ID: 964520830

View in Genome Browser
Species Human (GRCh38)
Location 3:157564453-157564475
Sequence CAAAATGCTGATAGTGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 4, 1: 46, 2: 86, 3: 86, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964520830_964520833 4 Left 964520830 3:157564453-157564475 CCCGTATCACTATCAGCATTTTG 0: 4
1: 46
2: 86
3: 86
4: 237
Right 964520833 3:157564480-157564502 AAACCATTCAACACGTCTCTAGG 0: 3
1: 367
2: 2053
3: 1996
4: 1368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964520830 Original CRISPR CAAAATGCTGATAGTGATAC GGG (reversed) Intronic
903748861 1:25606653-25606675 GAAAATGAGGATAATGATACTGG - Intergenic
905379538 1:37551359-37551381 TGAAATGCTGATAAAGATACAGG + Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909020135 1:70421952-70421974 CAAAATGGAGATAATTATACCGG + Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911820363 1:102411625-102411647 CAAAATGCTGAGTGTCACACTGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912668463 1:111604287-111604309 CTAAATGCTGTCAGTGACACAGG + Intronic
912990040 1:114476856-114476878 CAAAATCCAGATAGTTATACAGG + Intronic
913423357 1:118698189-118698211 CAAAGTACTACTAGTGATACTGG + Intergenic
913973503 1:143435166-143435188 TAAAATAGGGATAGTGATACTGG + Intergenic
914067891 1:144260773-144260795 TAAAATAAGGATAGTGATACTGG + Intergenic
914111264 1:144705581-144705603 TAAAATAAGGATAGTGATACTGG - Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
915555905 1:156660700-156660722 GCAAAGGCTGATAGTAATACGGG + Intergenic
915911427 1:159918030-159918052 CAAAGTGCAGTGAGTGATACAGG - Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917984489 1:180301647-180301669 CAAAATGCCACTAGTGATGCTGG - Intronic
918434919 1:184501241-184501263 GAAAAGGCTGATAGGGCTACAGG - Intronic
918547343 1:185700129-185700151 CAAAATGCAGATTCTGATTCAGG + Intergenic
918766282 1:188488378-188488400 CAAAGTGCCACTAGTGATACTGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921042418 1:211446730-211446752 GAAAATACTGGTAGTGATACTGG - Intergenic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924185743 1:241488023-241488045 CACAAGACTGTTAGTGATACAGG + Intergenic
1063110239 10:3029294-3029316 CAAAATGTTGAAAATGTTACTGG + Intergenic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068298289 10:55104774-55104796 CAAAGTGCTACTAGTGATGCCGG - Intronic
1068530166 10:58176642-58176664 CATAATTCTGATAGTGTTCCTGG - Intergenic
1069923758 10:71833864-71833886 CAAACTGCTGATTGAGATCCTGG - Intronic
1071174087 10:82903431-82903453 CAAAGTTCTGCTAGTGATGCTGG + Intronic
1071512079 10:86268336-86268358 CCAAATGCTGTTGGTGATACCGG - Intronic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072488650 10:95881110-95881132 CTGATAGCTGATAGTGATACAGG - Intronic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074075865 10:110123959-110123981 CCAAATGCTGTTATTGATACAGG + Intronic
1077379148 11:2220400-2220422 TAAAATGCTGATAGACATGCAGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078836509 11:15035338-15035360 CAAACTGCTGCTACTGATTCGGG - Intronic
1079279396 11:19073780-19073802 TAAAAAGGTGATAGTGATACAGG + Intergenic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079830372 11:25259030-25259052 TAAAACTCTGATGGTGATACAGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079872817 11:25821779-25821801 CAAAATGCCAATAGTGATGCAGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083010521 11:59393531-59393553 CAAAGTGCTACTAGTGATGCTGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087029525 11:93688963-93688985 CAAAAAGCTTATAGTCATTCTGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090685477 11:129113107-129113129 CAAAATGCTACTAGTGATGCTGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094546487 12:31409096-31409118 CCAAATGCTAAGAGTGCTACAGG - Intronic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1095269582 12:40201784-40201806 CAAAATTCTGATAATTATTCTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095374395 12:41508688-41508710 CAAAATGGTAAAAGTAATACAGG - Intronic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098266710 12:68728986-68729008 CAAAGTGCCAGTAGTGATACTGG - Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1108085300 13:46783184-46783206 AAAAGTGCTGATAGTGAGAGAGG - Intronic
