ID: 964522773

View in Genome Browser
Species Human (GRCh38)
Location 3:157585594-157585616
Sequence CCCTTTCCCTCTCCTTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 4, 2: 7, 3: 48, 4: 476}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964522773 Original CRISPR CCCTTTCCCTCTCCTTCTGG GGG Intronic
900567151 1:3339147-3339169 CTCCTGCTCTCTCCTTCTGGAGG + Intronic
901110791 1:6792565-6792587 CCCTTTTGCTCTTTTTCTGGAGG + Intronic
901120083 1:6884154-6884176 CCATTTCTCACTCCTTCTGAGGG + Intronic
901780408 1:11590543-11590565 CCCCTCCCCTCTCCTTCTCCTGG + Intergenic
902721659 1:18308232-18308254 GCCTCTCCCTCTGCTTCTAGGGG + Intronic
902890280 1:19438350-19438372 TCCTTTCCCTGACTTTCTGGAGG - Intronic
903116510 1:21182890-21182912 CCCTTTCATTTTCCTCCTGGAGG + Intergenic
903314000 1:22486478-22486500 CCTTTTCCCTCTCCCGCTGCTGG + Intronic
903687871 1:25145827-25145849 GCCTTTCTCTCTCCTTCTGCCGG - Intergenic
903921797 1:26804840-26804862 CCCTCTCCCTCTCCTTTCGACGG - Intergenic
904453560 1:30632477-30632499 CCCTTTGCCTCTCCCTTTGGGGG + Intergenic
904576247 1:31506908-31506930 CCCTTTGCTTCTCATTCTGTGGG - Intergenic
904697270 1:32337385-32337407 CCCCATCCCTTTCCTCCTGGGGG - Intergenic
904714497 1:32457118-32457140 CCCATTCCCTCTCTTTCCTGGGG - Intergenic
905544555 1:38787250-38787272 CCCTTGCCCGTTCCTTCTTGTGG - Intergenic
905874236 1:41422209-41422231 CACCTTCCTTCTCCTCCTGGGGG - Intergenic
905891447 1:41521003-41521025 GCCTTTCCCACTCCATGTGGAGG + Intronic
906105889 1:43292241-43292263 CCCATTCCCTGATCTTCTGGTGG - Intergenic
906328978 1:44868642-44868664 ACCTTTCCCTGCCCTTCTGTGGG - Intronic
907232869 1:53016597-53016619 CCCTTCCCCTATACTTCTGTTGG - Intronic
907350351 1:53824652-53824674 ACCTTTCCCTCTCCTGCCAGAGG + Intronic
907836547 1:58114321-58114343 CCATTTCTTTCTCCTTCAGGAGG - Intronic
908583078 1:65538330-65538352 TCCTTGCCATCTCCTTTTGGGGG + Intronic
908694030 1:66816282-66816304 CCCTTTCCCTCACGTCCCGGGGG + Intronic
908776981 1:67649842-67649864 CCTTTCCCCTCTCCTTCTATAGG - Intergenic
909053094 1:70791051-70791073 CCCTCTTCCTCTCCTTCTGCTGG + Intergenic
910763325 1:90756642-90756664 CCCATTCCCCCTTCTTCTGTGGG + Intergenic
910930593 1:92439449-92439471 CTCTTGCCCTCTCATTCTGCAGG + Intergenic
911845332 1:102745647-102745669 CCCTCTCCTTCTCCTTTTGATGG + Intergenic
911983213 1:104592257-104592279 CACTTTCACTTTCCCTCTGGAGG + Intergenic
912106405 1:106282066-106282088 CTCATTCTCTCTGCTTCTGGAGG + Intergenic
914349805 1:146831275-146831297 CCTCTTTCCTCTCCTCCTGGAGG - Intergenic
914717182 1:150262785-150262807 CCCTTTCCTTCTCTTCCAGGTGG + Exonic
914845401 1:151281293-151281315 CCCTTTCCCCCGCCTCCAGGGGG + Intronic
915473534 1:156139413-156139435 CCCTTTCCCTTGGCTTCTAGAGG - Exonic
