ID: 964522395

View in Genome Browser
Species Human (GRCh38)
Location 3:157583191-157583213
Sequence AAGGGCCTGTTAAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 8, 1: 9, 2: 41, 3: 41, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964522395_964522402 5 Left 964522395 3:157583191-157583213 CCCCCAGAGTTTAACAGGCCCTT 0: 8
1: 9
2: 41
3: 41
4: 101
Right 964522402 3:157583219-157583241 TATATAATGCTCCATGCACTTGG 0: 11
1: 8
2: 11
3: 17
4: 128
964522395_964522404 9 Left 964522395 3:157583191-157583213 CCCCCAGAGTTTAACAGGCCCTT 0: 8
1: 9
2: 41
3: 41
4: 101
Right 964522404 3:157583223-157583245 TAATGCTCCATGCACTTGGAGGG 0: 11
1: 17
2: 29
3: 36
4: 107
964522395_964522406 18 Left 964522395 3:157583191-157583213 CCCCCAGAGTTTAACAGGCCCTT 0: 8
1: 9
2: 41
3: 41
4: 101
Right 964522406 3:157583232-157583254 ATGCACTTGGAGGGTTAGAAAGG 0: 7
1: 12
2: 30
3: 23
4: 150
964522395_964522403 8 Left 964522395 3:157583191-157583213 CCCCCAGAGTTTAACAGGCCCTT 0: 8
1: 9
2: 41
3: 41
4: 101
Right 964522403 3:157583222-157583244 ATAATGCTCCATGCACTTGGAGG 0: 11
1: 19
2: 26
3: 38
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964522395 Original CRISPR AAGGGCCTGTTAAACTCTGG GGG (reversed) Intronic
900730421 1:4255340-4255362 AAAGCCCTGCCAAACTCTGGAGG + Intergenic
903767490 1:25744076-25744098 AAGGGCCTGGAAGAATCTGGGGG - Intronic
904218814 1:28947448-28947470 AACGGCCTTTTAATCTCTTGAGG + Intronic
905784289 1:40740859-40740881 AGTGGCCAGATAAACTCTGGAGG + Intronic
909851887 1:80476990-80477012 CAGGGCTTGTAAAACTCTGTTGG - Intergenic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
912208612 1:107534714-107534736 CAGGGCCTGGTCAACTCAGGAGG - Intergenic
915516578 1:156416300-156416322 AGGGGCCTGTGTGACTCTGGTGG + Intronic
916292619 1:163183240-163183262 AAGTGGCTGTTAAATTTTGGGGG - Intronic
917575829 1:176320975-176320997 AAGGGGCTGTTAACATCAGGGGG - Intergenic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
919584979 1:199426073-199426095 AAGGGAATGTTATACACTGGTGG + Intergenic
921721415 1:218475954-218475976 AAGGGCTTGTTGATTTCTGGAGG + Intergenic
922291368 1:224211504-224211526 AAGGGCATTTTGAAGTCTGGAGG - Intergenic
924717566 1:246591843-246591865 GAAGGCCTGTTCATCTCTGGAGG - Exonic
1063430722 10:5985804-5985826 AAGGGCCAGTTAGAGTCTGTAGG + Intergenic
1063952329 10:11234836-11234858 AAGTGCCTTTTTAACTCTGCAGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065235234 10:23643856-23643878 AAGGAACTGTTAAACACTGAAGG + Intergenic
1065945017 10:30598266-30598288 AAGGGCCTATTAAACACAGCCGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1071276395 10:84059529-84059551 AATGGCCTGTTATACTCTCATGG - Intergenic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078973013 11:16436967-16436989 AAGGGCCTGGCCAACTGTGGTGG + Intronic
1082682217 11:56188852-56188874 AAGGGCATGTCAAATTCTAGTGG - Intergenic
1083298321 11:61727115-61727137 AAGGTCCTGTTAGACACTGATGG + Intronic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084658915 11:70535861-70535883 CAGGGCCTGGTAAGCTGTGGGGG + Intronic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1087561966 11:99802341-99802363 AACTGCCTGATTAACTCTGGAGG + Intronic
1091550672 12:1532612-1532634 AAGGGCGTGTGACACTCTGTGGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093178693 12:15943521-15943543 AAGGACCTTTTAAACCCTGTTGG + Intronic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1096788588 12:54031648-54031670 AAGGGCCCGGAAAACTCTGGCGG - Intronic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1107174092 13:37379678-37379700 AGGGGTGTGTTAAACTTTGGAGG + Intergenic