1108763229 13:53595451-53595473 GAAATTGCTCAAAGTGATACAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110563291 13:76932249-76932271 CAAAATGCCATTAGTGATGCTGG - Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111459346 13:88519394-88519416 CAAGTTGCTGATAATGACACGGG + Intergenic
1111789472 13:92835833-92835855 CATATTGCTGATGGGGATACAGG - Intronic
1111921111 13:94412092-94412114 GAAAATCCTGTTAGTGACACAGG + Intergenic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113791993 13:113033856-113033878 CAAAATGCTGATGTGGAGACGGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1119691966 14:76680234-76680256 TAAAATGGTGAAAGTGTTACAGG - Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120663055 14:87273615-87273637 CAAAAAGCACATAGTCATACTGG + Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1122020103 14:98830710-98830732 CAATATTCTGATAGAGACACAGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1125295508 15:38198618-38198640 AAAAATGCTGATACTGTGACTGG - Intergenic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1129316888 15:74750542-74750564 CAAAGTCCTGATAGTGCTCCTGG - Exonic
1130350686 15:83089055-83089077 CAAAATCCTGGTAGTGAAGCGGG + Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1133392878 16:5423247-5423269 CACTTTCCTGATAGTGATACTGG - Intergenic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1135132883 16:19867431-19867453 TAAAATGCTCAGAATGATACCGG + Intronic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1135979687 16:27138306-27138328 AATCATGGTGATAGTGATACTGG + Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137767367 16:50988257-50988279 CAAAATGGTGATCAAGATACAGG - Intergenic
1137805619 16:51302660-51302682 GAAAATGGTGTCAGTGATACAGG + Intergenic
1138637315 16:58351476-58351498 CAACTTGGTGACAGTGATACAGG - Intronic
1138876975 16:60963991-60964013 TAGAATGCTGTTAGTGCTACTGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1142976027 17:3645016-3645038 CAGGATGCTGAAAGTGATGCTGG - Intronic
1143862946 17:9904635-9904657 CGAGATGCTGATATTGATAGAGG - Intronic
1146640906 17:34540684-34540706 CAAAATGGTGATAGGGAAGCTGG - Intergenic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1148842069 17:50505456-50505478 CATGATGCAGATGGTGATACTGG + Intergenic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1154127136 18:11701583-11701605 CATAATGCTGTTATTGATCCTGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156975866 18:43220957-43220979 CAGAAAGCTGATAGAAATACAGG - Intergenic
1157376026 18:47166170-47166192 CAATATTTTGACAGTGATACAGG - Intronic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1158911244 18:62065049-62065071 CCAAAGGCTGATACTGATGCAGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166018173 19:39999537-39999559 CAAAGTGTTAATAGTGATGCTGG - Intronic
1166452770 19:42916016-42916038 CATAATGCAGAGAGTGACACAGG + Intronic
1166491928 19:43267675-43267697 CATAATGCAGAGAGTGACACAGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931225890 2:60331466-60331488 CGAAGTGCTGCTAGTGATGCTGG + Intergenic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
933026219 2:77262851-77262873 CTAAATGATGAGAGTGATAAAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933067839 2:77820089-77820111 AAAAATACTTATTGTGATACAGG - Intergenic
933238498 2:79892774-79892796 CAATATTATGAAAGTGATACTGG - Intronic
933360230 2:81272283-81272305 CAAAAGGGTGACAGTAATACAGG + Intergenic
934178200 2:89596132-89596154 TAAAATAGGGATAGTGATACTGG + Intergenic
934288497 2:91670424-91670446 TAAAATAGGGATAGTGATACTGG + Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935723621 2:106001862-106001884 CAAAATTCTGTTGGTTATACAGG + Intergenic
935913764 2:107926425-107926447 CAAAATGCTGAAAGTGGCGCTGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937015416 2:118601052-118601074 CACACTGCTGATAGCAATACTGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
939052473 2:137324548-137324570 CAAAATGCTTATAGTTAAAGGGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940532074 2:154890465-154890487 GAAAATGCAGATATTGACACAGG + Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG + Intronic