915737742 1:158095321-158095343 GCCCTTCCCTCTTCTTCGGGAGG + Exonic
916173694 1:162021059-162021081 CCCTTTCCCTCTGCCTCTTCGGG - Intronic
916777634 1:167984271-167984293 CACTTTTCCCCTCCTTCTTGAGG + Intronic
918647570 1:186920719-186920741 CCCTTTTCCTCTCCTTTCAGGGG + Intronic
919465140 1:197916742-197916764 CTCTTTGCCTCACCTTCTTGAGG - Intronic
920199420 1:204250413-204250435 ATCTATCTCTCTCCTTCTGGTGG - Intronic
920261939 1:204694176-204694198 CCCTTCCCCTCTCCTTCCCGCGG + Intergenic
920859796 1:209696424-209696446 CCCAAACCCTCTCCTTCTGAGGG - Intronic
921620246 1:217317842-217317864 GCTTTTCTCTCTCCTTGTGGAGG + Intergenic
922163150 1:223093064-223093086 TCCTTGCCCTTTTCTTCTGGTGG + Intergenic
923413904 1:233735754-233735776 CCCTTCCCCTCTTCTGATGGAGG - Intergenic
924807680 1:247374036-247374058 CCCTTTCCCGCGCCCTCTGGTGG + Intergenic
1063068792 10:2637795-2637817 TCCTTTTCCTCTCCTTCTGAAGG - Intergenic
1063366134 10:5492079-5492101 CCTTCTCCATCTCATTCTGGAGG + Intergenic
1064284077 10:13977115-13977137 GCCTTTCCCTCTCACTCTTGTGG - Intronic
1064465837 10:15581000-15581022 CCTTTGCCCTCAGCTTCTGGGGG + Intronic
1064484302 10:15769059-15769081 CCCTTTCCATCTGCTTCATGGGG + Intergenic
1066080923 10:31929279-31929301 CCCTTTCCGTCTCCCTCAGGCGG - Intergenic
1066563149 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG + Intergenic
1067168283 10:43882887-43882909 CTCTCTCCCTCCCCTTCTGCAGG + Intergenic
1067437463 10:46288170-46288192 CCCTTTCCTGCTCCTCCTGCTGG + Intronic
1067830657 10:49609709-49609731 GCCTTCCCCTCCCCTCCTGGCGG + Intronic
1069076620 10:64043986-64044008 CCAGGCCCCTCTCCTTCTGGTGG + Intergenic
1069271422 10:66532885-66532907 CTCCTTCTCTCTCCTTCTGATGG + Intronic
1069495703 10:68901450-68901472 CCTTTTGCCTCTCCTTCTTCTGG - Exonic
1069638059 10:69937616-69937638 CCCTCTCCCTTTCCTCCAGGGGG + Exonic
1069744490 10:70706480-70706502 GCCTTCCCCTCCCCTGCTGGGGG + Intronic
1069857396 10:71448875-71448897 CCCTCTCCCTGGCCTGCTGGTGG - Intronic
1070308199 10:75252641-75252663 GCCCTTCTCTCACCTTCTGGTGG + Intergenic
1070555662 10:77525861-77525883 CCCATTCCCTCACCAGCTGGTGG + Intronic
1070799288 10:79235643-79235665 CTCTTTCCCTCACCTACTGTGGG - Intronic
1071281867 10:84110833-84110855 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1071667916 10:87578316-87578338 GGCTTTTCCTCTCCCTCTGGTGG + Intergenic
1071709493 10:88035779-88035801 GCCTTTCCCTCTCCTGGGGGTGG + Intergenic
1071833236 10:89392957-89392979 CCATTTCCCTCCCCTTCTTTGGG - Intronic
1072321646 10:94255999-94256021 CCCTTTCTCTCTCTTTCTCTTGG + Intronic
1072362054 10:94669149-94669171 CCCTTTCACTCTCCTACTTCAGG - Intergenic
1072721027 10:97781252-97781274 CCCTCACCCTCTCCTTAAGGAGG - Intergenic
