5027473 GTATCCACGTCCACTCACAATGG + Intergenic
901903792 1:12390774-12390796 ACATGGACTTCCACTCCCCAAGG - Intronic
902791112 1:18768718-18768740 ACATGCACGCACACACACAACGG + Intergenic
904179317 1:28654755-28654777 ACATGGACTTCCACTCACCAAGG - Intergenic
904336063 1:29798890-29798912 ACATGGACTTCCACTCGCCAAGG + Intergenic
905354201 1:37369684-37369706 ACATGGACTTCCACTCACCAAGG + Intergenic
905465357 1:38149005-38149027 ACAGGGACTTCCACTCACCAAGG + Intergenic
906050614 1:42868312-42868334 ACATGGACTTCCACTCACCAAGG + Intergenic
906054813 1:42907249-42907271 GCATGGACCTCCACTCACCAAGG - Intergenic
906770931 1:48482492-48482514 ACTTTCACATCCACTCACAACGG - Intergenic
906867880 1:49441924-49441946 ACATGGACTTCCACTCACCACGG + Intronic
906879784 1:49577356-49577378 ACATGGACTTCCACTCAGTGAGG + Intronic
906930797 1:50167623-50167645 ACATGGACTTCCACTCACCAAGG - Intronic
906996007 1:50795122-50795144 ACATGGACTGCCCCTCACCAAGG + Intronic
907359423 1:53902772-53902794 ACAGGGACCTACACTCAAAAGGG + Intronic
907597476 1:55733022-55733044 ACATGTACTTCCACTCACCAAGG + Intergenic
907601994 1:55781300-55781322 ATGTGGACTTCCACTCACCAAGG - Intergenic
907662325 1:56404776-56404798 AAATGAACGTCCGCTCACACAGG + Intergenic
907780467 1:57561737-57561759 ACATGGACTTCCACTCACCAAGG + Intronic
908052438 1:60247613-60247635 ACATGGACTTCCACTCACCAAGG + Intergenic
909032762 1:70561394-70561416 ACATGAACTTCCACTCACCAAGG - Intergenic
909172477 1:72314563-72314585 ACATGGACTTCCACTTACCAAGG - Intergenic
909548825 1:76876296-76876318 ACATGGAATTCCACTCACCAAGG - Intronic
909781345 1:79551194-79551216 ACATGGATTTCTACTCACCAAGG + Intergenic
909811071 1:79932231-79932253 AAATGGACTTCCACTTACCAAGG + Intergenic
909858791 1:80576144-80576166 GCATGGACTTCCACTAACCAAGG - Intergenic
910370764 1:86513033-86513055 ACATGGACTTCCATTCACCAAGG + Intergenic
910562020 1:88600871-88600893 ACATGGACTTCCACTTACCAAGG + Intergenic
910565433 1:88637956-88637978 ACATGCACTTCAACTCACCAAGG - Intergenic
910588345 1:88902622-88902644 AAATGGACTTCCACTCACGAAGG + Intergenic
910630341 1:89347166-89347188 ACATGGACTTTCACTTACCAAGG + Intergenic
910638859 1:89439072-89439094 ACATGGACTTCCACTCACCAAGG - Intergenic
910830973 1:91462519-91462541 ACATGGACTTCCACTCACCAAGG - Intergenic
910948337 1:92617610-92617632 ACATGGATTTCCACTCACCAAGG + Intronic
911109043 1:94163802-94163824 ACATGGACTTCCACTCACCAAGG - Intronic
911257213 1:95646460-95646482 ACATGGACTTCCACTCACCAAGG - Intergenic
911738271 1:101361029-101361051 ACATGAACTTCCACTCATGAAGG - Intergenic
911883697 1:103271364-103271386 ACGTGGACTTCCACTCACCAAGG + Intergenic
912067141 1:105757854-105757876 ACATGGACTTCCACTCAGCAAGG + Intergenic
912129786 1:106587155-106587177 ACGTGGACTTCCACTCACCAAGG - Intergenic
912212375 1:107569758-107569780 ACATGGACTTCCACTCACCAAGG + Intergenic
912733201 1:112127931-112127953 ACATGGATTTCCACTCACCAAGG - Intergenic
912943681 1:114067304-114067326 TCACGGACTTCCACTCACCAAGG - Intergenic
913039319 1:115007496-115007518 ACATGGGCTTCCACTCACCAAGG - Intergenic
913393978 1:118346030-118346052 GCATGGACTCCCACTCACAAAGG + Intergenic
914965388 1:152253004-152253026 ACATGAACTTCCACTCATCAAGG - Intergenic
915265990 1:154718189-154718211 AGCTGGACTTCCATTCACAAAGG - Intronic
915667553 1:157458771-157458793 ACATGGACTTCCATTCACCAAGG - Intergenic
916106069 1:161433396-161433418 ATATGGACTTCCACTCACCAAGG - Intergenic
916285457 1:163100421-163100443 ACATGGACTTCTACTCACAAAGG + Intergenic
917217092 1:172690005-172690027 ACATGGACTTCCACTTACCAAGG - Intergenic
917247878 1:173024226-173024248 ACATGGACTTCCAGTTACTAAGG - Intergenic
917353699 1:174104742-174104764 ACATGCATGTCCTCTCACTAAGG + Intergenic
917462828 1:175247059-175247081 ACATGGACTTCTACTCACCAAGG + Intergenic
917764663 1:178202913-178202935 ACATGGACTTCCACTTACCAAGG + Intronic
918634270 1:186756049-186756071 ACATGGACGTCCACTCACGAAGG - Intergenic
918755584 1:188336911-188336933 ACATGGACTTCCACTCATCAAGG - Intergenic
918774625 1:188611649-188611671 ACATGGACTTCCACTTACCACGG + Intergenic
918783347 1:188731665-188731687 ACATAGACTTCTACTCACCAAGG - Intergenic
918815183 1:189172124-189172146 ACATGGACTTCCACTCACCAAGG + Intergenic
918918112 1:190670983-190671005 AAATGGACTTCCACTCACCAAGG - Intergenic
918958360 1:191238835-191238857 ACATGGACTTCCACTCACCAAGG + Intergenic
919000609 1:191826974-191826996 ACATGGACTTCCACTCATGAAGG - Intergenic
919124250 1:193377065-193377087 ACATGGACTTCCACTAAACAAGG - Intergenic
919241890 1:194925107-194925129 ACATGGAATTCCACTCACCAAGG + Intergenic
919318095 1:196000232-196000254 ACATGGACTTCCACTCACCAAGG + Intergenic
919330329 1:196162829-196162851 ATATGGACTTCAACTCACCAAGG + Intergenic
920197559 1:204239258-204239280 ACATGGACTTCCACTCACCAAGG + Intronic
922499501 1:226086042-226086064 ACATGGACTTCCCCTCACCAAGG - Intergenic
922780925 1:228251700-228251722 GCATGGACTTCCACTCACCAAGG - Intronic
923253449 1:232198549-232198571 ACATGGACTTCCACTCACCAAGG - Intergenic
923926073 1:238628916-238628938 ACATGGACCTCCACTGACCAAGG - Intergenic
924182408 1:241452338-241452360 ACATGGACTTTCACTCACCAAGG - Intergenic
924477169 1:244392547-244392569 ACATGGACTTCAACTCACCAAGG - Intergenic
924492083 1:244548309-244548331 ACATGGACTTCCACTGACCAAGG + Intronic
924840646 1:247706928-247706950 ACATGGACTTCCACTCACCAAGG - Intergenic
1062786997 10:273073-273095 ACATGTCAGTGCACTCACAATGG - Intergenic
1063788245 10:9409407-9409429 ACATGGACTGCCACTCACCAAGG + Intergenic
1065453627 10:25883651-25883673 GCATGGACTTCCACTCACCAAGG + Intergenic
1065607131 10:27429388-27429410 ACATCGACTTCCACTCACCAAGG + Intergenic
1066166898 10:32798326-32798348 ATGTGGACTTCCACTCACCAAGG - Intronic
1066169562 10:32827223-32827245 ATGTGGACTTCCACTCACCAAGG + Intronic
1067125426 10:43511644-43511666 ACATGGACTTCCACTCACCGAGG - Intergenic
1067519064 10:46981373-46981395 ACATGGACTTCCACTCACCAAGG + Intronic
1067643181 10:48070461-48070483 ACATGGACTTCCACTCACCAAGG - Intergenic
1067754226 10:48992816-48992838 ACATGGACTTCCACTCACCAAGG - Intergenic
1068007545 10:51408678-51408700 ACACGGACTTCCACTCACTAAGG - Intronic
1068447322 10:57139496-57139518 ACATGGACTTCCGCTCACCAAGG + Intergenic
1068909020 10:62358529-62358551 AAGTGGACTTCCACTCACTAAGG + Intergenic
1069145878 10:64891328-64891350 ACATAGACTTCCATTCACCAAGG + Intergenic
1071266950 10:83973102-83973124 ACAGGGACTTCCACTCACCAAGG - Intergenic
1071308636 10:84322954-84322976 ACATGGACTTCCACTCACCAAGG + Intergenic
1071364357 10:84883621-84883643 ACATGGACTTCCACTCACAAAGG - Intergenic
1071378505 10:85034261-85034283 ACATGGGCTTCCACCCACCAAGG + Intergenic
1071942657 10:90606872-90606894 ACATGGACTTCCACTCACCAAGG - Intergenic
1071950704 10:90700174-90700196 ACATGAACTTCCACTCACCAAGG - Intergenic
1072361960 10:94668366-94668388 ACATGGACTTCCACTAACCAAGG - Intergenic
1073557478 10:104466795-104466817 ACATGGGCTTCCACTCACCAAGG + Intergenic
1073600743 10:104843749-104843771 ACATTGACGTGCAGTCACACTGG + Intronic
1073656553 10:105423590-105423612 ACATGGGCTTCCACTCACCAAGG - Intergenic
1073995749 10:109313834-109313856 ACATGGACTTCCACTCACCAAGG - Intergenic
1075606916 10:123818307-123818329 ACATGTACTCCCACTCACCAAGG + Intronic
1077401377 11:2359664-2359686 ACATGGACTTCCACTGACCAAGG + Intergenic
1077425110 11:2472315-2472337 ACATGCACGTATACACACAAAGG - Intronic
1079243530 11:18737370-18737392 ACAGGGACATCCACTCCCACAGG - Intronic
1080020041 11:27550780-27550802 ACATGGACTTCCGCTCACCTAGG - Intergenic
1080076721 11:28158393-28158415 ACATGGACTTCCACTCACCAAGG + Intronic
1080142810 11:28942898-28942920 ACATGGCCGGCCAGGCACAATGG - Intergenic
1081065347 11:38534016-38534038 ACATGGAATTCCACTTACCATGG - Intergenic
1081072914 11:38632073-38632095 ACATGGACTTCCACTCACCAAGG + Intergenic
1081110650 11:39129613-39129635 ACATGGACTTCCACTCACCAAGG + Intergenic
1081378410 11:42386805-42386827 ACATGGACTTCCACTCACCAAGG + Intergenic
1081609187 11:44548756-44548778 ACACGGACTTCCACTCACCAAGG + Intergenic
1082691701 11:56312776-56312798 ACATGGACTTCCACTCATGAGGG + Intergenic
1082920349 11:58485802-58485824 ACATGGACCTTCACTTACCAAGG + Intergenic
1083134119 11:60655401-60655423 ACATGGGCTTCCACTCACCAAGG + Intergenic
1085684790 11:78611744-78611766 ATATGGACTTCTACTCACCAAGG + Intergenic
1086141506 11:83505325-83505347 ACATGGGCTTCCACTCACCAGGG - Intronic
1086278730 11:85161326-85161348 ACATGCAGTTCCACTCACCAAGG + Intronic
1086834246 11:91601262-91601284 ACATGGACTTCCACTCACTAAGG + Intergenic
1087374138 11:97321422-97321444 ACATGAACTTCCACTTACCAAGG + Intergenic
1087970120 11:104470319-104470341 ACATGTACGTGCACACACACAGG - Intergenic
1088265545 11:107984478-107984500 ACATGGACTTCCACTCACCAAGG + Intergenic
1088407491 11:109497787-109497809 ACATAGACTTCCACTCACCAAGG - Intergenic
1088836784 11:113584258-113584280 ACATAGACTTCCACTCACCAAGG + Intergenic
1089903740 11:122014490-122014512 ACATGGACTTCCACTTACCAAGG + Intergenic
1090119071 11:124005517-124005539 ACATGGACTTCCATTCGCCAAGG - Intergenic
1090209365 11:124907179-124907201 ATATGGACTTCCACTCACCAAGG - Intergenic
1090221484 11:125030724-125030746 ACATGGACTGCCACTCACCAAGG - Intronic
1090575235 11:128095077-128095099 ACATGGACTTCCACTCAACAAGG + Intergenic
1091051871 11:132379632-132379654 ACATGGACTTTCACTCACCAAGG + Intergenic
1092093407 12:5822512-5822534 ACATGGACTTCCACTCACCAAGG + Intronic
1092272521 12:7034569-7034591 ACATGGACTTCCACTCACCAAGG + Intronic
1092381672 12:8001801-8001823 ACATGGACTTCCACTCACCAAGG + Intergenic
1093031739 12:14295057-14295079 CCATGGACTTCCACTCACCAAGG - Intergenic
1093036470 12:14336553-14336575 CCATGGACTTCCACTCACCAAGG + Intergenic
1093048814 12:14484198-14484220 ACATGGACTTCCACTTACCAAGG - Intronic
1093049549 12:14490096-14490118 ACATGGACTTCCACTTACCAAGG - Intronic
1093964663 12:25311829-25311851 ACATGAACTTCCACTCACCAAGG + Intergenic
1093981484 12:25479920-25479942 ACATGGACTTCCACTCGCCAAGG - Intronic
1094102656 12:26780140-26780162 ATATGGACTTCCACTCGCCAAGG + Intronic
1094389667 12:29935345-29935367 ACATGGACTTCCACTCACCAAGG - Intergenic
1094523506 12:31217230-31217252 ACATGGTCGTCGACTCTCCAAGG + Intergenic
1095121386 12:38423961-38423983 ACATGGATTTTCACTCACAAAGG - Intergenic
1095548774 12:43407369-43407391 ACATGTATGTACACTCATAATGG + Intronic
1095603976 12:44045213-44045235 ACAACGACTTCCACTCACCAAGG + Intronic
1095844263 12:46729096-46729118 ACATGGACTTCCACTCATCAAGG - Intergenic
1095856130 12:46862798-46862820 ACATAGACTTCCACTCACCAAGG - Intergenic
1096288898 12:50324128-50324150 ACATGGACTTCCACTCACCAAGG + Intergenic
1096457335 12:51798570-51798592 ACATGGACTCCCACTCATCAAGG - Intronic
1096735094 12:53647004-53647026 ACATAGACTTCCACTCACCAGGG + Intronic
1097077122 12:56403277-56403299 ACATGGACATCCACTCATTAAGG + Intergenic
1097305775 12:58067470-58067492 ACATGGACTTCCACTCACTATGG + Intergenic
1097437707 12:59571378-59571400 ACATGGACTTCCACTCACCAAGG - Intergenic
1097564524 12:61251570-61251592 ACATGGGCTTCCACTCACCAAGG - Intergenic
1097821226 12:64131030-64131052 ACATGGACTTCCACTCACCAAGG - Intronic
1098158494 12:67624451-67624473 ACATAGATGTCCACTCACCAAGG + Intergenic
1098716222 12:73830682-73830704 ATATGGACTTCTACTCACCAAGG + Intergenic
1098731178 12:74038214-74038236 AGAGGGACTTCCACTCACCAAGG + Intergenic
1098749960 12:74280474-74280496 ACATGGACTTCCACTCACCAAGG + Intergenic
1098807292 12:75035808-75035830 ACATGGACTTCTACTCACCAAGG + Intergenic
1098831787 12:75373154-75373176 TCATGGACTTCCACTCACCAAGG - Intronic
1099183264 12:79491726-79491748 AGATGGACTTCCACCCACCAAGG - Intergenic
1099366054 12:81766258-81766280 ACATGGACTTCCACTCACCAAGG + Intergenic
1099401084 12:82204489-82204511 ACGTGGACTTCCACTCACCAAGG - Intergenic
1099508692 12:83508062-83508084 ATGTGGACTTCCACTCACCAAGG + Intergenic
1099526485 12:83723971-83723993 ACATGGACGTCCACTCACCAAGG + Intergenic
1099578187 12:84406276-84406298 ACATGGATTTCCACTCACTAAGG + Intergenic
1099700762 12:86078672-86078694 ACACGGACTTCCACTCACCAAGG - Intronic
1099735909 12:86565913-86565935 ACATGGACTTCCACTCACCAAGG + Intronic
1099804326 12:87498746-87498768 ACATGGACTTCCACTTACAAAGG - Intergenic
1099813628 12:87618387-87618409 ACATGTACTTCCACTCATCAAGG - Intergenic
1100241017 12:92710729-92710751 AAGTGGACTTCCACTCACCAAGG - Intergenic
1101264263 12:103066994-103067016 ACATGGACTTCCGCTCACTAAGG + Intergenic
1101534538 12:105605228-105605250 ACATGGACTTCTACTCACCAAGG - Intergenic
1103035748 12:117654950-117654972 ACATGGACTTCCACTCACCAAGG + Intronic
1104147919 12:126053540-126053562 ACATCGACTTCCACTCACCAAGG + Intergenic
1104482036 12:129115906-129115928 ACATGGAGGGGCCCTCACAAAGG + Intronic
1105384127 13:19914414-19914436 ACATGAACTTCCACTCTCCAAGG + Intergenic
1105740240 13:23316059-23316081 ACATGGACTTCCGCTCACCAAGG + Intronic
1105852638 13:24349427-24349449 ACATGGACTCCCACTCACGAAGG - Intergenic
1108166932 13:47702898-47702920 ACATGGACTTCCACTCACCAAGG + Intergenic
