ID: 964513233

View in Genome Browser
Species Human (GRCh38)
Location 3:157476674-157476696
Sequence GCTCATGTATTCTACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964513233_964513243 16 Left 964513233 3:157476674-157476696 CCCTGCAGGTAGAATACATGAGC 0: 1
1: 1
2: 0
3: 15
4: 132
Right 964513243 3:157476713-157476735 CTCAGGTTCTTTGTGTCAAGGGG 0: 1
1: 0
2: 1
3: 21
4: 219
964513233_964513242 15 Left 964513233 3:157476674-157476696 CCCTGCAGGTAGAATACATGAGC 0: 1
1: 1
2: 0
3: 15
4: 132
Right 964513242 3:157476712-157476734 CCTCAGGTTCTTTGTGTCAAGGG 0: 1
1: 0
2: 1
3: 17
4: 164
964513233_964513240 14 Left 964513233 3:157476674-157476696 CCCTGCAGGTAGAATACATGAGC 0: 1
1: 1
2: 0
3: 15
4: 132
Right 964513240 3:157476711-157476733 ACCTCAGGTTCTTTGTGTCAAGG 0: 1
1: 0
2: 1
3: 33
4: 247
964513233_964513236 -1 Left 964513233 3:157476674-157476696 CCCTGCAGGTAGAATACATGAGC 0: 1
1: 1
2: 0
3: 15
4: 132
Right 964513236 3:157476696-157476718 CCCAACAGCCCAGTCACCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964513233 Original CRISPR GCTCATGTATTCTACCTGCA GGG (reversed) Intronic
900827960 1:4941598-4941620 GTGCATGTATTATACCTGCCTGG - Intergenic
900916590 1:5643913-5643935 GCTCAGGGCTCCTACCTGCACGG - Intergenic
907395154 1:54184542-54184564 ACTCATTTATGGTACCTGCATGG - Intronic
908234992 1:62139990-62140012 GCTCATGTGATCTGCCTGCCTGG + Intronic
909900668 1:81130690-81130712 GTTCATGTTTTCTGCCTTCAAGG - Intergenic
911772329 1:101761777-101761799 GCTAATCTATACTATCTGCAAGG - Intergenic
912172129 1:107113458-107113480 GCTCATGCAATCCACCTGCCTGG - Intergenic
916322602 1:163521767-163521789 GCTGATGTAGGCTTCCTGCAAGG + Intergenic
921417936 1:214912298-214912320 GTGCCTGTATTCTAACTGCAAGG - Intergenic
921671182 1:217925366-217925388 TCTGATGTATTCTACATCCAAGG - Intergenic
922689103 1:227672997-227673019 GCTCAACTCTTCTTCCTGCAAGG + Intronic
923984800 1:239369331-239369353 TATCATGTATTCAACCTGGAAGG + Intergenic
924243031 1:242057910-242057932 GCTGATGTAATCTCCCTGCAGGG + Intergenic
1068340073 10:55689242-55689264 AATCATGTATTCTACCAACAGGG + Intergenic
1069659435 10:70113911-70113933 GCTCATGTGTGCTGGCTGCATGG - Exonic
1070153084 10:73817313-73817335 GCTCAGGGAATCTACCTGGAAGG + Intronic
1070182900 10:74031684-74031706 GCTCAAGTAATCTGCCTGCGGGG - Intronic
1072197321 10:93127666-93127688 GCTCATGTGATCCACCTGCCTGG + Intergenic
1073248735 10:102108901-102108923 TCTCATGTACTCTGCCAGCATGG - Intronic
1078931270 11:15913570-15913592 GATCAAGTGTTCTAGCTGCAGGG + Intergenic
1079394436 11:20049805-20049827 TCTCTTGTTTTCTACCTGCCTGG + Intronic
1082707588 11:56511575-56511597 GCTCCAGTAATCTACCTGCCTGG - Intergenic
1083455873 11:62778284-62778306 GTTCATGTCTCCTACCTGGATGG + Exonic
1085611714 11:77956174-77956196 GCTCAAGCAATCTACCTGCCTGG - Intronic
1087606326 11:100382794-100382816 GGAAATGTCTTCTACCTGCAAGG - Intergenic