1072866706 10:99069899-99069921 CACTTTCCCTCTCCTTGTTATGG - Intronic
1072994861 10:100233933-100233955 TCCTCTGCCTCTCCTTCTAGGGG + Intronic
1073914653 10:108388161-108388183 CCCTTTCCCCCTCTCTCTCGCGG - Intergenic
1075624136 10:123949642-123949664 CCCTGCCCCACTCCTTCTGTAGG + Intergenic
1075633097 10:124013132-124013154 GCCTTTCCCTCGGCTCCTGGGGG + Intronic
1075847335 10:125555359-125555381 GCCTTCCCCTCTCCACCTGGGGG + Intergenic
1076425593 10:130365300-130365322 CTGTTTCCTTCTCCTTCTGCAGG - Intergenic
1076626898 10:131826602-131826624 GCCCTTCCCTCCCGTTCTGGTGG - Intergenic
1076916080 10:133423697-133423719 CCCTTTCCCTCTCTTCCCGCAGG - Exonic
1076936186 10:133568483-133568505 CCCTTTCCCTCTCTTCCCGCAGG - Intronic
1077150774 11:1072190-1072212 CCCTCTCCCTCTTCCTCCGGTGG + Intergenic
1078936759 11:15958155-15958177 CCCATTTCTCCTCCTTCTGGAGG + Intergenic
1078988078 11:16613918-16613940 CCCTTTGCTTCTCTTTCAGGCGG - Intronic
1082788473 11:57330700-57330722 CCCTTTCCCCCTCCTGGTGCAGG - Intronic
1082929094 11:58579949-58579971 CCCTATCCCTTTCCTTTAGGCGG + Intronic
1083197291 11:61096123-61096145 CCCTTTCCCTCTCCTTTCGGGGG - Intergenic
1083765165 11:64838162-64838184 CTCCTTCCCTCTCCCTCTGCAGG - Exonic
1084358781 11:68656380-68656402 CCTTTTCCATCTTCTGCTGGTGG - Intergenic
1084693822 11:70742226-70742248 CCCCTTCCTCCTCCTTCTGCTGG + Intronic
1086169168 11:83816020-83816042 CTCTTTCTCTCTCCTTCTTTGGG + Intronic
1087104159 11:94393983-94394005 CCCTTTCTTTCCTCTTCTGGAGG - Intronic
1087619357 11:100525006-100525028 CCCTTTCCCACTTCTGCAGGTGG - Intergenic
1088459700 11:110069581-110069603 TCATTTCCCTTTCCTTCTGGAGG + Intergenic
1088982388 11:114875474-114875496 CCCATGCTGTCTCCTTCTGGTGG - Intergenic
1089494753 11:118902421-118902443 CCCTCACCCGCTCCTCCTGGGGG + Exonic
1089615965 11:119694922-119694944 CCCCTTGACTCTCCTTCTGAAGG + Intronic
1089808238 11:121111093-121111115 CCCTTTTCCTTCCCTTCTGTTGG - Intronic
1089900021 11:121971920-121971942 CATTTTACCTCTCCTTCTGCTGG - Intergenic
1090246030 11:125216541-125216563 CCCTTTCCCTCTTCTTCAAAAGG + Intronic
1090793320 11:130111517-130111539 ACCTTTCCTTCTGCTTCTGATGG + Intronic
1090874025 11:130773103-130773125 CCCTTTCTCTCTCCCTTTGCAGG - Intergenic
1091116064 11:133014714-133014736 TTCTTTCTCTCTCCTTCTGCTGG - Intronic
1091173041 11:133535197-133535219 CTCCTTCTCTCTCCTCCTGGTGG - Intergenic
1091563828 12:1633512-1633534 CCCTTCCCCTCTCCCACTGCTGG + Intronic
1091866537 12:3842032-3842054 GCCTTTCCCTCTGCTACAGGAGG - Intronic
1092102010 12:5891312-5891334 TCCTCTCACTCTCCTTCTAGGGG - Intronic
1094085184 12:26582943-26582965 CCATCTCCCTCTCCTTGTAGGGG + Intronic
