ID: 964513949

View in Genome Browser
Species Human (GRCh38)
Location 3:157485990-157486012
Sequence TGGCAAACCCAAAATTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964513944_964513949 12 Left 964513944 3:157485955-157485977 CCCCTAACAAGCTTGACAAAATT 0: 1
1: 0
2: 0
3: 13
4: 235
Right 964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG 0: 1
1: 0
2: 1
3: 21
4: 278
964513946_964513949 10 Left 964513946 3:157485957-157485979 CCTAACAAGCTTGACAAAATTAC 0: 1
1: 0
2: 1
3: 11
4: 174
Right 964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG 0: 1
1: 0
2: 1
3: 21
4: 278
964513945_964513949 11 Left 964513945 3:157485956-157485978 CCCTAACAAGCTTGACAAAATTA 0: 1
1: 0
2: 0
3: 15
4: 259
Right 964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG 0: 1
1: 0
2: 1
3: 21
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964513949 Original CRISPR TGGCAAACCCAAAATTATAA TGG Intronic
901121918 1:6902483-6902505 TGGAAAAGCCAAAATTGTATGGG + Intronic
903538971 1:24086137-24086159 TGGCAAACCCATTGTTCTAAAGG - Intronic
905982241 1:42239996-42240018 TGGCAAATCCTAAATCTTAAGGG - Intronic
907484808 1:54769879-54769901 AGACAAAGACAAAATTATAAGGG - Intergenic
908557737 1:65274063-65274085 AGACAAATCTAAAATTATAATGG - Intronic
908916822 1:69137898-69137920 TATCAAACTTAAAATTATAAAGG - Intergenic
909154427 1:72054136-72054158 TGGCAAAAATAAAATTCTAAAGG + Intronic
909304311 1:74053308-74053330 TGTCATACTCAAAATTATATAGG - Intronic
909856541 1:80539986-80540008 TTCCAAAACCATAATTATAAGGG - Intergenic
910874997 1:91870401-91870423 TAGCAAACCAAAAATTAGAAAGG + Intronic
911276066 1:95860270-95860292 TGGAAAAACCAAAATTATGGAGG - Intergenic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
911803339 1:102173747-102173769 TGGAAAATTTAAAATTATAAGGG + Intergenic
911868815 1:103064809-103064831 TGGAAAAGTCAAAATTATAGAGG + Intronic
911942288 1:104061929-104061951 TGGCAAAAACAAAGATATAAAGG + Intergenic
912581872 1:110728317-110728339 TACCAAGCCCAAAATTATACAGG + Intergenic
912731851 1:112114153-112114175 TGGCAAATCCAAAATCTTCAGGG + Intergenic
912917382 1:113828942-113828964 TGGCAAAGCCTCAATTAAAATGG - Intronic
913996248 1:143653734-143653756 TGGCAACCCCGACATCATAAAGG + Intergenic
914883455 1:151565696-151565718 TGACAAAGCAAAAATTACAAAGG - Intronic
918494577 1:185119803-185119825 AGGCAAACTTAAAATTTTAATGG - Exonic
918707033 1:187676342-187676364 TGACAAAGGCAAAATTATAGGGG - Intergenic
919488304 1:198171700-198171722 TGCCAAGGCCAAAATCATAAAGG - Intronic
920614050 1:207471762-207471784 TGGTATACCCAAAATTAAGATGG - Intronic
920727818 1:208453305-208453327 TGTTAAGTCCAAAATTATAATGG + Intergenic
921513528 1:216061801-216061823 AGGCAAACCCAAACTTAAACTGG + Intronic
921651836 1:217688985-217689007 TGACAAAGTGAAAATTATAATGG - Intronic