1095865411 12:46966368-46966390 GCTCATCAAATCCACCTGCAGGG - Intergenic
1100321142 12:93494062-93494084 GTTCATGTATTCTGGCTACATGG - Intronic
1100321532 12:93497936-93497958 GTTCATGTATTCTGGCTACATGG + Intronic
1100925735 12:99546167-99546189 ATTCATTTATTCTACCTGCCTGG + Intronic
1101654513 12:106708253-106708275 GCTCATGGATTCTATCAGGAAGG + Intronic
1102266195 12:111487689-111487711 CCTCAAGTAATCTACCTGCTTGG + Intronic
1104322419 12:127764274-127764296 GCTCATGTCTATTACCTGCCTGG - Intergenic
1106483693 13:30155151-30155173 GCTCATGTGCCCTGCCTGCAGGG - Intergenic
1109954308 13:69545954-69545976 GTTTATGCAATCTACCTGCAAGG - Intergenic
1116656324 14:47657911-47657933 ACTTATGTATTCTACCTACTGGG - Intronic
1116665300 14:47766755-47766777 ACTCATGTATTTTACCTACTCGG - Intergenic
1119061499 14:71479638-71479660 GCTCATGCATTCCTCCTGCCTGG + Intronic
1119602199 14:75983704-75983726 GCTCAAGTAATCCTCCTGCATGG - Intronic
1125388744 15:39168818-39168840 GCACCTGTATTTTATCTGCATGG + Intergenic
1126941048 15:53765881-53765903 ACCCATGTATACTACCTGCTTGG + Intergenic
1131629760 15:94164389-94164411 GTTTCTGTATTCTACCTGCAGGG + Intergenic
1132415490 15:101615898-101615920 CCTCATGCATTCTACCGACATGG - Intergenic
1135499679 16:22983508-22983530 CCTCATTTATTCTCTCTGCAAGG - Intergenic
1139007377 16:62589380-62589402 GTTCAAGCATTCTACCTTCAGGG + Intergenic
1140495938 16:75388470-75388492 ACTCATTTATATTACCTGCATGG - Intronic
1144997460 17:19280069-19280091 GCTCAGGCAGTCTACCTGCCTGG + Intronic
1146971059 17:37072822-37072844 CCTCATGTGTTCTGCCTGCCTGG + Intergenic
1148025695 17:44586072-44586094 ACTCAGGTATTCTAACTCCAAGG - Intergenic
1151185125 17:72358440-72358462 GCTCATAAATTCTTCCTCCAAGG + Intergenic
1151599217 17:75096035-75096057 GCTCAAGTGATCTACCTGCCTGG + Intronic
1152079820 17:78179745-78179767 ACTCATTTATTCTTCCTCCAGGG + Intronic
1155715946 18:28943911-28943933 GCTCATGTGATCCTCCTGCAAGG - Intergenic
1155931524 18:31713773-31713795 TCCCATGTATTTTACCTGCCTGG - Intergenic
1158432342 18:57400721-57400743 ACCTATGTATTCTACCTGCTGGG - Intergenic
1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG + Intronic
1159156219 18:64586738-64586760 CCTCATGTATTCTAGCTACAAGG - Intergenic
1161240140 19:3218411-3218433 GCTCATGTTTTCCACCTTCATGG - Intergenic
1164904486 19:31955903-31955925 CCTCATGTATTCCACCTGTTGGG - Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
925018414 2:549151-549173 GTTCATGTATTGTATCTGAAAGG - Intergenic
925672448 2:6325881-6325903 GCTCATGTGCTCTGCCTGCCCGG + Intergenic
926608017 2:14917026-14917048 GCCCATGGATTTTACCTACATGG + Intergenic
926674222 2:15606259-15606281 ACTCAGGTATTATACCTGCAAGG + Exonic
926799320 2:16645552-16645574 CCACATGTATTCTACCTTCAAGG + Intronic
927290180 2:21397446-21397468 ACTCATGTATTCTACCTATTTGG - Intergenic
929378411 2:41319132-41319154 GGTCAGGTATTCTACCTGAAGGG + Intergenic
935224537 2:101041789-101041811 GCTCAAGTGATCCACCTGCACGG - Intronic
