ID: 964506414

View in Genome Browser
Species Human (GRCh38)
Location 3:157404920-157404942
Sequence CAGAAAGGACAACTGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964506414_964506421 22 Left 964506414 3:157404920-157404942 CCAATGCCCAGTTGTCCTTTCTG 0: 1
1: 1
2: 1
3: 16
4: 320
Right 964506421 3:157404965-157404987 TGTTAGGCTCATGGCTAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 134
964506414_964506420 13 Left 964506414 3:157404920-157404942 CCAATGCCCAGTTGTCCTTTCTG 0: 1
1: 1
2: 1
3: 16
4: 320
Right 964506420 3:157404956-157404978 TTGTTCACTTGTTAGGCTCATGG 0: 1
1: 0
2: 1
3: 13
4: 119
964506414_964506422 23 Left 964506414 3:157404920-157404942 CCAATGCCCAGTTGTCCTTTCTG 0: 1
1: 1
2: 1
3: 16
4: 320
Right 964506422 3:157404966-157404988 GTTAGGCTCATGGCTAGAAAGGG 0: 1
1: 0
2: 1
3: 10
4: 110
964506414_964506419 6 Left 964506414 3:157404920-157404942 CCAATGCCCAGTTGTCCTTTCTG 0: 1
1: 1
2: 1
3: 16
4: 320
Right 964506419 3:157404949-157404971 CTGAGATTTGTTCACTTGTTAGG 0: 1
1: 0
2: 0
3: 16
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964506414 Original CRISPR CAGAAAGGACAACTGGGCAT TGG (reversed) Intronic
900338340 1:2175703-2175725 CAGAAGGGTCAGCTGGGAATGGG + Intronic
900664558 1:3806026-3806048 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
900961098 1:5920654-5920676 CAGAAAAGAAAAATGGGCAAAGG - Intronic
901217552 1:7563164-7563186 CAGAAAGGAGCAGGGGGCATGGG - Intronic
901872859 1:12148316-12148338 CAGCCAGGCCACCTGGGCATGGG - Intergenic
905391544 1:37638999-37639021 AAGAAAGCACAGCAGGGCATGGG - Intergenic
907495572 1:54841971-54841993 GAGAAAGGACACATGGGCTTGGG + Exonic
907500756 1:54878203-54878225 CAGAAAAGACAACAGGTAATAGG + Intronic
907616294 1:55930196-55930218 CAGAAAGGAGAGCTGGAGATGGG + Intergenic
909466416 1:75978865-75978887 CAGAATTGTCAACAGGGCATTGG - Intergenic
910637372 1:89423799-89423821 CACCAAGGACAACAGGGCAAAGG + Intergenic
912678555 1:111710727-111710749 CAGAAAGGAGAAAAGGGCCTAGG + Intronic
913022723 1:114804389-114804411 CAGAAGGGGCAGCTGGGCAGAGG + Intergenic
913156546 1:116105147-116105169 CAGAAATAACAGCTGGGCAAAGG - Intergenic
914755587 1:150559967-150559989 GAGAAAGGACCAGTGGGAATGGG + Intronic
914959749 1:152196038-152196060 CAGAAGGGGCAGCTGGGCAGAGG + Intergenic
915009167 1:152668681-152668703 CAGAAAGGACAGAGGGACATGGG - Intergenic
916367087 1:164042003-164042025 CAGAAATGAAAACTGGGAAATGG - Intergenic
917689844 1:177457502-177457524 CAAAAAGGACAAGAGGGCATAGG - Intergenic
918864455 1:189876510-189876532 CAGAGAGGAAAGCTGTGCATAGG + Intergenic
920090364 1:203448556-203448578 CAGAAAGGAAAAGAGGGCTTTGG - Intergenic
920447153 1:206026739-206026761 CAGAATGGGCAAATGAGCATTGG - Intergenic
921778544 1:219132145-219132167 CAAAAGGAATAACTGGGCATTGG - Intergenic
922170919 1:223153854-223153876 CAGAAGGGACAAGGGGGTATGGG - Intergenic
922722780 1:227907015-227907037 GTGAAAAGACAAATGGGCATGGG - Intergenic
1062897706 10:1116876-1116898 CAGAAAGAACCACTGGGCCTAGG - Intronic
1063185519 10:3647287-3647309 CAGAAAGCAAAACTGCGGATGGG - Intergenic
1065174538 10:23063786-23063808 CAGAAATAAACACTGGGCATCGG + Intergenic
1065201254 10:23315591-23315613 CAAAAAGATCAGCTGGGCATGGG - Intronic