922887677 1:229032385-229032407 TGGCAAAGCCAAGATTTAAATGG + Intergenic
922914616 1:229246471-229246493 AGACAAATTCAAAATTATAATGG + Intergenic
923738074 1:236630726-236630748 TGGCAAACCCACAAGTACACGGG - Intergenic
1065227119 10:23555550-23555572 CAGAAAACCCAATATTATAAAGG - Intergenic
1066130025 10:32384266-32384288 TGGCACACCCAAAATGAAATGGG - Intergenic
1066226754 10:33390855-33390877 TTGCAAAGCCAAAATTGGAATGG + Intergenic
1069967567 10:72133977-72133999 TGGCAAATCCAAAATTAGAAGGG + Intronic
1071402413 10:85287257-85287279 TGTCAAATCCAGAATTGTAATGG + Intergenic
1071747953 10:88443177-88443199 TGGAAAATCCCAAATTAAAAGGG - Intronic
1071881660 10:89905424-89905446 TAGCAAATCCAAAATTCTTAGGG - Intergenic
1073940107 10:108687660-108687682 TGCCAAACCCAATTTTATGAAGG - Intergenic
1074010884 10:109478280-109478302 TTGCAAACACAAAATTATACAGG - Intergenic
1074428873 10:113375770-113375792 TAGAAAACCCAAAATAACAATGG - Intergenic
1074667412 10:115745089-115745111 TGGGAAAGGCAAAACTATAAAGG - Intronic
1075843453 10:125524802-125524824 GGTCAAACAGAAAATTATAAGGG - Intergenic
1079218366 11:18536272-18536294 GGACAAACCCAAAAGTATAAAGG - Intronic
1080152403 11:29068657-29068679 TGGAAAATCTAAAAGTATAAAGG + Intergenic
1081149993 11:39616194-39616216 TGGAAAACCCTAAATGATAGGGG + Intergenic
1083044045 11:59716390-59716412 TGGCTAGACCAATATTATAATGG - Intronic
1084841517 11:71854971-71854993 ATGCAAACCTAAAATTATTAAGG + Intergenic
1085975806 11:81652995-81653017 TGACAAACATAAAATTATGAAGG - Intergenic
1086121273 11:83306749-83306771 TGTCAAGCCCAAAATTAGAAGGG - Intergenic
1087986361 11:104686207-104686229 TGCCAAATCCAAGATTATATGGG - Intergenic
1088444236 11:109906808-109906830 TGGAAAACCCAAACAGATAAAGG - Intergenic
1090480771 11:127066419-127066441 TGGGAAACAGAAAAGTATAAAGG - Intergenic
1090572830 11:128067061-128067083 TAGCAAACACAAAACTAGAAGGG + Intergenic
1091518049 12:1206227-1206249 TGGCAAAACCACAATTAAAATGG - Intronic
1092867720 12:12778632-12778654 TGGCCAACCCAACATTAAAGGGG - Intronic
1093645114 12:21577145-21577167 TGATAAACACTAAATTATAATGG - Intronic
1094417787 12:30235660-30235682 AGACAAAAACAAAATTATAAAGG - Intergenic
1095238490 12:39828730-39828752 TGGCAAAAACAAAACTCTAAAGG + Intronic
1095555642 12:43500460-43500482 TGGCAAACTCTAAATTATGAAGG - Intronic
1096409035 12:51364242-51364264 TGGCGAACTCAAAAGTATTAAGG + Exonic
1098101561 12:67023201-67023223 TGCCTAACCCAAAGTCATAAAGG + Intergenic
1098305369 12:69097304-69097326 TGGCAAATCCAAAATCTTCAGGG + Intergenic
1098526050 12:71488336-71488358 TGACAAGCCCAAAAGTCTAAGGG + Intronic
1099693301 12:85989092-85989114 TGGAAAACCCAAAATCTTAATGG + Intronic
1100075166 12:90771862-90771884 TAGCAAAGACAAAACTATAATGG - Intergenic
1100422172 12:94446088-94446110 TTGCAAAGCAAAAAATATAAGGG - Intronic
1101032012 12:100669986-100670008 TGGCAGACCCAAGTTCATAAGGG + Intergenic
1101080759 12:101181327-101181349 TTGAATTCCCAAAATTATAATGG - Intronic
1101221650 12:102647454-102647476 GGGCAAAGCCAAAAGTAGAATGG + Intergenic
1107205423 13:37779897-37779919 TGGCAAACACAAAATGTTAGTGG - Intronic
1108347298 13:49558837-49558859 TTGCAAAGCAAAAATTACAAGGG - Intronic
1110880733 13:80569183-80569205 TGGCAGACTCTAAATAATAAGGG - Intergenic
1110957596 13:81575311-81575333 TGGAAAAGGCAAAACTATAAAGG - Intergenic
1111027979 13:82558224-82558246 TGAAAAACCTAAAATTAGAAGGG + Intergenic
1111297961 13:86308058-86308080 TGGCAAATCCAAAATCTTTACGG - Intergenic
1118507269 14:66427026-66427048 TGCCAGACCTCAAATTATAAAGG + Intergenic
1119404371 14:74388189-74388211 TGGCAAATCTAAAGTCATAAAGG - Intergenic
1119957182 14:78811183-78811205 AAGCAATCCCAACATTATAATGG + Intronic
1120130875 14:80806107-80806129 TGGCAAAAAGAAAATGATAATGG - Intronic
1120587911 14:86338177-86338199 TGTAAAACCCAAAACTATAAAGG - Intergenic
1120806776 14:88760025-88760047 TTGAAAACTCAAAAATATAAAGG - Intronic
1121834736 14:97081743-97081765 TTGAAAAGGCAAAATTATAAGGG - Intergenic
1124366802 15:29077871-29077893 TGCCAAACCCTAGAATATAATGG + Intronic
1125038626 15:35156995-35157017 TTACAAATCCAAAATTATAGTGG - Intergenic
1125875917 15:43144463-43144485 TGGCAATCCCACAATAAAAAAGG + Intronic
1126409038 15:48353126-48353148 TGGCAAAACCAAAGTTCCAATGG + Intergenic
1127430418 15:58901931-58901953 TGGCAAAGCCAATTTTAAAATGG + Intronic
1128920289 15:71604036-71604058 TAGAAAACCCAAAGTTAAAAAGG - Intronic
1129770253 15:78198855-78198877 TAGCAAACCCAAAATGCTCATGG + Intronic
1131322666 15:91410068-91410090 TGACAAACAGAAAATTATAAGGG + Intergenic
1131590641 15:93744516-93744538 TGGAAAAGGCAAAACTATAAGGG - Intergenic
1131857091 15:96609097-96609119 TGCCAAAACACAAATTATAAGGG - Intergenic
1133614074 16:7459409-7459431 TGGCAAATTGAAAATTATGATGG + Intronic
1134280223 16:12810496-12810518 TGATAAAGCCAAAATTATAAAGG - Intergenic
1135224588 16:20644775-20644797 TGGAAATCCCAAACTTACAAGGG + Intronic
1140166841 16:72561468-72561490 TCGCAAATGCAAAATTATCAGGG + Intergenic
1141680237 16:85539522-85539544 TGGATAACTCGAAATTATAACGG + Intergenic
1143931241 17:10428683-10428705 TGGCAAAAAAAAAATAATAATGG + Intergenic
1144083768 17:11788174-11788196 TGTAAAACACAAAATTCTAAAGG + Intronic
1146441543 17:32900307-32900329 TGGGAAACCCAATATCTTAAAGG + Intergenic
1147028088 17:37606958-37606980 TGGCAAAAAGAAAATTAAAAAGG + Intronic
1149356942 17:55848747-55848769 AGGCAAACCCAGAATCATCAGGG + Intergenic
1149418641 17:56487004-56487026 TAGCAAAGACAAAATGATAAAGG + Intronic
1149917907 17:60628555-60628577 TGGAAAAAGCAAAATTATGAAGG - Intronic
1151323625 17:73365981-73366003 TGGCAACCCCAAAATCATGGGGG + Intronic
1153191489 18:2545422-2545444 TGTCAAAGCCAAAATTAATAAGG + Intronic
1153704502 18:7732080-7732102 TGGAAAACACAAAATAAGAATGG + Intronic
1154391869 18:13944310-13944332 TGGCACACCCAAAATAGAAATGG + Intergenic
1156001805 18:32393626-32393648 TGGCAAACATAAAATTTAAAAGG - Intronic
1156055437 18:32997503-32997525 TGGCAAATCCAAAATCTTCAGGG - Intronic
1157488057 18:48103310-48103332 TGGCAAAGACAAAAGTATCACGG + Intronic
1158586764 18:58745522-58745544 TGGTAATCCCAAAATTATCCAGG - Intronic
1160083106 18:75749105-75749127 TCCCAAATCCAAAATTATTATGG - Intergenic
1163899230 19:20086919-20086941 TGGCCACCCAAAAACTATAATGG + Intronic
1164581846 19:29439490-29439512 TGACAGACCCAGAATTATCATGG + Intergenic
1166736520 19:45088837-45088859 GGGCAAACACAAATTTATACTGG - Intronic
1167788043 19:51651839-51651861 TGGAAAACCCAAAAGTGTAGAGG - Intergenic
1168342523 19:55633566-55633588 TTGCAAACCTAAAGTTACAAGGG + Intergenic
925694832 2:6565725-6565747 TGGCAAAATGAAAAATATAAAGG - Intergenic
925745078 2:7037005-7037027 TGGCAAACCCTAAGATTTAAAGG - Intronic
928293387 2:30060117-30060139 GGGCAAACCCCAGATCATAAAGG + Intergenic
929202583 2:39252863-39252885 AGGCAAACCCCAAAATATATTGG - Intronic
929366824 2:41168879-41168901 TGTCAAACCTAAAATGAAAATGG - Intergenic
930246319 2:48986721-48986743 TTGCAAACCCAAAGCTACAAGGG - Intronic
930436435 2:51349776-51349798 TGCCCAGCACAAAATTATAATGG - Intergenic
930738572 2:54804991-54805013 TGACAATCCCAAAAATAAAAAGG - Intronic
930769777 2:55119839-55119861 TGGCCAACCCATAATTATGCAGG + Intergenic
930798103 2:55414026-55414048 CTTCAAACCCAAAATTCTAAAGG + Intronic
930923650 2:56789720-56789742 TGGAAAAACTAAAATCATAATGG + Intergenic
933347962 2:81113889-81113911 TGGAAAACACAAAATAAAAAAGG - Intergenic
935489593 2:103700724-103700746 TGGAAAACTCAAAATTGTTAAGG + Intergenic
937892983 2:126954125-126954147 AGGCAAATCCACAATCATAATGG - Intergenic
938176642 2:129139028-129139050 AGGGAAACCCAAAATCAAAAAGG - Intergenic
938936290 2:136130525-136130547 TGGCAAAGCAACAGTTATAAGGG - Intergenic
941052542 2:160750643-160750665 TGCCACACCCAGCATTATAAAGG - Intergenic
941305614 2:163861876-163861898 TGGGAAACCCTAAATTGTATGGG - Intergenic
941328966 2:164153254-164153276 TGGTTAATCCAAAATCATAATGG - Intergenic
941784909 2:169487286-169487308 TGGACAAACCAAAATAATAATGG - Intronic
942991815 2:182211055-182211077 TGGCAAGCCCCATTTTATAATGG + Intronic
943011269 2:182452821-182452843 TGGCAAAACCAGAATAATCAAGG + Intronic
943013322 2:182478929-182478951 TCTCAAAACTAAAATTATAATGG + Intronic
944356941 2:198801502-198801524 TGGGAAAAGCAGAATTATAAAGG - Intergenic
945511714 2:210711368-210711390 AGGCAAACATAAAATTTTAAAGG + Intergenic
946684537 2:222254471-222254493 TGGGAAACCCAAATTTCCAAAGG - Intronic
946825705 2:223675552-223675574 TGGCAAGTCCAAAATTGTCAAGG - Intergenic
948298740 2:236885862-236885884 AGGCAAAAACAAGATTATAAAGG - Intergenic
1169049866 20:2566818-2566840 TGGCAACCCCAAAACTCCAATGG + Intronic
1169678341 20:8180414-8180436 TGGCAAACACACAATAAAAAAGG - Intronic
1170322015 20:15110602-15110624 TGGAAAACCAAAAAGTATGATGG + Intronic
1170406212 20:16040409-16040431 TAGAAAACCCATAATTTTAAAGG - Intronic
1172017583 20:31887190-31887212 TTGCAGAACCAAAATTACAAGGG + Exonic
1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG + Intronic
1174644779 20:52076414-52076436 TGTCAATTCCAAAATTCTAAAGG - Intronic
1176710043 21:10142979-10143001 TGGCAATCCTATAATTTTAAGGG - Intergenic
1177029461 21:15964511-15964533 TGCCAAAGCCAAAAGTTTAAGGG - Intergenic
1177261666 21:18737308-18737330 TGGAAAACACAAAATTTTCAAGG - Intergenic
1177453984 21:21310874-21310896 TGGAAAAGATAAAATTATAATGG - Intronic
1177532450 21:22378537-22378559 TGGCAAACCAAATGTGATAACGG - Intergenic
1177656986 21:24030206-24030228 TGGCAAAACCAAATTTTAAAGGG + Intergenic
1179659780 21:42866805-42866827 TCACAAACCCACAATTCTAAAGG + Intronic
1181920666 22:26317920-26317942 TTGCAAATCCAAAATCATGAAGG + Intronic
1183168845 22:36169447-36169469 TGGCAAACACAAAATTGACAAGG + Intergenic
1183639226 22:39083170-39083192 TTACAAAACCACAATTATAAAGG - Intronic
951196745 3:19832111-19832133 TAGCAAAAACAAAAATATAATGG - Intergenic
951240718 3:20283222-20283244 GGGCAAAAGCAGAATTATAACGG - Intergenic
952148832 3:30563788-30563810 TGTCAAACCCAAGAATTTAAAGG - Intergenic
953197221 3:40745955-40745977 GGGAAAACCTAACATTATAAAGG + Intergenic
953508833 3:43514508-43514530 AGACAAAGCCACAATTATAACGG + Intronic
953872204 3:46636631-46636653 TGGTAAACGAAAAATTATATTGG + Intergenic
954152982 3:48667736-48667758 TGGAAAAGTCAATATTATAAAGG + Intergenic
956914153 3:73853052-73853074 AGGCTGACCCAAAATAATAACGG - Intergenic
957532226 3:81455047-81455069 TGGAAAGCCTAAAATTAAAAAGG + Intergenic
957633721 3:82753871-82753893 TGACAAATCTAAAATTATTATGG - Intergenic
957828309 3:85480242-85480264 TGGAAAATCTAAATTTATAATGG - Intronic
959166593 3:102787464-102787486 TGCCAAATCAAAAATTACAATGG - Intergenic
959979906 3:112504408-112504430 GGCCAAACTCAAAACTATAAAGG - Intergenic
961238003 3:125385117-125385139 TGGGAAACCCCAACTTATAGTGG - Intergenic
964275718 3:155006850-155006872 TGGCAAACCCACAAATATGGAGG - Intergenic
964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG + Intronic
966598847 3:181754464-181754486 TGGAAAACACAAAATAACAAAGG + Intergenic
967870770 3:194227104-194227126 TAACAAACCCAAAATTAACAAGG + Intergenic
967905454 3:194495855-194495877 TGGCCAAGCCAAAATCTTAAAGG - Intronic
967956152 3:194879086-194879108 TGGCCACACCAAAATCATAAGGG + Intergenic
968857241 4:3135427-3135449 AAACAAACCCTAAATTATAAAGG - Intronic
969782613 4:9421010-9421032 ATGCAAACCTAAAATTATTAAGG + Intergenic
969906335 4:10399875-10399897 TAGCAATCCCATGATTATAATGG - Intergenic
970383638 4:15534422-15534444 TGTGAAAGCTAAAATTATAAAGG - Intronic
970923295 4:21420228-21420250 TGTAAAACACAAAATTAAAATGG + Intronic
970986766 4:22168062-22168084 TGGCAAGCCCAAAATTGACAGGG + Intergenic
971117473 4:23664773-23664795 TGTCAACCTCAAAAATATAATGG - Intergenic
971626831 4:28931836-28931858 TGCCAAACACAAACTTATCAGGG - Intergenic
971670877 4:29555721-29555743 TGGGATACCCACAATTAAAAGGG + Intergenic
971811269 4:31431231-31431253 TGGCAATCCTAAAAATATCAAGG + Intergenic
971912717 4:32815183-32815205 AGCCAAGCCCAAAAGTATAAGGG + Intergenic
972332553 4:38077457-38077479 TTTCAACCCCAAAATTATTAAGG - Intronic
972951731 4:44333811-44333833 AGGCAAATCCAAAAGTAAAAAGG + Intronic
973092118 4:46149631-46149653 TGGCCAACCCCACATTAAAAAGG + Intergenic
974212507 4:58797771-58797793 TGTCATACCCAAGATAATAAGGG - Intergenic
974497667 4:62653790-62653812 TGTGAAACCAAAAATTATCAGGG - Intergenic
974513834 4:62881573-62881595 TGTCTAACCCAAAGTCATAAAGG + Intergenic
976997080 4:91447347-91447369 TGACAAAGCCAACACTATAAAGG - Intronic
977433406 4:96961723-96961745 TGCCTAACCCAAGATCATAAAGG + Intergenic
978457958 4:108915782-108915804 TGGAAAAAGCAAAATTGTAATGG + Intronic
978784886 4:112598362-112598384 GGAAAAACCCAAAGTTATAAAGG + Intronic
979071561 4:116214128-116214150 TGGTAAATCCAAAATTTTCAAGG + Intergenic
980078941 4:128323374-128323396 TGGAAAACCAAGAATTATAGAGG - Intergenic
981568652 4:146129199-146129221 TGTCAAAACCACAATCATAATGG - Intergenic
981642513 4:146961140-146961162 TGGCAAGCACAGAATTAGAAAGG - Intergenic
981897708 4:149823730-149823752 TGGAAAGGCTAAAATTATAAGGG - Intergenic
982551546 4:156807406-156807428 TGGAAATCCCAATATTGTAAAGG + Intronic
984272336 4:177562296-177562318 TGACAGACCCCAGATTATAATGG + Intergenic
984523927 4:180833661-180833683 TGGAAAACACAAGACTATAAAGG - Intergenic
985885445 5:2673985-2674007 TTGCAAACCCATTATTATTAAGG - Intergenic
987054451 5:14178160-14178182 TGGCAAATCCAAAGTAATAAAGG - Intronic
987141343 5:14949796-14949818 TGAAAAACTCAATATTATAAAGG - Intergenic
987459918 5:18196992-18197014 TTGCAAAACCAAAATAAAAAAGG + Intergenic
987486125 5:18529532-18529554 TGACAAAACCAAAAATAGAATGG + Intergenic
988019140 5:25600684-25600706 TGTCAAAACAAAAATTATAAAGG + Intergenic
988300952 5:29426246-29426268 TGGAAAACTCAATATTCTAAAGG + Intergenic
989663688 5:43826074-43826096 AAGCATACCCAAAATGATAAAGG - Intergenic
990100389 5:52177905-52177927 TGGAAAAGGCAAATTTATAATGG + Intergenic
992315143 5:75544685-75544707 TGACAAACCCAGAAATATATGGG + Intronic
993535247 5:89076196-89076218 TGGAAAACCCTAAATAATACAGG - Intergenic
