ID: 964521101

View in Genome Browser
Species Human (GRCh38)
Location 3:157568419-157568441
Sequence AATAACTAAAAGAGTATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4231
Summary {0: 12, 1: 486, 2: 1010, 3: 1275, 4: 1448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964521101_964521102 5 Left 964521101 3:157568419-157568441 CCACTTATACTCTTTTAGTTATT 0: 12
1: 486
2: 1010
3: 1275
4: 1448
Right 964521102 3:157568447-157568469 ATGTACAATTAAATTATTGTTGG 0: 2
1: 23
2: 56
3: 94
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964521101 Original CRISPR AATAACTAAAAGAGTATAAG TGG (reversed) Intronic
Too many off-targets to display for this crispr