1107178938 13:37433777-37433799 AAGGGCCTGATCAACTTTTGGGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109779966 13:67096739-67096761 AAAAGTCTGTAAAACTCTGGTGG + Intronic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1112015388 13:95327202-95327224 AAGGGCCTGTGAAAATATGTGGG - Intergenic
1112664621 13:101555437-101555459 AAGGTCCTGATACACACTGGTGG - Intronic
1113027985 13:105962141-105962163 AGGGGCCTGTGCAACTCTTGGGG + Intergenic
1113882393 13:113635067-113635089 CAAGGCCTGTAAAACTGTGGTGG + Intronic
1116652004 14:47605093-47605115 CAGGGCATTTTAAACTATGGGGG - Intronic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1123386378 15:19811659-19811681 AAAGGAATGTTCAACTCTGGGGG + Intergenic
1125481084 15:40081319-40081341 AATGACCTGTGAAACTGTGGAGG - Intergenic
1127096303 15:55515089-55515111 AAGGGCCGGTTAAACTCTGGGGG - Intergenic
1127301998 15:57663671-57663693 CAGAGCCAGTTAGACTCTGGTGG + Intronic
1134205039 16:12230536-12230558 AAGGGCCTGTTCAACATTAGGGG + Intronic
1135924490 16:26680662-26680684 CAGGGCCTGATAAACTCTTCTGG + Intergenic
1137564607 16:49525205-49525227 AAGGGCCTGTTAATCCCTCAGGG + Intronic
1141717271 16:85734226-85734248 CAGGGCCTGGAACACTCTGGCGG - Intronic
1144659764 17:17060402-17060424 AATGGCCTGCTAAACTGGGGAGG + Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1148465808 17:47864715-47864737 GAGGGCCTGTTAGAGGCTGGGGG - Intergenic
1158277344 18:55782306-55782328 AATGGCCTCTTTAACACTGGGGG + Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG + Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1168021660 19:53613237-53613259 AAGCGCCTGTCAAACTCTTGTGG + Intergenic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
931193012 2:60023834-60023856 AAGGGCAAGCTATACTCTGGGGG - Intergenic
931356286 2:61539533-61539555 AAGGGCCTAGTAAATTTTGGTGG - Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
939115947 2:138060619-138060641 AAGGAACTGTTAAAATCAGGTGG - Intergenic
940200475 2:151144482-151144504 AAGGGCATTTTAAAAACTGGCGG - Intergenic
940345437 2:152623524-152623546 AATGGCCTTTGTAACTCTGGAGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1169757482 20:9058839-9058861 AAAGGAGTGTGAAACTCTGGAGG - Intergenic
1171336176 20:24387851-24387873 AAGGGGCTGTGAAACTGTGAAGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173296832 20:41767096-41767118 CAGGGCCTGTTCAAGGCTGGTGG + Intergenic
1178447716 21:32660793-32660815 AAGGGCCTGTTAAACTCTAGGGG + Intronic
1181115772 22:20631884-20631906 AAGGGCACGTTAGACTCAGGAGG + Intergenic
1182054824 22:27343598-27343620 AAAGACATGTTAAACTCTGCAGG - Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949274199 3:2258876-2258898 AAGTGCCTGAGAAACACTGGTGG - Intronic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
951166009 3:19485884-19485906 AAGGGCCTGTTAAACCCTGGGGG - Intronic
951492211 3:23283876-23283898 CAGGGCCTTTTAAACACTGTTGG - Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
959357627 3:105353129-105353151 AAAGGCCTGTTCAAGTCTGAGGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
963041616 3:141074539-141074561 AATGGCCTGTGAACCTCAGGTGG - Intronic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
966031239 3:175350449-175350471 ATGGGCCTCTGAAACTCTGATGG + Intronic
966759823 3:183407973-183407995 AAGGGCCTGTGAAACCCTGAGGG + Intronic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
972077472 4:35105252-35105274 AAAGCCCTGTTAAATTCTGGGGG + Intergenic
974103239 4:57440307-57440329 AAGGGCCTGTTCAAATCTATTGG - Intergenic
977564428 4:98567040-98567062 ATTGGCCAGTTAAACCCTGGGGG - Intronic
978178990 4:105770525-105770547 CAGGGCCTGTTAGAGTTTGGGGG - Intronic
979426051 4:120568680-120568702 AAAGGGCTGTTGATCTCTGGTGG - Intergenic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
988316340 5:29634689-29634711 AGGAGACTGTAAAACTCTGGTGG + Intergenic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