1095375426 12:41522275-41522297 CCCTTTCACTTTCATTTTGGAGG - Intronic
1095769477 12:45936813-45936835 CCCTTTTCCACTTCTGCTGGAGG - Intronic
1095962124 12:47842260-47842282 CTCCTTCCTTCTCCTTCTGATGG + Intronic
1096277500 12:50222650-50222672 CCCTCTCCCTCTCCCTCTGCCGG - Intronic
1096422083 12:51467414-51467436 CTCTTTTCCTCTGGTTCTGGTGG - Intronic
1096596074 12:52696357-52696379 CCCTTTCCCTCACCTTCTTCAGG + Exonic
1096743285 12:53709989-53710011 CCCTCTCCCTCTCCCTCTCTTGG - Intronic
1096869377 12:54583870-54583892 ACCTTCCCCTCCCCCTCTGGGGG + Intronic
1096967792 12:55642374-55642396 CACATTTCCTCTTCTTCTGGGGG - Intergenic
1097054003 12:56239340-56239362 CCCTTCCCCTCTAATTGTGGTGG - Exonic
1097242077 12:57582396-57582418 CCCTTTTCCTCTCCTTGGTGAGG + Intronic
1097647195 12:62250764-62250786 CCCTTCCCCTCTCCTACAGAAGG + Intronic
1098748266 12:74266698-74266720 CCCTTTCCCTCTCCTTTCAGGGG - Intergenic
1099748370 12:86736894-86736916 CCTTATCCCTTTCCTTCTCGTGG + Intronic
1100345293 12:93724038-93724060 CCTTTTCCTTCTCCTCCTGCTGG + Intronic
1101029614 12:100646224-100646246 CCCTTTCCCTGTCCTTTCAGGGG + Intergenic
1101420692 12:104548473-104548495 CTTTTTCCCTGTCCTTCTAGTGG - Intronic
1101556709 12:105816822-105816844 CCCTTTCCCTTCCCTTCTGTGGG - Intergenic
1101725998 12:107388611-107388633 CCCTCTTCCCCTCCTGCTGGAGG + Intronic
1102587013 12:113930615-113930637 CTCTTACCCTCCCCTTCGGGAGG + Intronic
1102678693 12:114675521-114675543 CCCTTTTTCTTTTCTTCTGGTGG - Intronic
1102784093 12:115590007-115590029 CTCTTTCCCTCTCTCTCTGAGGG + Intergenic
1102819075 12:115892673-115892695 TCCTTTCTCTCCCCTTCTAGGGG - Intergenic
1102840271 12:116112947-116112969 ACCTTCCCCTCTTCTCCTGGTGG - Intronic
1102873777 12:116434275-116434297 CCCTGTCCCTCTGCCTCTGGTGG + Intergenic
1103289127 12:119829470-119829492 CCTTTTCCCCCTGCTTCTGCAGG - Intronic
1103611647 12:122127756-122127778 CCCTTTCCTTCTCCTTCCCTAGG - Intronic
1104107720 12:125680090-125680112 CTCCCTCCCTCTCCTCCTGGAGG + Intergenic
1104620399 12:130307667-130307689 CTCTGTCCCTCGCCTTGTGGCGG + Intergenic
1104660764 12:130610120-130610142 CCCAGTCCCTCCCGTTCTGGGGG + Intronic
1104660779 12:130610163-130610185 CCCGGTCCCTCCCGTTCTGGGGG + Intronic
1104660793 12:130610206-130610228 CCCGGTCCCTCCCGTTCTGGGGG + Intronic
1105848293 13:24311875-24311897 CCCTTTCCCGCTTCCTGTGGGGG - Intronic
1105930640 13:25048835-25048857 CCCTTTCCCACTTCTGCTGTTGG - Intergenic
1106070586 13:26407277-26407299 CTCTGTCCCTCTCCTCCCGGTGG + Intergenic
1108524680 13:51276663-51276685 TCCTTTCCCTTTCCTTTGGGTGG - Intronic
1109802646 13:67399575-67399597 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1110241690 13:73274632-73274654 TCTTTTCCTTCTCCTTTTGGAGG - Intergenic
1110687319 13:78390150-78390172 CCCTTACTCTCTCCTTCTCATGG - Intergenic
1110690675 13:78427454-78427476 CCCTTCTCCCTTCCTTCTGGGGG + Intergenic
1112489602 13:99849721-99849743 CTTTTTCCATCTCCTCCTGGTGG - Intronic
1113627130 13:111855623-111855645 CCCTGTCCCAGTGCTTCTGGTGG - Intergenic
1114004957 14:18302367-18302389 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1114634153 14:24178025-24178047 TCCTTTTCCTGTCATTCTGGTGG - Intronic
1116794175 14:49372477-49372499 CCCTTTCTCCTTCCTGCTGGCGG + Intergenic
1117899821 14:60520309-60520331 ACCTTTCCGTTTCCTTTTGGAGG + Intergenic
1118737222 14:68710650-68710672 CCACTTCCCTCTTCTACTGGTGG - Intronic
1119205500 14:72790944-72790966 CCTCTTCCCTCTGCTCCTGGTGG + Intronic
1119482091 14:74964280-74964302 CCCTTTCCTGCTCCCTCTGTGGG - Intergenic
1120886345 14:89454888-89454910 CCCACTCCCTCTCCTTCTCCAGG - Intronic
1120983719 14:90314144-90314166 AGCTTTCCCTCACCTTCAGGTGG - Intronic
1121820678 14:96963549-96963571 CCCTGCCTCTCTCTTTCTGGGGG + Intergenic
1122281018 14:100622444-100622466 CTCTTTCCCCCTCCTCCTGCTGG + Intergenic
1122309403 14:100785075-100785097 CCCATTCCCTGCCCATCTGGTGG + Intergenic
1122865513 14:104602262-104602284 CCCTGTCCCCCAGCTTCTGGTGG + Intronic
1122941050 14:104981542-104981564 CCCTCCCACCCTCCTTCTGGGGG + Intergenic
1123389415 15:19854601-19854623 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1125119384 15:36135865-36135887 TCCTTTCCCCCAACTTCTGGTGG + Intergenic
1125956302 15:43793088-43793110 CCCTTTCCCTCCCCTCCCTGGGG - Intronic
1127293461 15:57590719-57590741 CCTGTACCCTGTCCTTCTGGAGG - Intergenic
1128215190 15:65929879-65929901 CCCTTTCCCTCCCCTCAGGGTGG - Exonic
1128497224 15:68205508-68205530 CCCTTTGCTTCGGCTTCTGGAGG - Exonic
1129604014 15:77016031-77016053 CCCTTCTCCTGTCCTTATGGAGG - Intronic
1129833425 15:78685638-78685660 CCCTTTCCCTCCCGTCCTGGGGG + Intronic
1130101370 15:80896846-80896868 CCTGTTCCCTGTCCTTTTGGAGG - Intronic
1130116626 15:81010806-81010828 CCTCATCCCTCTCTTTCTGGAGG + Intronic
1130996858 15:88908894-88908916 CCCCCGCCCCCTCCTTCTGGAGG + Intronic
1131690783 15:94824989-94825011 CCCTTGGCCTCTTGTTCTGGGGG + Intergenic
1131827317 15:96331796-96331818 CCCTTCCCCTCCCCTCCCGGCGG + Exonic
1132220880 15:100104221-100104243 CCCGGTGTCTCTCCTTCTGGAGG + Intronic
1132564905 16:617515-617537 CCCCTTCCCTCCCCTTCTGTCGG + Intronic
1133098463 16:3464402-3464424 CCCTTTCCCTCACCATCTGCTGG - Intronic
1133924555 16:10182472-10182494 CCCTCCCCCTCTCCTACTGCTGG - Intronic
1134079584 16:11315767-11315789 CCCCTTCCCCCTCCTGCTGGGGG - Intronic
1135350360 16:21724222-21724244 CCCTTTGCCTCTCCTTTGGAAGG - Intronic
1135685914 16:24498300-24498322 GCCTTTCCCTCAGCCTCTGGTGG - Intergenic