993804346 5:92385913-92385935 TTGCAAACACTAAAATATAAAGG + Intergenic
993941686 5:94066292-94066314 AACCAAACCCAAAATTAGAAAGG + Intronic
994968208 5:106701067-106701089 TTGTAAACCCATAATTTTAAAGG + Intergenic
996851215 5:127954879-127954901 TGGCAAACCCAAAATCTGTAAGG + Intergenic
997617368 5:135258184-135258206 TGGCATACACAAAATTTAAAGGG + Intronic
998728503 5:145046352-145046374 TGGGAAAAGCAAAATTTTAATGG - Intergenic
1000139192 5:158384966-158384988 TGGAAAACCCCAAATTACAATGG - Intergenic
1000206016 5:159059289-159059311 TGACATACCCAAAATAATCAGGG - Intronic
1000353742 5:160373373-160373395 TGGCTAAACCTAAATTATAATGG - Intergenic
1000589361 5:163139785-163139807 TGGCAAACACACAATGAAAAAGG - Intergenic
1003747235 6:9016331-9016353 TGCCAAAACCACAATTCTAAAGG + Intergenic
1004012476 6:11702825-11702847 TGGCAAGTCCCAAATTATCAGGG + Intergenic
1004471091 6:15929731-15929753 TGGCAAGTCCAAAATCATGAAGG + Intergenic
1005286180 6:24329476-24329498 CTGCAATCCCAAAATTATAATGG + Intronic
1005754157 6:28910663-28910685 TAGGAAACCCAAAATTTTATTGG - Intronic
1007025394 6:38567009-38567031 TTGCAACTCCAAAATTACAATGG + Intronic
1008180422 6:48321246-48321268 TGGAAAACCCAATACTTTAATGG - Intergenic
1008806279 6:55432816-55432838 TGGATAAACCAAAATTGTAAGGG - Intergenic
1009004193 6:57762155-57762177 TGGAAAACTCAATATTCTAAGGG + Intergenic
1011135759 6:84099017-84099039 TGCCAAACCCAAGGTCATAAAGG + Intergenic
1013036964 6:106394240-106394262 TGGAAAACCTAAGAATATAAGGG - Intergenic
1014469104 6:121793150-121793172 TGAAAATACCAAAATTATAAAGG + Intergenic
1014745246 6:125192912-125192934 TGGCAAACATTTAATTATAAGGG + Intronic
1014992425 6:128097976-128097998 TAGCAAAGACAAAATTCTAAGGG + Intronic
1015478274 6:133677917-133677939 TGCCTAATCCAAAATTACAAAGG + Intergenic
1018499527 6:164391070-164391092 TGGAAAAGGCAAAATTATAAGGG - Intergenic
1018712259 6:166505592-166505614 CGGCAAACACAAAATTAGAAGGG + Intronic
1021435737 7:20613124-20613146 TGTAAAACCTAAAACTATAAAGG + Intergenic
1021442754 7:20697193-20697215 TGGCTAACCCACATTTATATTGG - Intronic
1023960150 7:44919758-44919780 TGGCAAAGCCAAAATTCTCATGG + Intergenic
1028992787 7:97067408-97067430 TGGCAACTCAAGAATTATAAAGG + Intergenic
1030170928 7:106602114-106602136 TGGCAATAATAAAATTATAATGG + Intergenic
1030686156 7:112488901-112488923 TGGTAAAACCAAAATAATAATGG - Intronic
1030802181 7:113865418-113865440 TGTGATACTCAAAATTATAATGG - Intergenic
1031460031 7:122037425-122037447 AGGAATACCCAAAATTATAAAGG - Intronic
1033156729 7:138963195-138963217 TGGCAAACCCAAAACAAAGATGG + Intronic
1033358786 7:140623152-140623174 TGGCAAAACCAAAATTAGCCAGG + Intronic
1034530308 7:151692388-151692410 TGGAAAAAGCAAAATTATAGCGG + Intronic
1037064571 8:14561546-14561568 TGGCAAAACTAAAATAAAAAGGG - Intronic