1108914186 13:55588010-55588032 ACATGGACTTGCACTTACCAAGG - Intergenic
1109293347 13:60500993-60501015 ACATGGAACTCCACTCACCAAGG + Intronic
1109307251 13:60654478-60654500 ACATGGACTTTTACTCACCAGGG + Intergenic
1109519148 13:63485679-63485701 ACATGGACTTCCACTTACCAAGG + Intergenic
1109705148 13:66079889-66079911 ACATGGACTTCCACTCACTAAGG + Intergenic
1109712563 13:66179955-66179977 ACATGGACTTCCACTTACCAAGG - Intergenic
1109950899 13:69501333-69501355 ACATGGACTTCCGCTCACCAAGG - Intergenic
1110377287 13:74807389-74807411 ACATAGACTTCCACTCACCAAGG + Intergenic
1110815550 13:79856752-79856774 ACATGGACTTCCATTCACCAAGG + Intergenic
1110834017 13:80063752-80063774 ACATGGACTTCCACTCACCAAGG - Intergenic
1111057670 13:82972147-82972169 ACATGGACTTCCACTCACCAAGG - Intergenic
1111198655 13:84905764-84905786 ACATGGACTTCCACTAGCCAAGG + Intergenic
1111317621 13:86582677-86582699 ACATGGACTTCCACCAACCAAGG + Intergenic
1111515835 13:89329431-89329453 ACATGGACTTCCACTCACTAAGG - Intergenic
1111535317 13:89596049-89596071 ACATGGACTTCGACTCACCAAGG + Intergenic
1112230999 13:97589293-97589315 ACATTGACTTCCACTCATCAAGG - Intergenic
1112249810 13:97769426-97769448 ACATGGACTTCCACTCACCAAGG - Intergenic
1112810089 13:103207861-103207883 ACATGGCCTTCCTTTCACAAGGG - Intergenic
1112981774 13:105393748-105393770 ACATGGACTTACACTCACCAAGG - Intergenic
1113037177 13:106062903-106062925 ACATGGACATACACTCATAGAGG + Intergenic
1113319574 13:109220796-109220818 ATATGGGCTTCCACTCACCAAGG - Intergenic
1113334395 13:109364235-109364257 ACATGCAAGTCCACTGACATCGG + Intergenic
1113396261 13:109950410-109950432 ACATGGACTTTCACTTACCAAGG + Intergenic
1114205988 14:20571645-20571667 ACATGGACATCCACTCACCAAGG + Intergenic
1114413880 14:22526022-22526044 ACATGGCCCTCCACCCAGAATGG + Intergenic
1114758130 14:25283002-25283024 ACATGGACTTCCACTTACCAAGG - Intergenic
1114965521 14:27954800-27954822 ACATGGACTTCCACTCACTAAGG - Intergenic
1115070856 14:29320234-29320256 ACATGGACTTCCACTTACCAAGG + Intergenic
1115130810 14:30050136-30050158 ACATGGACTTTCACTCACCAAGG + Intronic
1116059026 14:39897804-39897826 ACATAAACTTCCACTCACAAAGG + Intergenic
1116068213 14:40010046-40010068 ACATGGACTTCCACTCACTAAGG + Intergenic
1116158260 14:41235781-41235803 ACATGGACTTTCACTCACCAAGG - Intergenic
1116218638 14:42053403-42053425 ACACGGACTTCCACTCACCAAGG + Intergenic
1116415186 14:44670172-44670194 ATATGGACTTCCACTCACCAAGG + Intergenic
1116531339 14:45977362-45977384 ACATGGACTTCCACTCACCAAGG - Intergenic
1117216974 14:53561052-53561074 ACATGGACTTCCACTCACCAAGG + Intergenic
1117596150 14:57329006-57329028 ACATGGACTCCCACTCACCAAGG - Intergenic
1117634261 14:57725253-57725275 ACATGGACTTCCACTCACCAAGG + Intronic
1118122314 14:62859301-62859323 ACATGGACTTCCACTCACCAAGG - Intronic
1118501948 14:66370261-66370283 ACATGGACTCCCACTCACCAAGG + Intergenic
1118880649 14:69823138-69823160 ACATGGACTTCCACTCACCAAGG - Intergenic
1118950630 14:70433696-70433718 ACATGGACTTCCACTTACCAAGG - Intergenic
1119059581 14:71461318-71461340 ACATGGACTTCCACTCACCAAGG - Intronic
1119107433 14:71937965-71937987 ACACGGACTTCCACTCACCAAGG - Intronic
1120081895 14:80226655-80226677 ACATGGACTTCCACTCACCAAGG - Intronic
1120973824 14:90231675-90231697 ACATGGACTCCCACTCACTAAGG + Intergenic
1121070597 14:91017096-91017118 ACATGGACTTCTACTCACCAAGG + Intronic
1122841327 14:104465179-104465201 ACATGGACTCCCATTCACCAAGG - Intergenic
1202935361 14_KI270725v1_random:82821-82843 ATGTGGACTTCCACTCACCAAGG - Intergenic
1123877805 15:24641476-24641498 ACAGGGACTTTCACTCACCAAGG - Intergenic
1124509685 15:30312904-30312926 ACACGGACTTCCACTCACCAAGG + Intergenic
1124571800 15:30871192-30871214 ACATGGACTTTCACTCACCAAGG + Intergenic
1124733873 15:32225758-32225780 ACACGGACTTCCACTCACCAAGG - Intergenic
1126283722 15:46987132-46987154 ACATGAACTTCCACTCACCAAGG + Intergenic
1128642922 15:69353103-69353125 ACATTGACTTCCACTCACTGAGG + Intronic
1130131994 15:81151427-81151449 ACATGGACTTCCACTCACCAAGG - Intergenic
1131724140 15:95203677-95203699 ACATGGACTTCCACTCAGCAAGG + Intergenic
1134514451 16:14875408-14875430 ACATTTACCTCCACTGACAACGG - Exonic
1134702127 16:16274061-16274083 ACATTTACCTCCACTGACAACGG - Exonic
1134969703 16:18520589-18520611 ACATTTACCTCCACTGACAACGG + Exonic
1135061511 16:19275091-19275113 ACATGGACTTCCACTCACCAAGG - Intergenic
1136136059 16:28257648-28257670 ACATGCACCACCATTCACAATGG - Intergenic
1138868499 16:60851661-60851683 ACATGGAATTCCACTCACCAAGG + Intergenic
1139359897 16:66391043-66391065 ACATGGATGGCCACTGACACTGG + Intronic
1140393998 16:74611619-74611641 GCATGGACTCCCACTCACCAAGG - Intergenic
1141559423 16:84857161-84857183 ACATGGACCTCCACCCACCAAGG - Intronic
1142571973 17:880682-880704 CCAAGGACGTCCACTCACAGGGG + Intronic
1146758556 17:35455009-35455031 ACATGGACTTCCACTCACCAAGG + Intergenic
1148790602 17:50170553-50170575 ACACAGACCTCCACTCACATTGG + Intronic
1149427198 17:56566544-56566566 ACATAGACTTCCACTCACCAAGG + Intergenic
1149628441 17:58097688-58097710 ACATGGACTTCCACTCACTAAGG - Intergenic
1150170401 17:62987678-62987700 TCCTGGACTTCCAGTCACAACGG + Intergenic
1151037677 17:70820721-70820743 ACATGGACTTCCACTCACCAAGG - Intergenic
1152778982 17:82218180-82218202 CCTTGGCCGTCCACTCACCAGGG - Intergenic
1153131152 18:1856848-1856870 ACATGGACTTCCACTCACCAAGG - Intergenic
1153216106 18:2822346-2822368 ACATGGACTTCCACTCACCAAGG - Intergenic
1154273189 18:12937418-12937440 ATATGGACTTCCACCCACTAAGG - Intergenic
1155316785 18:24579695-24579717 ACATGCACGTGCACACACAGTGG + Intergenic
1156303980 18:35859569-35859591 ACATGGACTTCCACTCATCAAGG + Intergenic
1156546345 18:37967420-37967442 ACATGCACTCCCACTCACCAAGG + Intergenic
1157341331 18:46780886-46780908 ACATGAACTTCCACTCATTAAGG + Intergenic
1157870816 18:51228720-51228742 ACATGAACTTACACTCACCAAGG - Intergenic
1157998378 18:52587250-52587272 ACATAGACTTCCACTCACCAAGG - Intronic
1159272376 18:66169120-66169142 ACATGGACATCCACTCATCACGG - Intergenic
1159287898 18:66376339-66376361 ACATGGACTTCCACTCACCAAGG + Intergenic
1159293262 18:66449670-66449692 ACATGGACTTCCACTCCTGAAGG + Intergenic
1159558983 18:69974489-69974511 ACATGGACTTCCACTCACCAAGG - Intergenic
1159711411 18:71764995-71765017 GCATGGACTTCCACTCACCAAGG + Intronic
1160074463 18:75659122-75659144 ACATGCATGTCCACACACACAGG + Intergenic
1160092568 18:75840889-75840911 ACATGGACTTCCACTCACCAAGG + Intergenic
1160126117 18:76173542-76173564 ACAAGGACGTCCCCGCAGAATGG + Intergenic
1160582177 18:79889347-79889369 GCCTGGATGTCCACACACAAAGG - Intronic
1161397720 19:4053255-4053277 ACCGGGATGTCCACCCACAAGGG + Intronic
1167951745 19:53033115-53033137 ATATGGACTTCCATTCACCAAGG + Intergenic
1168539208 19:57196531-57196553 ACATGGACTTCCACTTACCAAGG - Intronic
925280079 2:2677736-2677758 ACATGGACTTCCACTCACTGAGG + Intergenic
925581655 2:5417229-5417251 ATATGGACCTCCACTCATCAAGG + Intergenic
926810272 2:16749803-16749825 ACATTGACTTCCACTCATTAAGG - Intergenic
926826890 2:16914529-16914551 GCATGGACTTTCACTCACCAAGG + Intergenic
927008837 2:18880599-18880621 ACATGGACTTCCACTTACCGAGG + Intergenic
927660543 2:24989504-24989526 ACATGGACTTCCACTCACCAAGG + Intergenic
928187347 2:29124095-29124117 ATCTGGACCTACACTCACAAAGG - Intronic
929269703 2:39959924-39959946 ACATGGACTTCTACTCACCAAGG - Intergenic
930536500 2:52651391-52651413 ACATGGACTTCCACTCATCAAGG - Intergenic
932870574 2:75394210-75394232 ACATGGGCTTCCACTCACCAAGG - Intergenic
933265569 2:80177500-80177522 ACACGGACTTCCACTCACCAAGG - Intronic
933394348 2:81712483-81712505 ACATGGACTTCCACTCACCAAGG - Intergenic
934305862 2:91821469-91821491 ATGTGGACTTCCACTCACCAAGG + Intergenic
934327394 2:92031273-92031295 ATGTGGACTTCCACTCACCAAGG - Intergenic
934465777 2:94261853-94261875 AGGTGGACTTCCACTCACCAAGG - Intergenic
934674130 2:96237625-96237647 ACATGGACCGTCACTCACAAGGG + Intergenic
935184069 2:100715772-100715794 ACATGGACTTTCACTCACCAAGG + Intergenic
935424984 2:102910451-102910473 ACATGGACTTCCACTCACCAAGG - Intergenic
936084868 2:109460445-109460467 TCATGGATTTCCACTCACCATGG - Intronic
936562926 2:113557441-113557463 ACATGGACATTCGCTCACCAAGG - Intergenic
936646250 2:114376095-114376117 ACATGGACTTTCACTCACCAAGG - Intergenic
937765755 2:125658859-125658881 ACATGGACTTCCACTCACCAAGG + Intergenic
937785075 2:125886853-125886875 ACATGGACTTCCACTCACCAAGG - Intergenic
937841410 2:126528042-126528064 ATATGGACTTCCACTCACCATGG - Intergenic
937852447 2:126647861-126647883 ACATGGACTTCCATTCACCAAGG - Intergenic
939213992 2:139213112-139213134 ACATGGACTTCCACTCACCAAGG + Intergenic
939788557 2:146545242-146545264 ACATGGACTTCCACTCACTAAGG - Intergenic
940171186 2:150831835-150831857 ACATGGACTTCCACTAACCAAGG - Intergenic
940359404 2:152781465-152781487 GCATGGACTTCCACTCACCAAGG - Intergenic
940471970 2:154112245-154112267 ACATGGACTTCCACTCACCAAGG - Intronic
940544256 2:155062947-155062969 ACATGAACTTCCACTCATCAAGG - Intergenic
940605797 2:155923413-155923435 ACATGGACTTGCACTCATCAAGG - Intergenic
941228382 2:162877757-162877779 ACAATGTTGTCCACTCACAATGG - Intergenic
941330537 2:164173689-164173711 ACATAGACATCCACTCACTAAGG - Intergenic
941525704 2:166603998-166604020 ACATGGACTTTCACTCACGAAGG - Intergenic
941668145 2:168262004-168262026 ACATGGATTTCCACTCACCAAGG + Intergenic
942322064 2:174744381-174744403 ACATGGACTTCCACTCACCGAGG + Intergenic
942829826 2:180226362-180226384 ACATATACTTCTACTCACAAAGG - Intergenic
943189303 2:184655371-184655393 ACATGGATATCCACTAAAAAGGG + Intronic
943207501 2:184919383-184919405 ATGTGGACTTCCACTCACCAAGG - Intronic
943317800 2:186411443-186411465 ACATGGACTTCCACTCACTAAGG - Intergenic
943383948 2:187180218-187180240 ACTTGGACTTACACTCACCAAGG - Intergenic
943517472 2:188906381-188906403 ACATGGACTTCCACTCACCAAGG - Intergenic
943718766 2:191180801-191180823 ACATGGACTCCCTCTCACTAAGG - Intergenic
945544978 2:211138984-211139006 ACATGGACTTTCACTCACCAAGG + Intergenic
945642303 2:212444712-212444734 ACATGGATTTCCACTCACCAAGG + Intronic
945717715 2:213379795-213379817 ACATGGACTTCCACTGACCATGG - Intronic
945725725 2:213470627-213470649 ACATGGATTTTCACTCACCAAGG - Intronic
946703633 2:222436919-222436941 ACACGGACTTCCACTCACCAAGG - Intronic
947440970 2:230121128-230121150 ACATGGACTTTCACTCACCAAGG + Intergenic
948594686 2:239072407-239072429 ACATGGACCTACTCACACAAGGG - Intronic
1170666766 20:18393316-18393338 ACATGCCTGTCCACTCACACAGG + Intronic
1171315979 20:24195087-24195109 ACATGGACTTCCACTCACCATGG + Intergenic
1171329943 20:24328768-24328790 ACATGGACTTCTACTCACCAAGG - Intergenic
1171436249 20:25126820-25126842 ACATGGACTTCCACTCACCAAGG + Intergenic
1176596781 21:8705057-8705079 ATGTGGACTTCCACTCACCAAGG - Intergenic
1176998291 21:15581142-15581164 ACATGGACTTCCACTCACCAAGG + Intergenic
1177139298 21:17341390-17341412 ACATGGACTTCCACTCACCAAGG - Intergenic
1177505443 21:22013330-22013352 ACATGAACTTCCATTCACAAAGG - Intergenic
1177913299 21:27057084-27057106 ATATGGACTTCCAGTCACCAAGG + Intergenic
1178005920 21:28219558-28219580 ACATGGACTTCCACTCACCAAGG - Intergenic
1178012783 21:28306054-28306076 ACACGGACTTCCACTCACCAAGG + Intergenic
1178063191 21:28874507-28874529 ACGTGGACTTCTACTCACCAAGG - Exonic
1179415020 21:41191662-41191684 ACATGGACTTCCACTCACCAAGG - Intronic
1179707517 21:43190823-43190845 ACATGGACGTCCACAGGCAAGGG - Intergenic
1180279701 22:10682499-10682521 ATGTGGACTTCCACTCACCAAGG - Intergenic
1180586919 22:16901029-16901051 ATGTGGACTTCCACTCACCAAGG - Intergenic
1180591027 22:16937491-16937513 ATGTGGACTTCCACTCACCAAGG - Intergenic
1181367268 22:22387656-22387678 ACATGGACTTCCACTCTCCAAGG - Intergenic
1182965831 22:34520173-34520195 ACATCGACTTCCACTCACCAAGG + Intergenic
1183616613 22:38949810-38949832 ACATGAAGGTCCACTCCAAAAGG - Intergenic
1184603440 22:45557491-45557513 ACATGGACTTCCACTCACCAAGG - Intronic
1184638560 22:45856158-45856180 ACATGGAATTCCACCCACCAAGG - Intergenic
949125542 3:442237-442259 ACATGGACTTCCACTCACCAAGG - Intergenic
949169913 3:985726-985748 ACATGGACTTCCACTCACAAAGG - Intergenic
949245997 3:1925799-1925821 ACATGGACTTCCATTCTCCAAGG + Intergenic
949417455 3:3830014-3830036 ACATGGACTTCTGCTCACCAAGG - Intronic
949445735 3:4131933-4131955 ACATGGACTTTCACTCACCAAGG + Intronic
949639029 3:6014390-6014412 ACATGGACCTGCACTCATCAAGG + Intergenic
949906037 3:8859243-8859265 ACATGGACTTCCACTCTCCAAGG + Intronic
951003689 3:17593361-17593383 ACATGGACTTCCACTCACCAAGG + Intronic
951291401 3:20875868-20875890 ACATGCACTTCCACACACCAAGG - Intergenic
951384636 3:22028393-22028415 ACATGTACTTCCACTCACCAAGG + Intronic
951970643 3:28441012-28441034 ACATCAACTTCCACTCACCAAGG - Intronic
953805020 3:46061336-46061358 ACATGGACTTACACTCACCAAGG - Intergenic
954054284 3:48008814-48008836 ACATGGACTTCCACTCACCAAGG + Intronic
954511360 3:51128791-51128813 ACATGGACTTCCACTCACCAAGG - Intronic
956306988 3:67836505-67836527 ACATGGACTTCCACTCACCAAGG + Intergenic
956509791 3:69981240-69981262 ACATGGGCTTCCACTCACCAAGG + Intergenic
956703778 3:71982027-71982049 ACATGGACTTCCACTCATCAAGG - Intergenic
956782992 3:72619073-72619095 CCATGGACCTCTACTCTCAAGGG + Intergenic
957421751 3:79980201-79980223 ACATGGACTTCCACTCAATGCGG - Intergenic
957754712 3:84470301-84470323 ACATGGACTTCCACTCACCATGG + Intergenic
958258890 3:91355857-91355879 ACATGGACTTCCACTCACCAAGG - Intergenic
958845664 3:99261548-99261570 ACAAGTAAGTCCACTCACAAAGG - Intergenic
958934431 3:100241486-100241508 ACATGGACTTCCACTCACCAAGG + Intergenic
959226656 3:103596406-103596428 ACATGGACTCCCACTCACCAAGG - Intergenic
959439633 3:106360057-106360079 ACATGGACTTCCACTCACCAAGG + Intergenic
959745894 3:109776401-109776423 ACATGGACTTCCCCTCACCAAGG - Intergenic
959793553 3:110394258-110394280 ACATAGACTTCCACCCACCAAGG - Intergenic
959997991 3:112699194-112699216 ACATGGACTTCCACTCACCAAGG + Intergenic
960349640 3:116576575-116576597 ACATGGACTTCCAGTCACCAAGG + Intronic
960494617 3:118359882-118359904 ACATGGACTTCCACTTACAAGGG - Intergenic
961710855 3:128827144-128827166 ACATGGACTTCCACTCACCAAGG - Intergenic
962214790 3:133511947-133511969 ACATGGACTTCCACTCACCAAGG + Intergenic
963268016 3:143258384-143258406 ACATGGACTTTCACTCACCAAGG - Intergenic
963355541 3:144205993-144206015 ACATGGACTTCCACTCACCAAGG - Intergenic
963379121 3:144506409-144506431 ACATGGACTTCCACTCACCAAGG - Intergenic
963630431 3:147724095-147724117 ACATGGACTTCCACTCACCAAGG + Intergenic
963661513 3:148133012-148133034 ACATGGATTTCCACTCACCAAGG + Intergenic
963737667 3:149037887-149037909 ACCTGGACGTGCATTCACATAGG - Intronic
963970193 3:151421079-151421101 ACGTGGACTTCCACTCATAAAGG - Intronic
964505584 3:157395424-157395446 ACATGGACGTCCACTCACAAAGG - Intronic
965893054 3:173538697-173538719 ATATGGACTTCTACTCACAAAGG - Intronic
966661425 3:182418871-182418893 ACATGGACTTCTACTCCCAAAGG + Intergenic
968800314 4:2739006-2739028 ACATGGACCTCCACTAGCCAAGG + Intergenic
970524105 4:16913940-16913962 ACATGGACTTCCACTCACCAAGG + Intergenic
970629405 4:17924377-17924399 ACATGGACTTCCAATCACCAAGG + Intronic
971100893 4:23465546-23465568 ACATGGACTTCCACTCACCAAGG - Intergenic
971126556 4:23761182-23761204 ACATGGACTTTTACTCACCAAGG + Intronic
971687265 4:29786213-29786235 ACATGGACTTCCACTCACCAAGG - Intergenic
971820776 4:31551519-31551541 ACACGCACGTACACTCACAGAGG + Intergenic
971857537 4:32061980-32062002 ACATAGAATTCCACTCACCAAGG - Intergenic
971979182 4:33731999-33732021 ACATGGACTTCCACTCACCAAGG - Intergenic
972085339 4:35207960-35207982 ACATGGACTTCCACTCACCAAGG + Intergenic
972095602 4:35343566-35343588 ACATGAACTTCCACTCACCAAGG + Intergenic
972201185 4:36716308-36716330 ACATGGACTTCCACTCACCAAGG - Intergenic
972806043 4:42530203-42530225 ACATGGACTTCTACTCACCAAGG + Intronic
972882852 4:43447298-43447320 ACATTGACTTCCACTCAGCAAGG - Intergenic
973092703 4:46157970-46157992 ACATGGACTTCCACTCACCAAGG + Intergenic
973098150 4:46227558-46227580 ATATGAACTTCCACTCACCAAGG + Intergenic
973103038 4:46295617-46295639 ACATGGACTTCCACTCACCAAGG + Intronic
973120880 4:46520029-46520051 ACATGGACTTCCACTCACCAAGG - Intergenic
974478934 4:62420017-62420039 ACATGGATTTCCACTCAGCAAGG - Intergenic
974557701 4:63472768-63472790 ACATGGACTTTCAGTCACAAAGG + Intergenic
974564904 4:63569185-63569207 ACGTGGACTTCCACTCACCAAGG + Intergenic
974644495 4:64673892-64673914 ACATAGACTTCCACTCACCAAGG - Intergenic
974727343 4:65813411-65813433 ACATGGACTTCCACTCACCAAGG + Intergenic
975024638 4:69533010-69533032 ACAGGGACTTCCACTCACCAAGG + Intergenic
975386596 4:73766638-73766660 ACATAGACTTCCACTCACTAAGG - Intergenic
975759085 4:77600191-77600213 ACATGTAAGTCCTCTCACATTGG - Intronic
975982480 4:80176403-80176425 ACATGGACTTCCACTCACCAAGG - Intergenic
976034084 4:80794948-80794970 ACATGGGCTTCCACTCACCAAGG - Intronic
977031767 4:91892684-91892706 ACATGGACTTCCACTCACCAAGG + Intergenic
977204831 4:94156509-94156531 ACATGGACTTCCACTCACCAAGG + Intergenic
977489960 4:97699199-97699221 ACATGGATTTCCACTCACCAAGG - Intronic
977701626 4:100029011-100029033 ATATGGACCTCCACTCACCAAGG - Intergenic
977898832 4:102395460-102395482 ACATGGACTTCTACTCACCAAGG + Intronic
977930281 4:102742944-102742966 ACATGGATTTCCACTCAGCAAGG - Intronic
977976471 4:103272467-103272489 ACATGGACTTCCACTTACCAAGG - Intergenic
978341454 4:107724673-107724695 ACATGGACTTCCACTCATGAAGG - Intergenic
978485800 4:109252353-109252375 ATGTGGACTTCCACTCATAAAGG - Intronic
978772030 4:112466912-112466934 ACATGGGCTTCCACTCACCAAGG - Intergenic
978898945 4:113925938-113925960 ACATGGACTTCCACTCACCAAGG - Intronic
979324742 4:119365535-119365557 GCATGGTCATCCACTCAAAATGG - Intergenic
979767132 4:124475470-124475492 ACATGGACTTCCGCTCACAAAGG + Intergenic
979888447 4:126061303-126061325 AAGTGGACTTCCACTCACCAAGG - Intergenic
980283888 4:130757294-130757316 ATATGGACTGCCTCTCACAAAGG + Intergenic
980385671 4:132086185-132086207 ACATGGACTTTCACTCACCAAGG - Intergenic
980405768 4:132352915-132352937 AAATGGACTTCCACTCACCAAGG - Intergenic
980602325 4:135040884-135040906 ACACGGACTTCCACTCACCAAGG + Intergenic
980957852 4:139446789-139446811 ACATGGACTTCCACCCACCAAGG + Intergenic
981462935 4:145032668-145032690 ACATGGACTTCCACTCACCAAGG + Intronic
981835124 4:149044815-149044837 ACATGGACTTCCACTCACTAAGG + Intergenic
982597655 4:157406169-157406191 ACATGGACTTCCACTCACCAAGG - Intergenic
982623214 4:157732013-157732035 ACATGGACTTCCACTCACCAAGG - Intergenic
982788114 4:159559522-159559544 ACATGGACTTCCACTTACCAAGG - Intergenic
982835671 4:160117520-160117542 ACATGGACCTCCACTCACCAAGG + Intergenic
983027524 4:162756163-162756185 ACATGGACTTCCCCTCACCAAGG + Intergenic
983185195 4:164692449-164692471 ACATGGATTTCCACTCACCAGGG + Intergenic
983242586 4:165250236-165250258 GCATGGTCATCCACTCAAAATGG - Intronic
983582805 4:169325688-169325710 ACATGGACTTCCACTCACCAAGG + Intergenic
984060163 4:174981153-174981175 ACATGGACTTCCACTCACCAAGG - Intergenic
984869266 4:184312298-184312320 ACAGGGACTTGCACTCACAGTGG - Intergenic
985832450 5:2244180-2244202 ACATGGACTTCCACACACTAAGG + Intergenic
986036920 5:3949576-3949598 ACATGGACTTCCATTCACCAAGG - Intergenic
986087225 5:4463592-4463614 ACATGTACTTCCACTCACCAAGG + Intergenic
986261509 5:6151649-6151671 ACATGGACTTCCACTCATCAAGG - Intergenic