994379833 5:99057818-99057840 TAGGGCCAGCTAAACGCTGGAGG + Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
1002110661 5:176908555-176908577 AAGAGCATGTTCAACTGTGGAGG - Exonic
1002408132 5:179052420-179052442 AAAGCCCTGTTAAATTCCGGGGG - Intergenic
1007285193 6:40742591-40742613 AAGAGCCTGGAAGACTCTGGGGG - Intergenic
1010840998 6:80649072-80649094 AAGGGCCTGAGAAACTCCTGAGG + Intergenic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1013111159 6:107066394-107066416 AAGGGACTGTAAGATTCTGGGGG + Exonic
1018051741 6:160015395-160015417 CAGGGCCTTTTTTACTCTGGGGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG + Exonic
1022718937 7:32925309-32925331 AAGGGGCAGTTAAAATCAGGAGG + Intergenic
1023166359 7:37347383-37347405 AAGGGACTGTTGACCTCTAGAGG - Intronic
1025713958 7:63937207-63937229 AAGGGCATGTTATACTCTGTTGG + Intergenic
1028046232 7:86122938-86122960 ACTGGCCTGTTAAACTCTATGGG - Intergenic
1028803914 7:95002152-95002174 AATGGCCTCTTAATCACTGGGGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030927585 7:115477340-115477362 AGGGGCCTGAAAGACTCTGGGGG + Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1036082478 8:5572780-5572802 AAAGGGCTTTAAAACTCTGGGGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041030934 8:53734581-53734603 AAAGGCTTGTTAAACTCCAGAGG + Intronic
1041347875 8:56920365-56920387 AAGGGGCAGTTAAACACTGAGGG + Intergenic
1042092663 8:65175904-65175926 AAGGGACTTTTAAACTCTCAAGG - Intergenic
1042281819 8:67064168-67064190 CAGGGGCTATTAAACTGTGGGGG - Intronic
1042323455 8:67503384-67503406 GAGGACCTGTTGAACTCAGGAGG - Intronic
1042486273 8:69349605-69349627 AAGGGCCAGATAGGCTCTGGTGG - Intergenic
1043843518 8:85137283-85137305 AAAGGCCTCTTAAACACTTGTGG - Intronic
1044384798 8:91575049-91575071 AATGGCCAGTTTAACTCTGAAGG + Intergenic
1048182951 8:132213231-132213253 AAGGGACAGTTAAGCTCTGGTGG - Intronic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1049662377 8:143825294-143825316 AAGGACCTGGGACACTCTGGTGG - Intronic
1056785497 9:89589944-89589966 AAAGGCCTTTTCAACTCAGGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060101664 9:120846023-120846045 CAGGGCCTGCTACACTCTGAGGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185751699 X:2615528-2615550 CAGGGCCTCTCAAATTCTGGAGG + Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1187357117 X:18586386-18586408 AAGGGCTTGTTATAATATGGTGG + Intronic
1187827791 X:23349936-23349958 AAGGAGCTGTTAAAGTCTGCAGG + Intronic
1190425839 X:50333937-50333959 AAGGGTCTGCTAAACTCTGGGGG - Intronic
1190898245 X:54641853-54641875 AAGTGCCTGTTAAAATCCTGGGG + Intergenic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1191564284 X:62504272-62504294 AAAGGAATGTTCAACTCTGGGGG + Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1195465209 X:105172212-105172234 AGGGGCCTGATAACCTGTGGAGG + Intronic
1197536368 X:127692960-127692982 AAGGACCTGTTCAAGTCTGTTGG + Intergenic
1198970072 X:142269951-142269973 AAAGCCCTGTTAAATTCCGGGGG + Intergenic
1200394075 X:155972905-155972927 AAGGGCCTGTTAAACTCTAGGGG - Intergenic
1200912156 Y:8540210-8540232 AAGCACCAGTTAAACTCTGGAGG + Intergenic
1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG + Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1200983604 Y:9284445-9284467 AAAGGGCTGTTAGTCTCTGGAGG - Intergenic
1201270353 Y:12248009-12248031 AAAGCCCTGTTAAATTCTGGAGG + Intergenic
1201377169 Y:13335177-13335199 CAGGGCCTGTCAAAGGCTGGGGG + Intronic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1201680512 Y:16640056-16640078 AAAGCCCTGTTAAATTCTGGAGG - Intergenic
1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG + Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic