ID: 964517417

View in Genome Browser
Species Human (GRCh38)
Location 3:157527551-157527573
Sequence TGTCCAAGCTAGAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964517417_964517421 13 Left 964517417 3:157527551-157527573 CCACCCACTTTCTAGCTTGGACA 0: 1
1: 0
2: 5
3: 11
4: 143
Right 964517421 3:157527587-157527609 AAGTCCTGCTTAATAGCATGAGG 0: 1
1: 0
2: 0
3: 2
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964517417 Original CRISPR TGTCCAAGCTAGAAAGTGGG TGG (reversed) Intronic
900493770 1:2966876-2966898 AGTCTCAGCTACAAAGTGGGTGG - Intergenic
900693972 1:3998954-3998976 TGTGCAGTTTAGAAAGTGGGGGG + Intergenic
904251978 1:29231419-29231441 TGGCCAAGCTAGGAAGTGGCAGG - Intergenic
905991758 1:42343404-42343426 AGTCCCAGCTACAAGGTGGGAGG + Intergenic
906440158 1:45835765-45835787 TGCCCTAGCTAGAATGAGGGTGG - Intronic
907319193 1:53592218-53592240 TTCCCAAGCTAGAAAGTGGGCGG + Intronic
907744901 1:57203427-57203449 TGCCCAAGACAGAAAGTAGGGGG + Intronic
910036716 1:82797792-82797814 TGTGCAAGATAGGAAGCGGGAGG - Intergenic
910363098 1:86434668-86434690 TGTACAAGCGAGAATGTGGGAGG - Exonic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
912756742 1:112330571-112330593 TCACCCAGCTAGAAAGTGGTGGG + Intergenic
914224977 1:145712743-145712765 TTTCCAAGCTAGAATGTCAGGGG - Intergenic
914504878 1:148280599-148280621 TTTCCAAGCCCGAAGGTGGGTGG - Intergenic
914972535 1:152323356-152323378 TGTACAAGCCACACAGTGGGAGG + Intronic
915153794 1:153857606-153857628 TTATCAAGTTAGAAAGTGGGAGG + Intronic
917854513 1:179089908-179089930 TTTCCAAGCTGAGAAGTGGGTGG - Intronic
920303254 1:205002497-205002519 TGTCAAAGGTAGAAAGTGTGGGG - Intronic
1066995719 10:42561131-42561153 TGTTCAAGGTAGAAACTGTGGGG + Intergenic
1067140523 10:43652654-43652676 TTTATAAGCCAGAAAGTGGGAGG + Intergenic
1067147987 10:43707343-43707365 TCTCACACCTAGAAAGTGGGAGG + Intergenic
1069514193 10:69064733-69064755 TGTCCAAGATAGAATCTAGGTGG - Intergenic
1072460647 10:95615589-95615611 TGTGTAAGCTAGGAAGTGGTGGG + Intronic
1073784722 10:106876591-106876613 TGTCAAATCTACACAGTGGGTGG + Intronic
1077919861 11:6633798-6633820 CATCCAAGGTAAAAAGTGGGGGG + Exonic
1079394516 11:20050272-20050294 GGGCCAAGCTACACAGTGGGTGG - Intronic
1080996709 11:37611848-37611870 AGTACAAACTTGAAAGTGGGAGG - Intergenic
1081490120 11:43561122-43561144 GGACCAAGCTTGAAAGTGGTGGG - Intronic
1082127270 11:48447927-48447949 TGTCCAAGCTGGAAGGTTGTGGG - Intergenic
1083329326 11:61890396-61890418 TGGCCAACCTAGAAATTTGGAGG + Intronic
1086150030 11:83599007-83599029 AATCCAAGCTAGAAATTGTGAGG - Intronic
1088331704 11:108661039-108661061 TGTTTAAGCAAAAAAGTGGGAGG + Intergenic
1089055225 11:115579863-115579885 TGTCCCAGCAAGAAAGGGAGGGG + Intergenic
1090258956 11:125305028-125305050 TCTCCGAGCTAGTAAGTGGTGGG + Intronic
1093317393 12:17667857-17667879 TGACCAAGCGAGAAAGTGGGAGG + Intergenic