1065285611 10:24184763-24184785 CAGAAAGGAAAACTAGGAAAAGG - Intronic
1066185905 10:33010336-33010358 CAAAAAGGACAAATGGGTGTGGG - Intergenic
1066503243 10:36015192-36015214 GAGAAGGGACTACAGGGCATGGG + Intergenic
1067734058 10:48835406-48835428 CAGAGAGGACAGTTGGGCAATGG + Intronic
1067960819 10:50847009-50847031 CAGAAAGGACAGTTGGGCTCTGG + Intronic
1068019259 10:51560562-51560584 CGGTAGGGAAAACTGGGCATGGG - Intronic
1070770405 10:79079177-79079199 GAGCAAGGCCAACTGGGCAGAGG + Intronic
1071926385 10:90414847-90414869 CAGAAAGAACAAAAGGGGATGGG + Intergenic
1072103157 10:92248402-92248424 AAGAAAGGACAACTGTACATGGG + Intronic
1072138413 10:92569153-92569175 CAGAAAGGGCATCTCGGAATTGG + Intronic
1073494697 10:103880337-103880359 CAGAAAGAACAATTGGGAAAGGG + Intergenic
1075637866 10:124042589-124042611 CAGAAAGGGCTGCTGGGGATGGG + Intronic
1075894961 10:125987091-125987113 AAGAAGGGACAACTGAGCAAGGG - Intronic
1075997797 10:126892624-126892646 CTGACAGGAGAACTGGGCAAAGG - Intergenic
1076209388 10:128628141-128628163 CAGGAAGGACAAATGGGAAGTGG - Intergenic
1076419687 10:130322139-130322161 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1077706594 11:4492829-4492851 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1078512818 11:11998101-11998123 CAGAAAGAAAACCTGGGCACAGG - Intronic
1082078707 11:47995424-47995446 CAGGAAGGACAGCTGGACTTGGG + Intronic
1082689102 11:56277999-56278021 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1082954201 11:58851207-58851229 AAGAAAAGACAACTGGGCCCGGG - Intronic
1083727751 11:64637260-64637282 TAGAAAGGACACCTGGGTCTGGG - Intronic
1083992703 11:66256924-66256946 CAGAAAGGAGAAATTGGGATGGG + Intergenic
1084202852 11:67573392-67573414 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1086404392 11:86487575-86487597 CAGAAATGACACCTGGGCGGGGG - Intronic
1087432011 11:98066689-98066711 CAGAAAGAACAAAAGGGGATGGG - Intergenic
1087727807 11:101742018-101742040 CAGGAAGGAGATCTGTGCATAGG - Intronic
1087837051 11:102885897-102885919 CACAAAGAACAACTGGGCGCTGG + Intergenic
1088511858 11:110583900-110583922 CAGAAAGAAAAAATAGGCATTGG + Intronic
1089533133 11:119144876-119144898 CAGAAAGGAAAAATGTGCATAGG - Intergenic
1090060960 11:123463848-123463870 CAGAAAGGAAAACTGTGTAAAGG + Intergenic
1090076522 11:123583527-123583549 CATGAAGGACTACTGGCCATAGG + Intronic
1091691395 12:2599824-2599846 AAGAAAGGGCAAATGGACATGGG - Intronic
1093872232 12:24306347-24306369 CCAAAAGGACAAATGGGCAATGG + Intergenic
1095632788 12:44398025-44398047 CAGAAAGGACAACAGGGTATGGG - Intergenic
1095764780 12:45882231-45882253 CACAAAGGAGACCTGGGCCTTGG - Intronic
1095965442 12:47864183-47864205 GAGCAAGGCCAGCTGGGCATGGG - Intronic
1096384651 12:51187086-51187108 CAGGAAGGAAATCTGGGCATGGG + Exonic
1096488010 12:51996630-51996652 CAGAAGGGCCAACTGGGGAGTGG - Intronic
1097254768 12:57665144-57665166 CAGACAGGGCAGCTGGGCAGAGG - Intergenic
1097746366 12:63308068-63308090 AAGAAAGCAGATCTGGGCATTGG - Intergenic
1098375232 12:69807453-69807475 CAGACAGGACGGCTGGGCAGAGG + Intronic
1098618247 12:72556970-72556992 AAGAGAGGACAACTAGGTATAGG - Intronic
1099078409 12:78142328-78142350 CAGAAAGGTCTACTGGACACTGG - Intronic
1101598897 12:106191291-106191313 CAGGAAGGAAAAGTGGGCACTGG + Intergenic
1101776701 12:107801423-107801445 CAGAAAGGGGAACTGTTCATGGG + Intergenic
1102306915 12:111811869-111811891 AAGAAAAGACAGCTGGGCTTGGG + Intergenic
1102366803 12:112344499-112344521 CAAAAAGGTCAACAGGGCAGAGG + Intronic
1103283747 12:119783053-119783075 CTTAAATGACAACTGGGCAGAGG - Intronic
1104507733 12:129348732-129348754 AAGAAAAGAAAACTGGCCATTGG + Intronic
1105267769 13:18837093-18837115 CAGACAGGGCAGCTGGGCAGAGG + Intergenic
1105287177 13:19013920-19013942 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1107690386 13:42947753-42947775 CAGAAAGGCCCACTGGTCTTTGG - Intronic
1107876245 13:44793256-44793278 CAAAAAGGACATCTGGGTGTGGG + Intergenic
1108107694 13:47029756-47029778 GACAAAAGACAACTGGGGATGGG - Intergenic
1109290979 13:60474377-60474399 AAGAAAGGACAGCTGGGCCCGGG - Intronic
1110963871 13:81666312-81666334 AATAAAGGAGAGCTGGGCATGGG + Intergenic
1111999874 13:95200114-95200136 CAGGAAGGACTTCTGTGCATTGG + Intronic
1112679797 13:101750649-101750671 CAGAAAAGATAACTGACCATAGG + Intronic
1113676529 13:112210760-112210782 CAGACAGCACGCCTGGGCATGGG + Intergenic
1113775453 13:112942498-112942520 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1114340960 14:21743146-21743168 CAGAAAGTACAACTGAGCCTGGG + Intergenic
1116171380 14:41407116-41407138 AACAAAGGGGAACTGGGCATGGG + Intergenic
1118430850 14:65717441-65717463 CAGACAGGGCAGCTGGGCAGAGG + Intronic
1118537099 14:66779600-66779622 TAGAAGGGACACCTGGACATTGG + Intronic
1119721719 14:76896161-76896183 AAGAAAGGGAAAATGGGCATTGG + Intergenic
1120087195 14:80287049-80287071 CAGAAGGGACGGCTGGGCAGAGG - Intronic
1120732674 14:88021055-88021077 AAGAAAAGATAACTGGGAATAGG + Intergenic
1122360947 14:101163095-101163117 CATTAAGGACAACTGGGAAAAGG - Intergenic
1122755943 14:103980202-103980224 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1123042774 14:105497141-105497163 CAGAAAGGACAGGTGGGCTGTGG + Intronic
1124587184 15:31020671-31020693 TAGAAAGAAAAACTAGGCATGGG - Intronic
1125682530 15:41541100-41541122 CAGAAGGGAGAGCTGGGCAAAGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130248740 15:82280675-82280697 CAGAAATGATAACTAGGCAGAGG - Intronic
1130451315 15:84055479-84055501 CAGAAATGATAACTAGGCAGAGG + Intergenic
1130858317 15:87861991-87862013 CAGAAAGGACCTATGGGGATAGG - Intronic
1131985832 15:98042184-98042206 CAGGAAGGACAGATGGGTATGGG - Intergenic
1133833918 16:9350416-9350438 CAGACAGGGCAGCTGGGCAGAGG + Intergenic
1133833951 16:9350526-9350548 CAGACAGGGCAGCTGGGCAGAGG + Intergenic
1133975351 16:10596347-10596369 GAGAAAGGAGGACTGGGCACTGG + Intergenic
1135670865 16:24374485-24374507 AAGAAAAGACACCTGGGCCTGGG + Intergenic
1138210354 16:55157931-55157953 CAACAAGGGCAAGTGGGCATGGG - Intergenic
1138829208 16:60358090-60358112 CAGACAGGGCAGCTGGGCAGAGG + Intergenic
1143344828 17:6241923-6241945 CATGAAGGACAACAGGGCAGGGG + Intergenic
1144573098 17:16412682-16412704 CAGACAAGAAAACTGAGCATGGG - Intergenic
1144852590 17:18251558-18251580 CAGAAAGAACAGCTGTGCAAAGG - Intronic
1146103873 17:30012669-30012691 AAGAAAAGACAACTGGGCCCGGG - Intronic