986743076 5:10720633-10720655 ACATGGACTTCCATTCACCAAGG + Intronic
986766281 5:10931179-10931201 ACATGGACTTCTACTCACCAAGG + Intergenic
986959952 5:13200058-13200080 ACATGGACTTCCACTCACCAAGG + Intergenic
987490697 5:18577436-18577458 ACATGGACTCCTACTCACTAAGG - Intergenic
987504510 5:18750712-18750734 ACATGGACCTCCACTCACCAAGG + Intergenic
987578220 5:19757436-19757458 ACATGGACGTCCACTCACCAAGG - Intronic
987885571 5:23807375-23807397 ACATGGACTTCCACTCAACAAGG + Intergenic
988160703 5:27515995-27516017 ACGTGGACTTCTACTCACCAAGG - Intergenic
988205177 5:28124478-28124500 ACATGGACTTCCACTCACCAAGG - Intergenic
988258280 5:28849416-28849438 ACATGGACTTCCACTCACCAAGG + Intergenic
988562249 5:32291714-32291736 ACATGGACTTCCACTCACCAAGG + Intronic
989045030 5:37266411-37266433 ACATGGACTTCCACTCACCAAGG - Intergenic
989307380 5:39973748-39973770 ACACGGACTTCCATTCACCAAGG - Intergenic
989457525 5:41660893-41660915 ACATGGACTTCCACTTACCAAGG - Intergenic
989486260 5:41995485-41995507 ACAAGGATTTCCACTCACCAAGG - Intergenic
990748209 5:58982714-58982736 ACATGGACTTCCACTCACCAAGG - Intronic
990842515 5:60099173-60099195 ACATGGAAGGGTACTCACAAAGG - Intronic
991013668 5:61910013-61910035 ACATGGACTTCCACTTACCAAGG - Intergenic
991330616 5:65488811-65488833 ACATGGACTTCCACTCATCAAGG - Intergenic
991595292 5:68298132-68298154 AAAGGCACGTCCACTCACAAGGG + Exonic
991946269 5:71901000-71901022 ACATGGAATTCCACTCACCAAGG + Intergenic
992099775 5:73395886-73395908 CCATGGACTTCCACTCATCAAGG + Intergenic
992109771 5:73481998-73482020 ACATAAACTTCCACTCACCAAGG - Intergenic
992243079 5:74790727-74790749 ACATGGACTTCCACTCACCAAGG + Intronic
993231794 5:85246664-85246686 CCATGGACTTCCACTCCCCAAGG - Intergenic
993367349 5:87050089-87050111 ACATGGACTTCCACTCACCAAGG - Intergenic
993791900 5:92219783-92219805 ACATGGGCTTCCACTCACCAGGG + Intergenic
994291244 5:98031079-98031101 ACATGGATTTCCACTCACCAAGG - Intergenic
994917062 5:105994352-105994374 ACATGGACTTTCACTAACCAAGG + Intergenic
994984289 5:106914852-106914874 ACATGGACTTCCACTCACCAAGG - Intergenic
995427613 5:112042875-112042897 ACATGGACTTCCACTCACCAAGG - Intergenic
995776158 5:115726825-115726847 GCTTGGACTTCCACTCACCAAGG - Intergenic
996018681 5:118568742-118568764 ACGTGGACTTCCACTCACCAAGG + Intergenic
996392082 5:122972915-122972937 ACATGGACTTACACTCAGCAAGG - Intronic
996825688 5:127678702-127678724 ACATGGGCTTCCACTCACGAAGG + Intergenic
997753642 5:136373992-136374014 ACCTGGACTCCCACTTACAAAGG + Intronic
998290207 5:140907678-140907700 ACAGGGACTTCCACTCACCAAGG - Intronic
999351494 5:150875707-150875729 ACATAGACTTCCACTCACCGAGG + Intronic
999388748 5:151174619-151174641 CCATGCACTTCCACCCACAAAGG - Intergenic
1000417093 5:160994776-160994798 ACATGGACTTCCACTCACCAAGG + Intergenic
1001173729 5:169445515-169445537 ACATGGGCATCCATTCACCAAGG + Intergenic
1002998094 6:2305635-2305657 ACATCGACCTCCACTCACCAAGG + Intergenic
1003695774 6:8405287-8405309 ACATGGACTTCCACTCACCAAGG - Intergenic
1003758736 6:9150960-9150982 ACATGGACTTCCACTCACCAAGG + Intergenic
1003791352 6:9550923-9550945 ACTTGGACTTCCATTCACCAAGG + Intergenic
1004199742 6:13536503-13536525 TCTTGCACCTCCACTCACAACGG - Intergenic
1004824165 6:19402358-19402380 ACTTGGACTTCCATTCACCAAGG - Intergenic
1005185301 6:23157940-23157962 ACATGGACTTCCACTAACCAAGG + Intergenic
1006001672 6:30969949-30969971 ACATGGACTTCCATTCACCAAGG + Intergenic
1006062469 6:31434080-31434102 ACATAGACTTTCACTCACCAAGG + Intergenic
1006423977 6:33952280-33952302 ACAAGGACGACCACCCAAAATGG + Intergenic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1008400409 6:51056341-51056363 ACATGGACTTCCACTCACCAAGG + Intergenic
1008996364 6:57664716-57664738 ACATGGACTTCCACTCACCAAGG + Intergenic
1009184883 6:60563509-60563531 ACGTGGACTTCCACTCACCAAGG + Intergenic
1009389986 6:63134199-63134221 ATGTGGACTTCCACTCACCAAGG - Intergenic
1009580296 6:65524976-65524998 ACGTGGACTTCCAGTCACCATGG - Intronic
1009660571 6:66606055-66606077 ACATGGACTTCTACTCACTAAGG - Intergenic
1010107826 6:72189696-72189718 ACATGGACTTCCACTCACCAAGG - Intronic
1010323692 6:74541366-74541388 ACATGGACTTCCACTCACCAAGG + Intergenic
1010325207 6:74555725-74555747 ACATGGACTACCACTCACAAAGG - Intergenic
1010818751 6:80389284-80389306 ACATTTACTTCCACTCACCAAGG + Intergenic
1010854009 6:80814653-80814675 ACATGGACTTATACTCACCAAGG - Intergenic
1010938122 6:81885548-81885570 ACATGGACTTCCACTCACCAAGG - Intergenic
1011039227 6:83012425-83012447 ACATGGACTTTCACTCACCAAGG - Intronic
1011069230 6:83362529-83362551 ACATGTACTTCCGCTCACCAAGG + Intronic
1011072567 6:83401729-83401751 ATATGGACTTTCACTCACCAAGG + Intronic
1012344708 6:98171197-98171219 ACATGGACTTCCACTCACTAAGG + Intergenic
1012358769 6:98350123-98350145 ACAGAGAAGTCCACTCCCAAGGG + Intergenic
1012362890 6:98405842-98405864 ACATGGAATTCCATTCACAAAGG - Intergenic
1012820893 6:104083638-104083660 ACATGGACTTCCACTCAAGAAGG + Intergenic
1012920663 6:105218673-105218695 ACATGGACTTCTACTCACCAAGG - Intergenic
1013406796 6:109850676-109850698 ACATAGGCTTCCACTCACCAAGG + Intergenic
1014363278 6:120507477-120507499 ACATGGACTTCCACTCACCAAGG - Intergenic
1014417119 6:121196281-121196303 ACATGGACTTCCACTCACCAAGG + Intronic
1014538727 6:122648901-122648923 ACATGGACTTCCACTCAACAAGG - Intronic
1014631765 6:123797668-123797690 ACATGGACTTCCACTCACCATGG + Intergenic
1015475873 6:133658357-133658379 ACATGGACTTCCACTCACCAAGG + Intergenic
1015527564 6:134188001-134188023 ACATGGACGTCCACTCACTAAGG - Intronic
1016119812 6:140331818-140331840 ACATGGACTTCCACTCACCAAGG - Intergenic
1016147203 6:140691839-140691861 ACAGGGACTTCCACTCAGCAAGG - Intergenic
1016576142 6:145571713-145571735 ACGTGGACTTCCACTCACCAAGG - Intronic
1016594647 6:145785756-145785778 ACACAGACTTCCACTCACAAAGG + Intergenic
1017043959 6:150330072-150330094 ACATGGACTTCCACTCACCAGGG - Intergenic
1017227685 6:152040212-152040234 ACATGGACTTCCACGTACCAAGG - Intronic
1017284310 6:152657006-152657028 ACATGGACTTCCCATCACTAAGG - Intergenic
1017452431 6:154566409-154566431 ACATGAACTTCCACTTACCAGGG + Intergenic
1017976911 6:159366272-159366294 ACATGGACTTCCAATCACCAAGG - Intergenic
1018479798 6:164178901-164178923 AAATGGACCTGCACTCACAAGGG + Intergenic
1018540888 6:164877994-164878016 ACACGGACTTCCACTCATCAAGG + Intergenic
1019891455 7:3950605-3950627 AGATGCCCTTCCACTCACAATGG + Intronic
1020710476 7:11598502-11598524 ACATGGACTTCCACTCACCAAGG + Intronic