1094420715 12:30268432-30268454 TGCCCAGGCTGGAGAGTGGGTGG + Intergenic
1095836572 12:46646018-46646040 CGTGCAAGCAAGAAGGTGGGGGG - Intergenic
1098590617 12:72207204-72207226 TGTGCAAAATAGAAAATGGGAGG + Intronic
1100414260 12:94355684-94355706 TGTCCAAGCTGGAAGGTTGTGGG + Intronic
1100447778 12:94677149-94677171 TGACAAAGCTAGACAGTGGCTGG - Intergenic
1100672050 12:96824154-96824176 TGTCCCAGCCAGAAAGCGGTTGG - Intronic
1100767474 12:97883552-97883574 TTTCCAGGCAAGAAAGTAGGTGG + Intergenic
1102727137 12:115075632-115075654 TGTCTAGGCTCAAAAGTGGGGGG - Intergenic
1102908320 12:116694283-116694305 TGTCCTAGTTAGTAAGTGGCAGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1107822048 13:44295068-44295090 TGTCCAAGGTAGACTGGGGGAGG - Intergenic
1114757414 14:25275570-25275592 TGGCAAAGCTGAAAAGTGGGGGG - Intergenic
1115082632 14:29475244-29475266 TTTGCAAGCTACAAAGTTGGTGG - Intergenic
1116826418 14:49677429-49677451 TCTCCAAGCAAGATAGTGGTGGG - Intronic
1120342623 14:83241633-83241655 TGTCCAGTCTATAAAGTGGTGGG - Intergenic
1123069848 14:105637397-105637419 GGTCCCAGGTAGAAAGTGGGAGG + Intergenic
1123089082 14:105734185-105734207 GGTCCCAGGTAGAAAGTGGGAGG + Intergenic
1123123187 14:105927461-105927483 TGTCCAACCAAGAGAGCGGGAGG + Intronic
1125596752 15:40892428-40892450 TGTCACAGCTAGCAAGTGGCTGG + Intergenic
1131378945 15:91948127-91948149 AGTCTGAGCCAGAAAGTGGGTGG + Intronic
1133330518 16:4970412-4970434 AGTGCAAGTTAGAAAGTGGCTGG + Intronic
1133892803 16:9896772-9896794 TGTCCTTCCTAGAAATTGGGTGG - Intronic
1137860451 16:51841531-51841553 TCTCCAAGCTACAATGTGAGGGG + Intergenic
1139415818 16:66808599-66808621 TGTCCATGCTAGAAACTGAAAGG + Exonic
1140542543 16:75770797-75770819 TTTCTGAGCTAGAGAGTGGGGGG + Intergenic
1142260225 16:89039388-89039410 TGTCCATGGTAGTACGTGGGTGG - Intergenic
1143199048 17:5099357-5099379 TCTCCAAGCTGGAATGTGGATGG + Intergenic
1143363311 17:6388704-6388726 TCCCCCAGCTAGTAAGTGGGAGG + Intergenic
1144499197 17:15770612-15770634 TGTCCAAGCGAGAACCAGGGAGG + Intergenic
1144577974 17:16441680-16441702 AGTCCCAGCTACAAGGTGGGAGG - Intronic
1145036385 17:19543607-19543629 TGTCCAAACTTAAAATTGGGAGG + Intronic
1145162585 17:20585645-20585667 TGTCCAAGCAAGAACCAGGGAGG + Intergenic
1147183518 17:38701832-38701854 GGTCAAAGCAAGAAAGTGGCAGG + Intergenic
1149538215 17:57448810-57448832 GGTCCAAGCTAGTAAGTGGCTGG - Intronic
1150391878 17:64794541-64794563 AATTCAAGATAGAAAGTGGGGGG - Intergenic
1150788950 17:68184591-68184613 AATTCAAGATAGAAAGTGGGGGG - Intergenic
1151412269 17:73938941-73938963 TGTGCAAGTTAGGAAATGGGAGG + Intergenic
1155785489 18:29894332-29894354 TGTACAAGAAAGAAATTGGGGGG + Intergenic
1163235690 19:16029198-16029220 GCTCCAAGCTACAAAGTTGGGGG + Intergenic
927257316 2:21050792-21050814 TCTCCAAAGAAGAAAGTGGGTGG + Intergenic
927343371 2:22008262-22008284 TGTCCATGCCACAAACTGGGTGG + Intergenic
928209388 2:29312380-29312402 TCTCCAGGCTAGAAAGTGGGGGG + Intronic