1146789357 17:35742777-35742799 CAGAGAGGACAACTCCGCTTTGG + Exonic
1147020823 17:37531300-37531322 CGGAAAGGAGAAGTGGGCAAGGG + Intronic
1148091965 17:45028016-45028038 CAGGAAGGACAAATGGCCAGAGG + Intronic
1148717690 17:49727625-49727647 GTGGAAGGACAGCTGGGCATGGG + Intronic
1149570749 17:57670641-57670663 AAGAAAGGACTCCTGGGAATGGG - Intronic
1149659612 17:58327473-58327495 AAGAGAGGACAGGTGGGCATTGG + Intronic
1149982231 17:61320262-61320284 CAGAAGGAAAAACTGGGCTTTGG - Intronic
1150247730 17:63688919-63688941 AAGAAAGGACAAGTTGCCATGGG + Intronic
1150975530 17:70082139-70082161 CAGAAAAAACAACTGTGCCTGGG + Intronic
1151194829 17:72424056-72424078 AAGAAAGGACAACTTGACAACGG - Intergenic
1152140061 17:78530898-78530920 CAGAATGTACCCCTGGGCATGGG + Intronic
1153181629 18:2441667-2441689 CAGAAAGCACCACTGAGCTTCGG + Intergenic
1153450129 18:5217737-5217759 CAGAATGGACACCTGAGCAGAGG + Intergenic
1153642168 18:7166435-7166457 CAGCAAGGACAAGTGTGCAGTGG - Intergenic
1154160703 18:11979393-11979415 CAGAAAGGAGAACTGGGAAGAGG + Intergenic
1154322733 18:13367865-13367887 GAGAGGGGACGACTGGGCATGGG + Intronic
1154420312 18:14223190-14223212 CAGACAGGGCAGCTGGGCAGAGG - Intergenic
1155011740 18:21785307-21785329 AAGAAAAGACAGCTGGGCTTGGG - Intronic
1155246631 18:23916826-23916848 CAGAAAGTACAACTGGGTGGAGG - Intronic
1157169079 18:45385438-45385460 CAGAAAGTAGAACTGAGCAGAGG + Intronic
1158641872 18:59210608-59210630 AAGAAAGGAAAAGTGGGTATTGG + Intergenic
1158798799 18:60880991-60881013 TAGAAAGGAGAACTGGACACAGG - Intergenic
1159302277 18:66589549-66589571 CTGAAAGGACAACTGATAATTGG - Intronic
1159570082 18:70102959-70102981 CAGACTGGACAGCTGGGCAGAGG - Intronic
1159570101 18:70103033-70103055 CAGACGGGACAGCTGGGCAGAGG - Intronic
1160078563 18:75702338-75702360 CAGAATGAAGAACTGGGCAGCGG + Intergenic
1162290526 19:9776658-9776680 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1162679681 19:12331552-12331574 AAGAAATGAAAACTGGGCTTGGG + Intronic
1163075607 19:14888468-14888490 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1164436143 19:28231451-28231473 CAGACAGGACAAGAGGGCAAGGG + Intergenic
1166437060 19:42776601-42776623 AAGAAAAGACAAATGGGCCTGGG + Intronic
1166453703 19:42922714-42922736 AAGAAAAGACAACTGGGCCTGGG + Intronic
1166465965 19:43031269-43031291 AAGAAAAGACAACTGGGCCCGGG + Intronic
1166472102 19:43087338-43087360 AAGAAAAGACAACTGGGCCTGGG + Intronic
1167180582 19:47900197-47900219 CATTAAGGACATCTGGGCACTGG - Intergenic
1167206817 19:48108076-48108098 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1167227712 19:48259708-48259730 AAGAAAAGACAACTGGGCCCGGG + Intronic
1167392833 19:49207852-49207874 AAGAAAAGACAGCTGGGCCTGGG + Intronic
925192111 2:1893101-1893123 CAGAAAGGATTACTGGGCAGTGG - Intronic
926664009 2:15499967-15499989 AAGAAAGAACAAATGGGTATTGG - Intronic
926674598 2:15610583-15610605 CAGAAAGGATAACTAGAAATTGG - Intronic
927088217 2:19690738-19690760 CAGAGAGGACAACCGGGTAAAGG - Intergenic
927461961 2:23306962-23306984 CAGCATGGAGCACTGGGCATTGG - Intergenic
929904429 2:46033797-46033819 GAGTCAGGGCAACTGGGCATGGG + Intronic
931341339 2:61404045-61404067 CAGAAAGTACAACTTGGAAGAGG + Intronic
931610539 2:64094822-64094844 CAGAAAAGACAACTGCCTATTGG - Exonic
931773394 2:65518622-65518644 AAGAAAGAACAAGTGAGCATTGG - Intergenic
931852937 2:66271362-66271384 CAGAAAGGACGACGGAGCAAGGG + Intergenic
932747631 2:74347206-74347228 AAGAAAGGGAAACTGGGCACGGG - Intronic
934879121 2:97958069-97958091 CAGAAAGCACAACAGTGCAAAGG + Intronic
934960768 2:98670702-98670724 GAGAAAGGGCAACTAGGCAGTGG - Intronic
937970604 2:127546120-127546142 CAGAAAGGGCATCTGGGGCTGGG - Intronic
943125736 2:183792213-183792235 CAGACAGGGCAGCTGGGCAGAGG + Intergenic
943339218 2:186657441-186657463 CAAAAAGATCAACTGGGAATTGG + Intronic
944168174 2:196745237-196745259 CAGAAAGGAGAGCTGGACAGAGG + Intronic
947322698 2:228939710-228939732 CAGAAAGAAGAACTGATCATGGG - Intronic
947903941 2:233745923-233745945 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947905344 2:233757278-233757300 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947906013 2:233763714-233763736 GAGAAAGCACAACCTGGCATTGG + Intronic
947940825 2:234053794-234053816 GAGAAAGGAAAGGTGGGCATTGG + Intronic
948730330 2:239959488-239959510 ATGAAAGCACAGCTGGGCATTGG - Exonic
948909788 2:240997304-240997326 CAGAGAGGCAAACTGGGCCTGGG - Intergenic
1168764228 20:371129-371151 CAGGCAGGACCACTGGGGATAGG - Intronic
1168843126 20:922492-922514 TAGAAAATACAACTGGCCATGGG + Intergenic
1169374986 20:5059276-5059298 CATAAAGGAGAACTGGGGTTGGG - Intergenic
1169826753 20:9777190-9777212 GAGAAAAGAGAACTGTGCATTGG + Intronic
1170028353 20:11916184-11916206 CAGAAAGGCCTACCTGGCATGGG + Intronic
1170934545 20:20798088-20798110 CAGAAAGCAGATCTAGGCATGGG - Intergenic
1171214393 20:23341743-23341765 CAGTAAGGACAGATGGGAATTGG - Intergenic
1171899790 20:30846909-30846931 CAGTAGGGGCAACTGGGCAGAGG + Intergenic
1172065718 20:32218822-32218844 GAGAAAGGACAATGGTGCATGGG + Intronic
1172799405 20:37565482-37565504 CAGAAAGGACGACTGAGGAGGGG + Intergenic
1172998991 20:39092091-39092113 AAGACAGGTCACCTGGGCATAGG - Intergenic
1174822895 20:53742896-53742918 CAGATAGGTAAACTGGGGATTGG + Intergenic
1175060101 20:56234099-56234121 CAGAAAGCAGAACTGGGCCAAGG - Intergenic
1178579418 21:33825436-33825458 CAGAACTGACGTCTGGGCATGGG + Intronic
1179593793 21:42428864-42428886 AAGAAAAGACAACTGGCCACAGG + Intronic
1180830064 22:18900553-18900575 CAGACGGGACAACCGGGCAGAGG + Intergenic
1181469257 22:23127843-23127865 TGGAAAGGAGAACTGGGCTTGGG - Intronic
1182883492 22:33753905-33753927 CAAAAAAAATAACTGGGCATGGG + Intronic
1183236613 22:36623484-36623506 CAGAGAGGGAAACTGGGCACAGG - Intronic
1184887633 22:47356134-47356156 GAGGAAGGACACCTGGGCACAGG - Intergenic
1185097388 22:48818596-48818618 TAGAAAGGAGAAATGGGCATCGG - Intronic
1203280155 22_KI270734v1_random:125824-125846 CAGACGGGACAACCGGGCAGAGG + Intergenic
950040682 3:9917354-9917376 GAGAAAGGACCACTGGGCTTCGG - Exonic
950143627 3:10632639-10632661 CACAAAGGGACACTGGGCATGGG + Intronic
950313350 3:11978285-11978307 GAGAAAGGAGGACTGGCCATAGG + Intergenic
950748245 3:15108003-15108025 CAGAAAGCAAAACTGCGGATGGG + Intergenic
950868117 3:16205920-16205942 CAGAAAGGAAAAGAGGGTATTGG + Intronic