941357254 2:164509723-164509745 TAAAATGCAGATACTGATTCAGG - Intronic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942011192 2:171763920-171763942 CAAAATGCCAGTAGTGATTCTGG + Intergenic
942265122 2:174216348-174216370 CAAAGTGCTATTAGTGATGCTGG + Intronic
942649580 2:178152842-178152864 TAAAAGGCTAATAGTGTTACCGG + Intergenic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943296644 2:186148667-186148689 CAAAACACTGATAGTAATCCAGG - Intergenic
943322458 2:186462386-186462408 CAAAATGCTGGTGGTAGTACAGG + Intergenic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946135811 2:217646040-217646062 CAAAATGCAGGAAGTGATTCAGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169470212 20:5878551-5878573 CAAAATGTTGAAAGGGCTACAGG - Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1179075076 21:38113415-38113437 CAAAATGCTGCTGGTGTGACTGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1183118229 22:35708485-35708507 CAAATTGCTGATTGTGTTTCAGG - Intergenic
949394381 3:3599231-3599253 CAAAAGGCCACTAGTGATACTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951394526 3:22149129-22149151 TAAAATGCAGATTCTGATACAGG - Intronic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
953158766 3:40398958-40398980 CAAAATGCTGCTGGTATTACAGG - Intronic
954955162 3:54512435-54512457 AAGAATGATGATAGTGACACCGG + Intronic
955559848 3:60177026-60177048 AAAAATGCTCATAGGGAGACTGG + Intronic
956321629 3:68004003-68004025 CAAAATACTGATAGTATTAGTGG - Intergenic
956574641 3:70738671-70738693 TGAAATTCTGATAGTGCTACAGG + Intergenic
956612338 3:71136936-71136958 CCTTATGCTGATAGTGGTACAGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958650900 3:96935062-96935084 CTAAATGCTCTTAGTGTTACTGG - Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959526566 3:107383949-107383971 ATAAATGGTGATAATGATACTGG + Intergenic
959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG + Intergenic
960396601 3:117145200-117145222 CACAAAGCTGCTGGTGATACTGG - Intergenic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962783838 3:138747255-138747277 CAAAATGCTACTTGTGATCCTGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963841571 3:150112993-150113015 CAAAGTGCCACTAGTGATACTGG + Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964597325 3:158449582-158449604 CAATATGCTGTGAGTAATACTGG + Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966921008 3:184611328-184611350 GAAGATGCCGGTAGTGATACTGG - Intronic
967064602 3:185903664-185903686 CAAAGTGCTGGTATTGTTACAGG - Intergenic
967243672 3:187465862-187465884 TAAAATGGTGATATTGAAACTGG - Intergenic
969142752 4:5093866-5093888 CAAAGTGCTAAGAGTGATGCTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
969831050 4:9797264-9797286 TAAAATAAGGATAGTGATACTGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974625859 4:64428543-64428565 CAAAATGCTAATCATAATACAGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983013244 4:162576610-162576632 AAAAATGTTGATAGTGGTAGAGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991453915 5:66782025-66782047 CAAAGTGCTGGGAGTGTTACAGG - Intronic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993271234 5:85799211-85799233 CAAAATGTTGAGGTTGATACTGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993885372 5:93409607-93409629 CAAACTCCTGGTCGTGATACTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996191086 5:120542411-120542433 GAAAATGTTAATAGTGATAGAGG - Intronic
997106503 5:131025927-131025949 CAAAGTGCTACTAGTGATGCTGG + Intergenic
997913505 5:137900402-137900424 CAAAGTGCCACTAGTGATACTGG + Intronic
997944448 5:138187122-138187144 CAACATGGTGCTAGTGAAACTGG + Exonic
998836107 5:146203954-146203976 CACAATGGTGATAGTACTACAGG - Intronic
998997913 5:147886261-147886283 CAGTATGCTGACATTGATACAGG - Intronic
999324084 5:150632275-150632297 CAAAATGCAGATTGTAATTCAGG - Intronic
1000033528 5:157424067-157424089 CAAAATGCCACTAGTGATGCTGG + Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002017469 5:176336334-176336356 CAAAAAGCTGATAGTTGAACAGG - Intronic
1002060522 5:176623124-176623146 CAAAATGCTGGGAGTGGTAACGG - Intronic
1002219484 5:177668666-177668688 CAAAGTGCTACTAGTGATGCTGG + Intergenic
1003331442 6:5132539-5132561 CAAAAGGCTGAGAGTGAAAGTGG + Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1004809427 6:19243347-19243369 CAAAATGGTGCTAGTGAAACTGG + Intergenic
1005074521 6:21893800-21893822 TGAAGTGCTGAGAGTGATACTGG - Intergenic
1005199540 6:23327573-23327595 CAAGATGGTGATAGTGATGGTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009627055 6:66147295-66147317 CAAAATGGAGATAGTCATGCGGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010420548 6:75669787-75669809 TAAAATGCTGCTAGTTATAGTGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011489765 6:87878985-87879007 CAAAATTTTGATAGTGATGGTGG - Intergenic
1011789027 6:90878234-90878256 TTAGATGCTGATAGTGATACTGG - Intergenic
1011895451 6:92218830-92218852 TAAAATGTAGCTAGTGATACAGG - Intergenic
1011907730 6:92392732-92392754 AAAAATGGTGACAGTGAAACAGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013857883 6:114596444-114596466 CAAAATGCAAATAGTGGTGCAGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015689894 6:135910323-135910345 TAAAGTGCTGACTGTGATACTGG - Intronic
1015695028 6:135970504-135970526 TAAAATGCTGATTTTGATTCAGG + Intronic
1017482684 6:154873071-154873093 CAAAATGCAGAAAGGGGTACTGG - Intronic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020518001 7:9149433-9149455 AAAAACTCTGATAGTAATACTGG - Intergenic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022562134 7:31360616-31360638 CACAATGCTTAATGTGATACTGG - Intergenic
1023514610 7:40988555-40988577 TAAAATGTGGATACTGATACTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1026095471 7:67343092-67343114 CACAAAACTGATATTGATACTGG - Intergenic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1030827699 7:114181033-114181055 AAAAATGATGATAGAGAGACAGG - Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032905077 7:136355386-136355408 CAAAAAGCTGTTGGTAATACTGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038469504 8:27801995-27802017 CTAAATGCTGAATGTGATACTGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1043051528 8:75391952-75391974 CTTAATGCTCATAGTTATACAGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044105969 8:88207523-88207545 CAAAGTGCTGCTAGTGATGCTGG + Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045054213 8:98355420-98355442 TAAATTTCTGAGAGTGATACTGG + Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1046326034 8:112647921-112647943 CCATATGCTGATACTGCTACAGG - Intronic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056076602 9:83047964-83047986 CCAAATGTTGACAGTGATGCTGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058271459 9:102976696-102976718 CATAATGCTGGTAGAAATACAGG - Intergenic
1058433097 9:104936567-104936589 CAAAATGCTGAAAGAGAAAGAGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059109015 9:111537054-111537076 CAAAGTGCTGCTAGTAATGCTGG - Intronic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059847810 9:118300970-118300992 CCAAATTCTGATACTGATACTGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186205563 X:7196741-7196763 CAAAATACAGATAGAGAGACAGG - Intergenic
1187281682 X:17861697-17861719 GAAAATGCCAATTGTGATACCGG + Intergenic
1187753272 X:22491126-22491148 AAACATGCTGACAGTGATCCTGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188740750 X:33777431-33777453 CAAAATACTGAATGTGACACAGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189454202 X:41169763-41169785 CAAGATACTGAAAGTAATACAGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193565805 X:83075696-83075718 TAGAATGCTGTTTGTGATACAGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194190546 X:90831055-90831077 TAAAATGTAGATGGTGATACTGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1197623697 X:128780369-128780391 CAAAATGGTGAAAGGGAGACAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1200052231 X:153440360-153440382 CACAATGCTGATACTGTTCCTGG + Intergenic
1200537206 Y:4413479-4413501 TAAAATGTAGATGGTGATACTGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201643935 Y:16206462-16206484 CAAAATGCTGGTGGTGTTACTGG - Intergenic
1201658880 Y:16378859-16378881 CAAAATGCTGGTGGTGTTACTGG + Intergenic