935371339 2:102350176-102350198 ACTCATTACTTCTACCTGCATGG - Intronic
938232394 2:129672446-129672468 GCTCATGTAATCGACCTCCCTGG - Intergenic
938319600 2:130354332-130354354 GCTTCTGTATTCTACCTCCCTGG + Intergenic
938964816 2:136379030-136379052 ACCCATGTTCTCTACCTGCATGG + Intergenic
939172167 2:138709058-138709080 ACACATGTATTCTAGCAGCAGGG + Intronic
941624687 2:167818410-167818432 GCTCATTGATACCACCTGCATGG + Intergenic
944446923 2:199801412-199801434 GCTCAAGAAATCTACCTGCTTGG - Intronic
944519319 2:200547819-200547841 GCTCTTGTTTTCTAGTTGCATGG - Intronic
1169717441 20:8636160-8636182 GCACATGTATTCTACCTGCAAGG - Intronic
1170419283 20:16176482-16176504 TCTCATGAAATCTCCCTGCATGG - Intergenic
1173402269 20:42736203-42736225 GCCCATGTATTTTCCCTGCAGGG - Intronic
1173964851 20:47104786-47104808 CCTCATGTAATCCACCTGCCTGG - Intronic
1181117719 22:20643693-20643715 CCTCAAGGATTCTCCCTGCATGG + Intergenic
1181660080 22:24340015-24340037 GCTCAGGTAATCCACCTGCCTGG + Intronic
1184915961 22:47569201-47569223 GCACACGTATTCCCCCTGCAAGG + Intergenic
951724632 3:25743439-25743461 GCTCATGCCTTCTACCTAAAAGG + Intronic
951964838 3:28370680-28370702 GTTCATGAATTATAACTGCATGG - Intronic
952322263 3:32289045-32289067 GCTCATATATTCTGCCTTCCTGG - Intronic
952778683 3:37071902-37071924 GTACATGGAATCTACCTGCAAGG + Intronic
958486056 3:94710688-94710710 GCTCATATATTCTAGTTGCAGGG + Intergenic
960251993 3:115465738-115465760 GCTCATTTATTCTGCCTGTAAGG + Intergenic
960263109 3:115590465-115590487 GCTGATGTATTCTCAGTGCATGG + Intergenic
962183960 3:133238693-133238715 GCTCATGTATTTTGTCTTCATGG + Intronic
964513233 3:157476674-157476696 GCTCATGTATTCTACCTGCAGGG - Intronic
967130319 3:186464732-186464754 GCCCATGTATTCTACCTACTGGG - Intergenic
967513337 3:190338069-190338091 ACTCATGTACTCTACCTACTGGG - Intronic
967565873 3:190971624-190971646 ACCCAAGTATTCTACCTACAGGG + Intergenic
968498757 4:933648-933670 GCTCATGTATGTTACCTGCCTGG + Intronic
968683207 4:1936234-1936256 GCTCACGTCTTCTACATGCATGG - Intronic
975649627 4:76579707-76579729 GCTCATTTACTCCACCTGCCTGG + Intronic
978153982 4:105468792-105468814 CCTCATGCATTAGACCTGCATGG + Intronic
985099237 4:186441814-186441836 GCTCATCTATTCTCTCTCCATGG + Intronic
986902719 5:12456758-12456780 GATCATATTTTCTAACTGCATGG + Intergenic
987014459 5:13803736-13803758 CCTCATCTTTTCTTCCTGCAAGG - Intronic
988638050 5:33008843-33008865 GCTCATTCACTGTACCTGCAGGG - Intergenic
992863399 5:80934680-80934702 ACTCATCTATTTTCCCTGCAGGG - Intergenic
994183546 5:96794420-96794442 GCTCAAGTAATCCACCTGCCTGG + Intronic
994604355 5:101948217-101948239 GTACATTTATTCTACCTTCATGG - Intergenic
995387240 5:111601576-111601598 ACTCATGTCTTCCAACTGCATGG + Intergenic
995712314 5:115048058-115048080 ACTCATATATTCTGCCTGCGAGG + Intergenic
996117743 5:119636139-119636161 GCTCAAGTGTTCTACCCGCCTGG + Intronic
996701786 5:126457399-126457421 GCTCAGGTGATCTACCTGCCTGG - Intronic
998327334 5:141293015-141293037 ACTCATGTATTCTAGCTACTTGG - Intergenic
998932993 5:147201686-147201708 ACTCATGTATTCTAGTTGCTTGG - Intergenic
999044200 5:148449781-148449803 GCTAATGGGTTCTACCTTCATGG + Intergenic
1002973238 6:2046692-2046714 GCTCATGCAATCCACCTGCCTGG + Intronic
1005192748 6:23244421-23244443 GCTCATGTATTTTAGCTGTTGGG - Intergenic
1006751579 6:36381162-36381184 CCTCCTGCATTCTTCCTGCAAGG - Intronic
1007696817 6:43739277-43739299 GCTCATTTATTATAGCTACATGG + Intergenic
1007766449 6:44163139-44163161 GCTGCTGCATTCTACCTGCGAGG - Intronic
1009050400 6:58268211-58268233 TCTGATGGATTCTACCTTCAAGG - Intergenic
1014598210 6:123372543-123372565 GATCATGTATTCCATATGCATGG - Intronic
1025841380 7:65152883-65152905 GCTCAAGCAATCTACCTGCCTGG + Intergenic
1025881668 7:65543086-65543108 GCTCAAGCAATCTACCTGCCTGG - Intergenic
1025891773 7:65659546-65659568 GCTCAAGCAATCTACCTGCCTGG + Intergenic
1028230868 7:88305321-88305343 CTGCATGTATTCTACCTGCATGG - Intronic
1030312647 7:108083729-108083751 GCCCATGTATTCTATCTGTTAGG - Intronic
1031811447 7:126374572-126374594 GCACATGTATTCCCACTGCAAGG - Intergenic
1031995992 7:128231399-128231421 GCTGGTGTCTTCCACCTGCATGG + Intergenic
1032715806 7:134508372-134508394 ACTCCCGGATTCTACCTGCAGGG + Intergenic
1040058799 8:43086661-43086683 CCTCAAGTAATCTGCCTGCATGG + Intergenic
1045514372 8:102844272-102844294 GCTCATGCAATCTACCGGCCTGG - Intronic
1046789109 8:118301847-118301869 GGTCATGGACTCTACCTGTAAGG - Intronic
1047066530 8:121290602-121290624 GCTCCTGTATTGAACCTGGAAGG - Intergenic
1048070073 8:131011955-131011977 ACTCATGTATTCTACCTATCAGG - Intronic
1048493745 8:134918544-134918566 CCTCTTTTTTTCTACCTGCATGG - Intergenic
1048544872 8:135377424-135377446 CCTCATGTGATCTACCTGCCTGG + Intergenic
1050488876 9:6166034-6166056 GCTGGTGTATTCTACCTATAAGG + Intergenic
1052431753 9:28375679-28375701 ACCCATGTATTCTACCTGTTGGG - Intronic
1055693563 9:78859074-78859096 CCACATGTATACTACCTGCCTGG + Intergenic
1057864182 9:98666289-98666311 ACCCATGTATTCTACCTGTTGGG - Intronic
1059302402 9:113324620-113324642 GCTCAAGTGATCTACCTGCCTGG + Intronic
1060093216 9:120763263-120763285 ACTCATTTATGTTACCTGCACGG + Exonic
1060250761 9:121985219-121985241 AGTCATGTGTTCTATCTGCACGG + Intronic
1187444675 X:19350803-19350825 ACTCATTTATTCTACCTGGCTGG - Intronic
1189452266 X:41147683-41147705 CCTCAGGTAATCTACCTGCCTGG + Intronic
1192059300 X:67807060-67807082 GTTCATTTATTCTACTTGAAAGG - Intergenic
1195704283 X:107727571-107727593 GCTCAGCTATGCTACCTACAGGG - Intronic
1196772060 X:119304090-119304112 CTCCATGTCTTCTACCTGCAAGG + Intergenic
1197656727 X:129124917-129124939 TCCCATGTCTTCTACCCGCAAGG + Intergenic
1198486255 X:137090385-137090407 GCTCATGTATTTTATTTGGAAGG + Intergenic
1199819428 X:151430214-151430236 ACTCATGTACTCTACCATCAGGG + Intergenic