952753697 3:36847271-36847293 CAGAGAGGAAAACCGGCCATTGG - Exonic
953984189 3:47428693-47428715 CAGAAAGGGCAGCTGAGCACAGG + Intronic
954201743 3:49027377-49027399 TAGAAAGGACAACATGGCACAGG + Intronic
956427462 3:69151558-69151580 CACAATAGACATCTGGGCATGGG - Intergenic
956509004 3:69974600-69974622 CAGAAAGGACAACTTGGATGAGG - Intergenic
957799124 3:85051805-85051827 AAGAAAAGAAAACGGGGCATTGG + Intronic
957806091 3:85151092-85151114 AAGAAAGAACAAATGGGTATGGG + Intronic
958406833 3:93763280-93763302 CAGACGGGACAGCTGGGCAGAGG + Intergenic
959707896 3:109356250-109356272 CATAAAGGAAAACGGAGCATGGG + Intergenic
964506414 3:157404920-157404942 CAGAAAGGACAACTGGGCATTGG - Intronic
965045156 3:163568592-163568614 CATAATGGACAACTGGGTCTTGG + Intergenic
965602752 3:170471148-170471170 CAGACAGGACAACAGGACAGTGG + Intronic
965971859 3:174568514-174568536 AAGGAAGGACAACTGGGAAAGGG + Intronic
966891974 3:184413742-184413764 AAAACAGGACAACTGGGGATTGG - Intronic
967473669 3:189891236-189891258 CAGAAAGGATAGCAGGGCACCGG + Intronic
968303211 3:197631529-197631551 GAGAAAGGGCAGCTGGGCCTGGG + Intergenic
968680257 4:1913796-1913818 AAGAAAAGACAGCTGGGCACAGG - Intronic
970313242 4:14804663-14804685 CAGGAAGGACCTCTGGGCAGAGG - Intergenic
971977091 4:33704376-33704398 CAGAAAGGAGAAATGAGCAGGGG + Intergenic
973817474 4:54632198-54632220 CAAAAAGGACAAGTAGGCAAGGG - Intergenic
974240023 4:59235311-59235333 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
974493450 4:62596023-62596045 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
975063880 4:70037873-70037895 CAGACAGGGCAGCTGGGCAGAGG - Intergenic
977293060 4:95183836-95183858 CAGATAGGAAAACTGAGCAATGG - Intronic
977604351 4:98967438-98967460 CAGAAAGGCCCACTAGTCATTGG - Intergenic
978308059 4:107353912-107353934 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
978441219 4:108736076-108736098 CAGACAGGACAACATGGCAGAGG - Intergenic
978811273 4:112852232-112852254 CAAAAAGGTCCACTGGGCAAAGG - Intronic
979632242 4:122916737-122916759 CAGAAAGCAAAACTGGACAAGGG - Intronic
981956022 4:150475389-150475411 CAGGAAAGACAACTGGGTCTGGG + Intronic
982927979 4:161363931-161363953 CAGAAAGTAGAAATGGGAATTGG + Intergenic
983290898 4:165803214-165803236 CAAAAAGGACAACTTTGCCTAGG + Intergenic
983662183 4:170139998-170140020 CAGAAAGGAAACCTAGACATAGG - Intergenic
983818980 4:172169960-172169982 CAGAAAGGAAAACTGAGAGTTGG + Intronic
985015564 4:185630277-185630299 AAGAAAAGAAAACTGGGTATAGG + Intronic
985291301 4:188390948-188390970 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
985532843 5:443813-443835 CAGGAAGGACAACTGCGCCTGGG - Intronic
987401784 5:17485746-17485768 CAGAACAGACAAGTGGGCCTGGG + Intergenic
988157655 5:27476137-27476159 CAGAAAGGACAAAAGAGAATGGG + Intergenic
991935278 5:71794278-71794300 CAGACGGGACAGCTGGGCAGAGG + Intergenic
992872845 5:81023973-81023995 ACGAAAAGACAACTGGGAATGGG - Intronic
993274238 5:85835678-85835700 CAGAAAGTAAAACTGTACATAGG - Intergenic
994516214 5:100775538-100775560 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
994571701 5:101524156-101524178 CAGATAGGAAAACTGGTCTTAGG + Intergenic
995419021 5:111941701-111941723 CAGACAGGACATCTAGGAATGGG + Intronic