1022079011 7:27001205-27001227 ACATGGACTTCCACTCACCAAGG + Intergenic
1024040665 7:45551021-45551043 ACATGGATTTCCACTCACCAAGG + Intergenic
1024177391 7:46855077-46855099 ACATGGACTTCCACTCACCAAGG - Intergenic
1024866217 7:53907219-53907241 ACATGGACTCTCACTCACCAAGG + Intergenic
1024884231 7:54123771-54123793 ACATGGATTTCCACTCACCAAGG - Intergenic
1026046367 7:66908237-66908259 ACATGGACTTTCACTCACCAAGG - Intergenic
1026207711 7:68272597-68272619 ACATGGACTTCCACTCACAAAGG + Intergenic
1026224158 7:68426157-68426179 ACATGGACTTCCTCTCACCAAGG + Intergenic
1027406934 7:77872131-77872153 ACATGGACTTCCACTCACCAAGG - Intronic
1027685919 7:81278829-81278851 GCATGTACTTCCACTCACCAAGG + Intergenic
1027799863 7:82737282-82737304 ACATGGACTTTCATTCACCAAGG + Intergenic
1028043966 7:86092336-86092358 ACATGGACTTCCACTCACCAAGG + Intergenic
1028237950 7:88383696-88383718 ACATAGACTTCCACTCACCAAGG + Intergenic
1028342180 7:89735171-89735193 ACCTGGACTTCCACTAACCAAGG - Intergenic
1028935137 7:96455939-96455961 ACATGAACTTCCACTCATCAAGG + Intergenic
1029005678 7:97206795-97206817 ACATGGACTTTCCCTCACCAAGG - Intergenic
1029913019 7:104174906-104174928 ACATGGACAGCCAACCACAAGGG + Intronic
1030277670 7:107737514-107737536 ACATGGACTTCCACTCACCAAGG + Intergenic
1030368881 7:108674914-108674936 ACATGGACATCCACTCACCAAGG + Intergenic
1030457336 7:109792171-109792193 ACATGGGCTTCCACTCACCAAGG - Intergenic
1030883159 7:114905673-114905695 ACATGGACTTCCACTCACCAAGG - Intergenic
1030931165 7:115524807-115524829 ACATGGACTTCCACTCACCAAGG - Intergenic
1031236977 7:119189126-119189148 ACTTGGACTTCCACTCACCAAGG + Intergenic
1031474338 7:122204487-122204509 ACCTGGACTTCCACTCACCAAGG - Intergenic
1031628863 7:124021995-124022017 ACATAGACTTCCACTCACCAAGG + Intergenic
1031682155 7:124688222-124688244 ACATTAACTTCCACTCACCAAGG + Intergenic
1031767906 7:125804575-125804597 ACATGGATTTTCACTCACCAAGG + Intergenic
1031833129 7:126650890-126650912 ACATGGACTTCCACTCACCAAGG + Intronic
1032152980 7:129446085-129446107 ACATGGACTTCCACTCACCAAGG - Intronic
1032923362 7:136575255-136575277 ACATGGACTTCCACTCACCAAGG - Intergenic
1033076385 7:138253921-138253943 ACATGGACTTCCACTCACGAAGG + Intergenic
1033135487 7:138780583-138780605 ACATGGACTTCCACTCACCAAGG - Intronic
1033392399 7:140940340-140940362 ACATGGACTTCCATTTACCAAGG + Intergenic
1034169931 7:149055145-149055167 AGATGGACTTCCACTCACCAAGG + Intergenic
1034314278 7:150115657-150115679 ACATGGACCTCCACTCTCATTGG + Intergenic
1034357146 7:150460086-150460108 ACATGGTCTTCCATTCACTAAGG - Intronic
1034792618 7:153985142-153985164 ACATGGACCTCCACTCTCATTGG - Intronic
1035616839 8:1008605-1008627 ACATTGGCTTCCACTGACAAAGG - Intergenic
1037364462 8:18107388-18107410 ACATGGACTTCCACTCACCAAGG - Intergenic
1037500923 8:19484873-19484895 CCAGAGACGTGCACTCACAAAGG + Intronic
1037675601 8:21048303-21048325 AAATGGACTTCCACTCACCAAGG - Intergenic
1037729854 8:21515252-21515274 GCATGGACTTCCACTTACCAAGG - Intergenic
1039527140 8:38226880-38226902 ACATGGACTCCCACTCACCAAGG - Intronic
1040726205 8:50384626-50384648 ACATGGACTTCCACTCACCAAGG - Intronic
1041556196 8:59159185-59159207 ACACGGACATCCATTCACCAAGG + Intergenic
1041935428 8:63326877-63326899 ACATGGACTTCTGCTCACTAAGG + Intergenic
1041986305 8:63925344-63925366 ACATGGAATTCCACTCACCAAGG + Intergenic
1042000938 8:64123120-64123142 ACTTGGACTTCCACTCACTAAGG - Intergenic
1043258047 8:78159693-78159715 ACATGGACTTCCACTCATCAAGG + Intergenic
1044202513 8:89453362-89453384 ACGTGGACTTCCACTCACCAAGG + Intergenic
1044633025 8:94297528-94297550 GCATGGACTTTCACTCACCAAGG - Intergenic
1045418908 8:101994574-101994596 ACATGAAAGTCCAATGACAAGGG + Intronic
1046128547 8:109940722-109940744 ACATGGATTTCCACTCACCAAGG - Intergenic
1046384884 8:113496315-113496337 ACATGGACTTCTACTTACCAAGG + Intergenic
1046417524 8:113936919-113936941 ACATGGACTTCCACTCACCAAGG - Intergenic
1046585665 8:116146864-116146886 ATATGGACTTCCACTCACCAAGG - Intergenic
1047884263 8:129231182-129231204 ACATGGACTTCTACTCAGTAAGG + Intergenic
1049653920 8:143789483-143789505 CCATGCACCTCCACTCACACTGG - Intergenic
1049889807 9:58258-58280 ACATGGAGGTTCACTCACCAAGG + Intergenic
1050901904 9:10960495-10960517 ACATGGACTTTCACTCACCAAGG + Intergenic
1051937220 9:22457738-22457760 ACATGGACTTCCATTCATTAAGG - Intergenic
1052100923 9:24445538-24445560 ACGTGGATTTCCACTCACCATGG - Intergenic
1052227705 9:26109247-26109269 ACATGGACTTCCACTCACCAAGG + Intronic
1052368772 9:27641711-27641733 ACATGGACTTCCATTCACCAAGG + Intergenic
1052737219 9:32354703-32354725 ACATGGAATTCGACTCACTAAGG - Intergenic
1052895383 9:33742787-33742809 ACGTGGACTTCCACTCAACAAGG - Intergenic
1053610919 9:39712233-39712255 ACATGGACTCCCACTCACCAAGG + Intergenic
1053695839 9:40638630-40638652 ATGTGGACTTCCACTCACCAAGG - Intergenic
1053731287 9:41059533-41059555 ACATGGACTTTCACTCACCAAGG + Intergenic
1053868957 9:42470255-42470277 ACATGGACTCCCACTCACCAAGG + Intergenic
1053942826 9:43269667-43269689 ATGTGGACTTCCACTCACCAAGG - Intergenic
1054087335 9:60758925-60758947 ACATGGACTCCCACTCACCAAGG - Intergenic
1054242603 9:62630162-62630184 ACATGGACTCCCACTCACCAAGG - Intergenic
1054307086 9:63437848-63437870 ATGTGGACTTCCACTCACCAAGG - Intergenic
1054405817 9:64761839-64761861 ATGTGGACTTCCACTCACCAAGG - Intergenic
1054439444 9:65247326-65247348 ATGTGGACTTCCACTCACCAAGG - Intergenic
1054490963 9:65774613-65774635 ATGTGGACTTCCACTCACCAAGG + Intergenic
1054556727 9:66664680-66664702 ACATGGACTCCCACTCACCAAGG - Intergenic
1054697222 9:68372556-68372578 ACATGGACATTCACTCACCAAGG - Intronic
1055903816 9:81270319-81270341 ACATGGACTTCCACTCACCAAGG - Intergenic
1056156797 9:83846068-83846090 ACATGGACTTCCACTCACCAAGG + Intronic
1056314110 9:85372071-85372093 ACATGGACTTCCACTCACCAAGG - Intergenic
1056353739 9:85777458-85777480 ACATGGACTTCCACTCACCAAGG - Intergenic
1057004826 9:91547926-91547948 ACATGGACTTCCACTCACCAAGG - Intergenic
1057210603 9:93199076-93199098 ACAAGGACCTCCAGTCACAGGGG - Intronic
1058020029 9:100076935-100076957 ACATGGACTTCCACTCACCAAGG + Intronic
1058124699 9:101178252-101178274 TCATGGACTTCCACTCACCAAGG + Intronic
1058259139 9:102808812-102808834 ACATGGACTTGTACTCACTAAGG - Intergenic
1058523043 9:105831069-105831091 ACGTGGGCATCCACTCACCAAGG + Intergenic
1059196379 9:112374993-112375015 ACAGGGACTTCCACTCACCAAGG - Intergenic
1060315202 9:122503422-122503444 GCATGGACTTCCTCTCACCATGG - Intergenic