930224593 2:48779282-48779304 TGCTGAGGCTAGAAAGTGGGAGG - Intergenic
930937595 2:56973948-56973970 TGTCCAAGTTAGAAAGTAAAAGG + Intergenic
931756727 2:65381410-65381432 TGACCAAGCTAGAAATTGGTGGG - Intronic
932193981 2:69766834-69766856 TTTCCTAGCTATAAAGTGGAGGG + Intronic
933554174 2:83811132-83811154 TGTTCAACCTACAGAGTGGGAGG - Intergenic
936546946 2:113399911-113399933 TGTGCAAGCTTGAACGTGGGAGG - Intergenic
937951444 2:127390947-127390969 TGTCCAAGCTTGGAAGTATGAGG + Intergenic
944217456 2:197270409-197270431 TGTTCAAGCTGGAAACTGTGGGG - Intronic
945548085 2:211182976-211182998 TGTAAAAGCCAGAAAGTGGACGG - Intergenic
1168866669 20:1092553-1092575 TGTTCAAGGTAGGAAGAGGGAGG + Intergenic
1169761926 20:9104892-9104914 TGTACAAGACAGAAATTGGGAGG - Intronic
1170269522 20:14508808-14508830 TGTCAAAGGTAGAATCTGGGTGG - Intronic
1170520159 20:17177086-17177108 TGTTCCAGCTAGAAGGTGTGAGG + Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1178617419 21:34146063-34146085 TGCCCAAGCTGGAAAGTTGTGGG - Intergenic
1181995054 22:26870876-26870898 TGTCAAAGCTAGAAGCTAGGTGG - Intergenic
1184374302 22:44102077-44102099 TCTGCAAGCTAGAAAGCTGGAGG + Intronic
953334306 3:42080763-42080785 TCTTCAAGCTAGAAAGTGGGTGG + Intronic
955205472 3:56892029-56892051 TGTCCAACCAAACAAGTGGGAGG + Intronic
961747361 3:129073089-129073111 ATTCCAAGACAGAAAGTGGGTGG + Intergenic
961811413 3:129523882-129523904 TGGCCAAGCTGGCATGTGGGGGG - Intergenic
962680236 3:137791852-137791874 TGTCAAAGCAAGAAAGTTGCTGG + Intergenic
963303987 3:143629703-143629725 TGTCCAGGAAAGAAAGAGGGTGG + Intronic
963958405 3:151280904-151280926 TGTCTAAGCTAGAAAGTAGCAGG + Intronic
964077572 3:152710273-152710295 TGTCCAAGCTAAAACCTAGGAGG + Intergenic
964517417 3:157527551-157527573 TGTCCAAGCTAGAAAGTGGGTGG - Intronic
965008476 3:163056341-163056363 TTACCCATCTAGAAAGTGGGGGG + Intergenic
965273186 3:166645846-166645868 TTTCCAAGCAAGAAAATAGGTGG + Intergenic
966592831 3:181700562-181700584 TGGCGAAGCTGGAAGGTGGGAGG + Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
968067555 3:195767173-195767195 TCACCAAGCTAGTAAGTGGGGGG - Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972733257 4:41815519-41815541 TGCTCAAGCTTGAAAGTGTGGGG - Intergenic
975062940 4:70025841-70025863 TCTCCAAGTTAGGAAGTGTGGGG - Intergenic
975100021 4:70502119-70502141 TGTCCAAGATATTAAGTGGAGGG + Intergenic
975605446 4:76149676-76149698 TGCCCAAGCCAGAAAGCAGGAGG - Intergenic
975798663 4:78035713-78035735 TTTCCAAGATAGAAAGTGATCGG - Intergenic
977416292 4:96736400-96736422 TCTCCAGGCTATGAAGTGGGGGG - Intergenic
986148412 5:5103039-5103061 TGACCACCCTAGCAAGTGGGTGG + Intergenic
991132813 5:63144653-63144675 TGGACAAGCTTGAAAGTGAGGGG - Intergenic
993425525 5:87759608-87759630 TCTCCTAGCTAGAAAGTAGTTGG + Intergenic
993506631 5:88716566-88716588 TGTCCAAACTGGAAATTGAGAGG - Intergenic
998714232 5:144864176-144864198 TCTGCAAGCTGTAAAGTGGGAGG - Intergenic
1003833176 6:10037512-10037534 TCTCCAAGAAATAAAGTGGGGGG - Intronic
1006027495 6:31156901-31156923 GGGCCGAGCTTGAAAGTGGGAGG + Exonic
1009819331 6:68779591-68779613 TCTGAAAGCTAGAAAGTCGGAGG - Intronic
1010738044 6:79465186-79465208 TTTGCAATCTAGAAAGAGGGAGG + Intergenic
1011194747 6:84769239-84769261 TCTCCAAGCTGGAAAACGGGGGG - Intergenic
1014015235 6:116521990-116522012 GGCCCAAGCTAGCCAGTGGGAGG + Exonic
1014529738 6:122544596-122544618 TGTGCATGCTAGAACTTGGGTGG + Intronic
1014719641 6:124900539-124900561 TGTCCAAGCTGGAAGGTTGTGGG - Intergenic
1018827125 6:167416753-167416775 CATCCATGCTAGAAAGTAGGGGG - Intergenic
1018910186 6:168097283-168097305 TGTCCACGGTAGGAAGTGCGAGG + Intergenic
1027126419 7:75559724-75559746 TGTCTGAGATAGAAAGTGAGCGG - Exonic
1028118374 7:87027873-87027895 TCCCCAAACTAGAAAGAGGGGGG + Intronic
1028390139 7:90306419-90306441 TGCCTTAGCTAGAAAGTGAGGGG + Intronic
1033209689 7:139451713-139451735 TTACCCAGCTAGAAAGTGGAAGG - Intergenic
1033779773 7:144654664-144654686 TGCACAAGCTAGAAAGTGGGGGG - Intronic
1033979377 7:147145326-147145348 TGTCACAGCTGGAGAGTGGGGGG + Intronic
1037278823 8:17212433-17212455 TGTTCATGCTAGAAACTGTGGGG + Intronic
1045273392 8:100680639-100680661 TGTGTAAGCTAGAAAGCTGGAGG - Intergenic
1048225151 8:132577965-132577987 TTTCCAAACTAGAAAGTGCCTGG - Intronic
1048303754 8:133269206-133269228 TGTCCCAGCCAGAAGTTGGGGGG - Intronic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1050260262 9:3834256-3834278 TTTCCAAACTAGAAAGGGAGTGG + Intronic
1052044604 9:23779443-23779465 TATGAAAGCTAGAGAGTGGGTGG + Intronic
1055910521 9:81345337-81345359 AGTCAAAGCTGGAAAGTGGTTGG - Intergenic
1058049131 9:100388949-100388971 TATCCAACCCAGGAAGTGGGTGG + Intergenic
1059345004 9:113622008-113622030 TGTTCAAACTTGAAACTGGGTGG - Intergenic
1061796998 9:133091388-133091410 TGTACAATATGGAAAGTGGGGGG - Intergenic
1062292744 9:135804538-135804560 GGACCCAGCTGGAAAGTGGGTGG - Intergenic
1186495922 X:10013238-10013260 TGTCCAAGGGAAAGAGTGGGAGG - Intergenic
1186703910 X:12122102-12122124 TCTCACAGCTAGAAAGTGGCAGG + Intergenic
1189246691 X:39568745-39568767 TCTCCAAGCTAGAAAGGGCAAGG - Intergenic
1189293129 X:39900010-39900032 TATCCAAGCAATAAAGTGGAAGG + Intergenic
1191833365 X:65438819-65438841 TGTCCAAGCTGGAAGGTTGTGGG - Intronic
1191927165 X:66326037-66326059 TCACAAAGCTAGAAAGTGGTAGG - Intergenic
1192470378 X:71393501-71393523 AATCCAAGCTGGAAAGGGGGAGG + Intronic
1192603099 X:72485701-72485723 TGAGCAAACTAGAAATTGGGTGG + Intronic
1196117224 X:112010986-112011008 TGTCCAGGCTGGAAACTGTGTGG + Intronic
1196626843 X:117886505-117886527 TGTCCAAGGTAGAATGTGTGTGG - Intergenic
1197821129 X:130541995-130542017 TGTTGAAACTAGACAGTGGGTGG + Intergenic
1198179510 X:134192411-134192433 CGGCCAAGCTAGAAATCGGGGGG - Intergenic
1200908127 Y:8506754-8506776 TCTTCAAGGTACAAAGTGGGAGG - Intergenic