995838946 5:116424921-116424943 CAGAGATGAACACTGGGCATTGG - Intergenic
996215476 5:120860290-120860312 CTCAAAGGACAAGTGAGCATGGG - Intergenic
997214683 5:132101025-132101047 TTGAGAGGACAACTGGGTATAGG - Intergenic
997731752 5:136186081-136186103 ATGAAAGGGCAAATGGGCATTGG - Intronic
999111417 5:149124821-149124843 GAGAAGGGACAACTGGGCAAAGG + Intergenic
1001282309 5:170395556-170395578 GAAAAATGACATCTGGGCATGGG - Intronic
1002401130 5:178992092-178992114 CAGGAAGGACAGCTGGGCTGTGG + Intronic
1002790891 6:436628-436650 CAGAGATGAAAACTGGGCGTCGG - Intergenic
1002952032 6:1823575-1823597 CAGAAAGGGCATGTGGGCAGTGG - Intronic
1004629194 6:17405597-17405619 CAGAAAGTGAAACTGGGCAAAGG + Intronic
1006174400 6:32113343-32113365 CAGAAAGACAAAGTGGGCATAGG + Intronic
1006489615 6:34375957-34375979 CAGAAAGCAAAACTGAGCGTAGG - Intronic
1007400764 6:41601042-41601064 CTGGAAGGACACCTGGGAATGGG - Exonic
1009505349 6:64470166-64470188 GAGAAAAGACAACTGGGCCCGGG - Intronic
1010282267 6:74035630-74035652 CAGGAAGGACAAGGGGTCATGGG - Intergenic
1010845104 6:80696911-80696933 CAGAAAGGACATATGAGCCTGGG - Intergenic
1011509521 6:88085068-88085090 AAGAAAGGACAAGAGGACATGGG + Intergenic
1013470334 6:110458351-110458373 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1014759111 6:125335887-125335909 AAGTAAGGTCAACTGGGAATCGG - Intergenic
1015907971 6:138137254-138137276 AAGAAAGGACAACTGCACAAAGG + Intergenic
1017282283 6:152637388-152637410 CAGAAAGGTCACCCGGGCAGTGG - Exonic
1018938737 6:168293703-168293725 CAGAAAGGACTGCTGGTCAGTGG - Intronic
1019782398 7:2950885-2950907 AAGTAAAGACATCTGGGCATGGG + Intronic
1022555570 7:31291812-31291834 CAGAAAGGACAGTTGGGATTTGG - Intergenic
1022705820 7:32801230-32801252 AAGAAAGGACAGCTGGGCCCGGG - Intergenic
1022752800 7:33249203-33249225 TAGAAAGAACTTCTGGGCATGGG + Intronic
1023570841 7:41569998-41570020 TAGAAAGGCCATCTGGACATTGG - Intergenic
1023736120 7:43237427-43237449 CAGAGTGGACCACTGAGCATTGG + Intronic
1023857340 7:44192765-44192787 CTGAAAGGAAAACTTGGTATGGG - Intronic
1026478938 7:70762594-70762616 GAGAAAGGCCAACTGGCCAGAGG - Intronic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1030386173 7:108870721-108870743 AAAAAAGAACAGCTGGGCATTGG - Intergenic
1030706287 7:112697212-112697234 CAGAAGGGGCAGCTGGGCAGAGG + Intergenic
1030922443 7:115408539-115408561 CAGAAAGGAGAGTAGGGCATTGG - Intergenic
1031937317 7:127749124-127749146 CAGAAAGATCACCTGGGCCTGGG - Intronic
1031960085 7:127981307-127981329 CAGAAAGAACAACTGGGCATGGG - Intronic
1033166126 7:139040138-139040160 CAGGTAGGACCAGTGGGCATGGG + Intergenic
1037879026 8:22564135-22564157 CTGAAAGGACATCGTGGCATAGG - Intronic
1040038639 8:42895873-42895895 CCGAAAGGAGCACAGGGCATGGG + Intronic
1041152977 8:54955512-54955534 CTCAGAGGACAACTGGGCCTTGG + Intergenic
1043745597 8:83869813-83869835 CAGAAAGGAGACCATGGCATGGG - Intergenic
1043833530 8:85018005-85018027 CAGATAGAACAACAGGGCAGAGG + Intergenic
1044735745 8:95276348-95276370 AAGAAAGGAGAACTGGGAAAAGG - Intergenic
1044847572 8:96397360-96397382 CAGAAAGAACACCAGGGCTTTGG + Intergenic
1045294939 8:100864302-100864324 GAAATAGGACAACTGGGCACGGG + Intergenic
1046638952 8:116703807-116703829 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1046717553 8:117584228-117584250 GAGATAGGACAAATGAGCATGGG + Intergenic
1048352358 8:133626447-133626469 ATGAAAGGAAAACTGGGGATTGG + Intergenic
1048969499 8:139637039-139637061 CAAAAAGGAAAAATGGGAATAGG + Intronic
1049561730 8:143315554-143315576 AAGAAAGGACAGCTGGGCCCGGG - Intronic
1049846516 8:144804599-144804621 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1049880092 8:145056005-145056027 AAGAAAAGACACCTGGGCCTGGG - Exonic
1049881412 8:145066687-145066709 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1053423772 9:37997867-37997889 CAGAAAGGACAACAAGGCCCTGG + Intronic
1053539659 9:38960249-38960271 CAGAAAATACATCTGGGTATGGG - Intergenic
1054626482 9:67403669-67403691 CAGAAAATACATCTGGGTATGGG + Intergenic
1054793793 9:69279821-69279843 CAGAGAGCAGAACTGGGGATGGG - Intergenic
1055122314 9:72675780-72675802 CAGAAAAGACAAAAAGGCATGGG - Intronic
1055805853 9:80092528-80092550 CAGAAAGGGCGAGTGGGCAAAGG + Intergenic
1056462784 9:86824358-86824380 CATAAAGGAAAAATGGGCCTAGG - Intergenic
1056784682 9:89581955-89581977 GAGAAAGGGGAGCTGGGCATCGG + Intergenic
1058197266 9:101993060-101993082 CAGAAAGGTAAACTGGGTATGGG - Intergenic
1058415379 9:104783402-104783424 CAGTCAGGACAAATGGGCACAGG + Exonic
1058721323 9:107767407-107767429 CAGAAAGGACACCTGTTGATAGG + Intergenic
1059963409 9:119589697-119589719 CAGAAAGGAAAGCTGGGGAAAGG - Intergenic
1061785590 9:133026049-133026071 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1062081497 9:134626411-134626433 CAGAAAAGAGAAATGGGCCTGGG + Intergenic
1062484322 9:136767184-136767206 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1186214426 X:7283698-7283720 CACAAAAGGCAACTGGGCAGTGG + Intronic
1186875037 X:13808365-13808387 CAGAAAGGGCTACTGGTCTTGGG + Intronic
1187736165 X:22305762-22305784 TAGAAAGGACCACTGGCCAGTGG + Intergenic
1187823867 X:23315523-23315545 CAGAAAAGAGAACTAGCCATGGG - Intergenic
1188685812 X:33068373-33068395 GAGAAAGAACACCTGTGCATTGG + Intronic
1189008512 X:37020238-37020260 CAGAAAAGACAACTGGAATTAGG + Intergenic
1189040210 X:37534773-37534795 CAGAAAAGACAACTGGAATTAGG - Intronic
1189219849 X:39362197-39362219 GCGAAAGGACAACTGGGGTTGGG - Intergenic
1189825199 X:44911062-44911084 CAGAAGGGGCAGCTGGGCAGAGG + Intronic
1193611318 X:83634850-83634872 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1193790658 X:85812337-85812359 CAGAAAGGACCAGTGGGCAGTGG - Intergenic
1193986552 X:88248848-88248870 CAGCATAGACACCTGGGCATGGG + Intergenic
1195626072 X:107006663-107006685 CAGAAAGCGGAACTGGGCAGAGG + Intergenic
1198156551 X:133966435-133966457 CAGTAAGGGCAGTTGGGCATTGG - Intronic
1198627155 X:138589417-138589439 CAGTAAAGTCATCTGGGCATGGG + Intergenic
1200327754 X:155260458-155260480 CAGACAGGACAACTGTTCCTTGG - Exonic
1200684236 Y:6245441-6245463 CAGCAGGGTCAACTGCGCATAGG + Intergenic
1201048397 Y:9908945-9908967 CAGCAGGGTCAACTGCGCATAGG - Intergenic
1201708202 Y:16959829-16959851 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1201748436 Y:17405782-17405804 AAGAAAAGACAGCTGGGCCTGGG - Intergenic