1060977557 9:127773989-127774011 CCAGGGACGTGCACTCAGAAAGG - Exonic
1062135601 9:134925882-134925904 ACATGAACTTCCACTCACCAAGG + Intergenic
1202778284 9_KI270717v1_random:12242-12264 ATGTGGACTTCCACTCACCAAGG - Intergenic
1185462827 X:340422-340444 ACAGGGACGTCCCCTCACCCTGG + Intronic
1186223568 X:7374789-7374811 ACATGCACCTCCGCTCACAACGG - Intergenic
1186279630 X:7977991-7978013 ACATGAGCTTCCACTCACCAAGG + Intergenic
1186383974 X:9090903-9090925 ACATGGACTTCCACTTACCAAGG - Intronic
1186469645 X:9811262-9811284 ACATGGACTTCCACTCACCAAGG - Intronic
1189878555 X:45464653-45464675 ACAAGGATGTCCAGTCACACTGG - Intergenic
1190527780 X:51345447-51345469 ACATGGATTTCCACTCACCAAGG - Intergenic
1190625238 X:52331000-52331022 ACATGGACTTCCACTCACCAAGG - Intergenic
1190767098 X:53484341-53484363 ACATGGACTTCCCCTTACCAAGG - Intergenic
1191009199 X:55743462-55743484 TCATGGACTTCCACTCACCGAGG - Intronic
1191629905 X:63311711-63311733 ACATGCACTTCCACTCACCAAGG - Intergenic
1191658675 X:63628935-63628957 ACATGGACTTCCACTCACCAAGG - Intergenic
1191719122 X:64214839-64214861 ACAAGAACTTCCACTCACCAAGG - Intergenic
1191759475 X:64630783-64630805 ACACGGGCTTCCACTCACCAAGG + Intergenic
1191769378 X:64739225-64739247 ACATGGACTTCCACTCACCAGGG - Intergenic
1191831596 X:65421333-65421355 ACATGGACTTCCATTCACCAAGG + Intronic
1191933027 X:66395017-66395039 ACATGGACTTCCACTCACCAAGG + Intergenic
1191941142 X:66483005-66483027 ACATGGACTTTCACTCACCAAGG - Intergenic
1191946470 X:66539893-66539915 ACATGAACTTCCACTCACCAAGG + Intergenic
1192297591 X:69867155-69867177 ACATGGACTTCCATCCACCAAGG - Intronic
1192824603 X:74682084-74682106 ACATGGACTTCAATTCACTAAGG + Intergenic
1192898829 X:75472779-75472801 ATATGGACCTCCACTCACCACGG + Intronic
1192996298 X:76516449-76516471 ACATGAACTTCCACTCACCAAGG + Intergenic
1193053613 X:77126640-77126662 ACATCGACATTCACTCACCAAGG + Intergenic
1193187480 X:78530078-78530100 ACATGAACTTTCACTCACCAAGG + Intergenic
1193297895 X:79853529-79853551 AGATGTACTTCCACTCACCAAGG + Intergenic
1193356370 X:80524014-80524036 ACATGGACATCCACTCACCAAGG + Intergenic
1193543544 X:82799837-82799859 ACATGGACTTTCACTCACCAAGG + Intergenic
1193573590 X:83174302-83174324 ATATGGACTTCCACTCACCAAGG - Intergenic
1193833072 X:86310979-86311001 ACATGAACTTCCACTCACCAGGG + Intronic
1193904599 X:87226691-87226713 ACATGGACTTCCACTCACCAAGG + Intergenic
1193914694 X:87351061-87351083 ACATAGACTTCCACTCACTGAGG - Intergenic
1193957412 X:87879090-87879112 ACATGGACTTCCACTCACCAAGG + Intergenic
1193984248 X:88220894-88220916 ACAAGGACTTCCACTCACCAAGG + Intergenic
1194163836 X:90489285-90489307 ACATGGACTTGCATTCACCATGG - Intergenic
1194210393 X:91063223-91063245 ACATGGACTTCCACTCACCAAGG + Intergenic
1194232975 X:91347159-91347181 ACATGGACTTCAACTAACCAAGG + Intergenic
1194343431 X:92731958-92731980 ACGTGGACTTCCACTTACCAAGG + Intergenic
1194443657 X:93961975-93961997 ACATGGACTTCCACTCACCAAGG + Intergenic
1194513305 X:94821377-94821399 ACATGGACCTCCACTCACCAAGG - Intergenic
1194649532 X:96498708-96498730 ACATGGACTTCCACTCAACAAGG + Intergenic
1194834070 X:98659672-98659694 ACATGGACGTCCACTCACCTAGG + Intergenic
1194870812 X:99128738-99128760 ACATGGACTTCTAGTCACCAAGG + Intergenic
1195262772 X:103149853-103149875 ACATGGACTTCCACTCAGCAAGG + Intergenic
1195748399 X:108141198-108141220 ACATGGACTTCCACTCACCAAGG - Intronic
1195748808 X:108144489-108144511 ACATGGACTTCCACTCACCAAGG - Intronic
1195809669 X:108815976-108815998 ACATGGACTTCCACTCACCAAGG - Intergenic
1196114384 X:111983265-111983287 ACATGGACTCCCACTCACCAAGG - Intronic
1196135844 X:112208969-112208991 ACATGGACTTCCACCCACCAAGG - Intergenic
1196178222 X:112663454-112663476 ACATGGAAGTCCCTTCAGAAGGG - Intronic
1196365698 X:114921332-114921354 ACATGCACTCACACTCACAATGG - Intergenic
1197002413 X:121453788-121453810 ACATGGACTTCCACTCACCAAGG + Intergenic
1197044538 X:121979181-121979203 ACATGGACTTCCATTCACTAAGG + Intergenic
1197084085 X:122452630-122452652 ACATGGACTTCCACTCACCAAGG - Intergenic
1197097526 X:122613285-122613307 ACATGGACTTCCACTTACCAAGG + Intergenic
1197182219 X:123548654-123548676 ACATGGACTTCCACTCACCAAGG + Intergenic
1197244926 X:124158129-124158151 ACATGGACTTCCACTCACCAAGG - Intronic
1197371934 X:125636993-125637015 ACATGGACTTCCACTCACCAAGG - Intergenic
1197379883 X:125727018-125727040 ACATGGACTTCCACTCACCAAGG - Intergenic
1197405166 X:126039814-126039836 ACATGGACTTCCACTCACCAAGG + Intergenic
1197409207 X:126095572-126095594 ACATGGACTTCTACTCACCAAGG - Intergenic
1197537388 X:127707354-127707376 ACATAGACTTCCACTAACCAAGG + Intergenic
1197591996 X:128420258-128420280 ACATGGACTTTCACTCACCAAGG + Intergenic
1198330388 X:135617351-135617373 GCATGGACTTCCACTCACCAAGG - Intergenic
1198336539 X:135671648-135671670 GCATGGACTTCCACTCACCAAGG + Intergenic
1198340672 X:135710605-135710627 GCATGGACTTCCACTCACCATGG - Intergenic
1198347292 X:135771123-135771145 GCATGGACCTCCACTCACCATGG + Intergenic
1198349198 X:135788384-135788406 GCATGGACCTCCACTCACCATGG + Intergenic
1198351103 X:135805657-135805679 GCATGGACCTCCACTCACCATGG + Intergenic
1198353010 X:135822922-135822944 GCATGGACCTCCACTCACCATGG + Intergenic
1198354919 X:135840177-135840199 GCATGGACCTCCACTCACCATGG + Intergenic
1198356829 X:135857460-135857482 GCATGGACCTCCACTCACCATGG + Intergenic
1198358742 X:135874739-135874761 GCATGGACCTCCACTCACCATGG + Intergenic
1198363107 X:135915139-135915161 GCATGGACTTCCACTCACCAGGG - Intergenic
1198782916 X:140256938-140256960 ACATGGACTTCCACTCAACAAGG - Intergenic
1199024502 X:142920597-142920619 ACATGTACTTCCACTCACCAAGG + Intergenic
1199116455 X:143998389-143998411 ACATGGACTTCCACTCACCAAGG - Intergenic
1199144340 X:144348104-144348126 ACATGGACTTCCACTTACCAAGG - Intergenic
1199310305 X:146313529-146313551 ACATGGACTTCCACTTACCAAGG - Intergenic
1200340358 X:155389769-155389791 ACATGGACTTCCACTTATCAAGG - Intergenic
1200440413 Y:3206127-3206149 ACATGGCCTTCCATTCACCAAGG - Intergenic
1200510099 Y:4067094-4067116 ACATGGACTTGCATTCACCATGG - Intergenic
1200651785 Y:5848623-5848645 ACATGGACTTCCACTTACCAAGG + Intergenic
1200745934 Y:6903998-6904020 ACATGGACTTCCACTTACCAAGG - Intergenic
1200973018 Y:9176843-9176865 ACATGGGCTTCTACTCACTAAGG - Intergenic
1201193599 Y:11470546-11470568 ATGTGGACTTCCACTCACCAAGG - Intergenic
1202138060 Y:21687666-21687688 ACATGGGCTTCTACTCACTAAGG + Intergenic