1037273974 8:17157357-17157379 TGGCAATCCTCAAATCATAAAGG - Intronic
1037927515 8:22855664-22855686 TATCAAAATCAAAATTATAAAGG + Intronic
1040587901 8:48761594-48761616 TGGCAAACCCACAATTGCAGTGG - Intergenic
1042625359 8:70751091-70751113 TGGCAAGCCCAAAATCAGCAGGG - Intronic
1046262807 8:111792193-111792215 TGACAAACACAAAATTCCAAAGG + Intergenic
1046639326 8:116708961-116708983 TGGCTAAACCAAAATTGTTAAGG - Intronic
1046654782 8:116881408-116881430 TGGGAAACACAAAGTTACAAAGG + Intergenic
1047043453 8:121024806-121024828 TTGCCACCCCAAAATTAGAATGG - Intergenic
1047636566 8:126769440-126769462 TGGCAAACTCAAAAGTCTATAGG + Intergenic
1047792057 8:128213467-128213489 TACAAAACCCAAAATTTTAAAGG + Intergenic
1048170974 8:132105935-132105957 TGGCAAATGCAAAATGAGAATGG - Intronic
1051514755 9:17916397-17916419 TGCCTAACCCAAAATTACAGAGG + Intergenic
1051797026 9:20883289-20883311 AGACAAACCCACAATAATAATGG + Intronic
1054744066 9:68836510-68836532 TGGCATACCCCAAATTCCAAAGG - Intronic
1056084951 9:83138477-83138499 TTGCAAACAAAGAATTATAATGG + Intergenic
1056622748 9:88227711-88227733 TGGCAAACCCAAAATCCACAGGG - Intergenic
1057817613 9:98307184-98307206 AGAAAAACCCAAAATAATAATGG - Intronic
1059026705 9:110641792-110641814 AGGCAAAAACAAAATTAAAAAGG + Intergenic
1059079110 9:111229184-111229206 TTGAAAACTCAAAATTGTAAAGG + Intergenic
1059572817 9:115458795-115458817 TTGCAAACATGAAATTATAAAGG + Intergenic
1059852493 9:118359938-118359960 TGGAAAACTCAAAATTACATGGG + Intergenic
1059935668 9:119307838-119307860 TGGAAAACCCAAAGTTACACAGG - Intronic
1060192243 9:121600281-121600303 TGGCCAATCCTAAATTATCAGGG + Intronic
1061533319 9:131231567-131231589 TGAGAAGCCCAAAATAATAATGG + Intronic
1202794804 9_KI270719v1_random:111974-111996 TGGCAATCCTATAATTTTAAGGG - Intergenic
1203375966 Un_KI270442v1:378056-378078 TGTAAAACCCAAAACTATAAAGG + Intergenic
1189376060 X:40467106-40467128 TGGCTACCCCAAACTTAGAAGGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191608499 X:63086586-63086608 AAACAAACCCAAAATTAAAAGGG + Intergenic
1192754029 X:74026634-74026656 TAGTGAAACCAAAATTATAATGG + Intergenic
1193657497 X:84216384-84216406 TGTCAAAGCCAACATTATAGAGG + Intergenic
1193968669 X:88022522-88022544 AGACAAACAGAAAATTATAAAGG + Intergenic
1196771067 X:119293818-119293840 TGTAAAACACAAAACTATAAAGG - Intergenic
1197015106 X:121615195-121615217 TGGAAAAGACAAAATTGTAAGGG - Intergenic
1197558108 X:127982436-127982458 TGGAAAAGGCAAAACTATAAAGG - Intergenic
1197911757 X:131490837-131490859 TGGCAAACCTAAACTTGTTAAGG + Intergenic
1198798544 X:140425768-140425790 TGGCTAACCTAAAAATGTAAGGG - Intergenic
1199652241 X:149957392-149957414 TGACAAATACACAATTATAATGG - Intergenic
1201698072 Y:16849646-16849668 AGGCAGAACAAAAATTATAAAGG - Intergenic