1135932694 16:26751987-26752009 CCCTTCCTCTTTCTTTCTGGTGG + Intergenic
1136928470 16:34396849-34396871 CACTGTCCCTTTCCTTCTGATGG + Intergenic
1136976104 16:35014955-35014977 CACTGTCCCTTTCCTTCTGATGG - Intergenic
1137720835 16:50626454-50626476 CCCTTGCCGCCTCCTTCAGGAGG - Intronic
1137893424 16:52185641-52185663 CCATTTCACCCTCCTTCTAGTGG + Intergenic
1138094805 16:54203202-54203224 CCTTCTCCCTCTCCTTCATGGGG - Intergenic
1138407295 16:56806691-56806713 CCCATTCCCTCTTGTTCTAGGGG - Intronic
1138890985 16:61143964-61143986 GCCTTTCCCTTACCTTCTCGTGG + Intergenic
1139836363 16:69841859-69841881 CCCTGTTCCTCTTCTCCTGGTGG + Intronic
1139984231 16:70884256-70884278 CCTCTTTCCTCTCCTCCTGGAGG + Intronic
1140318284 16:73921302-73921324 ACCTTTCACTATCCTTCTAGTGG + Intergenic
1140709541 16:77663978-77664000 CCCCTTCCCTGACCATCTGGTGG - Intergenic
1141275953 16:82588397-82588419 CCCTTACCCACTCATTCTGATGG - Intergenic
1141735623 16:85850485-85850507 CCTTTGCCCTCAGCTTCTGGAGG - Intergenic
1142008935 16:87704087-87704109 CCATCCCCCGCTCCTTCTGGAGG + Intronic
1142170529 16:88619791-88619813 CCCGTTCCCTCTCCCTGTGTTGG + Intronic
1142311721 16:89318031-89318053 CCCCGTCCCTCTCTTTCTGCAGG + Intronic
1142637952 17:1269572-1269594 CCCTTTGACTCCCCTTCTGCAGG - Intergenic
1143067437 17:4261473-4261495 CCCTTCCCCTTTCCTTTTGAGGG - Intronic
1143590571 17:7884271-7884293 CCCTCTCCCTTTCTTTATGGAGG + Intronic
1144798603 17:17910210-17910232 ACCTTTCCCTTTTCTTCTGCGGG - Intronic
1145367006 17:22273214-22273236 CCCTCTCTCTCTCCTTCAAGAGG - Intergenic
1147045232 17:37746339-37746361 CCCTTTCCCTGTTCTTCTACAGG - Intergenic
1147317402 17:39627458-39627480 CCCTTACCATCTCCACCTGGCGG - Exonic
1147488781 17:40844188-40844210 CTCTTTTCCTCACCTTCTGGAGG + Intergenic
1147914699 17:43879403-43879425 ACCTTGCCTTCTCCTTCTGCAGG - Exonic
1148623640 17:49053140-49053162 TCCTGACCCCCTCCTTCTGGAGG + Exonic
1148648952 17:49235840-49235862 CCCTGTCCTTCTGCTTTTGGGGG - Intergenic
1148895176 17:50835352-50835374 CCCTTTCCCCCACCTCCTTGGGG - Intronic
1149571252 17:57673988-57674010 CCCTTTCCTTCTCCTGCAGGAGG + Intronic
1149647444 17:58250393-58250415 CCCCTTCTCTCTCCATCTGTAGG + Exonic
1150285671 17:63952467-63952489 TCCTTTACCTCCACTTCTGGAGG + Intronic
1151210283 17:72539212-72539234 CCCCTTCCTTGTCCCTCTGGAGG - Intergenic
1151674131 17:75589225-75589247 CCCTGCCCCTCGCCCTCTGGCGG - Intergenic
1151847597 17:76668215-76668237 CCCTTTCCTCCTCCTCCTGCAGG + Intergenic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152668449 17:81586193-81586215 CCCCTTCCCTCCCCTCCTGCAGG + Intronic
1152795043 17:82302548-82302570 CCAACTCCCTCTCCTTGTGGCGG - Intergenic
1153462482 18:5352007-5352029 TCCTTTCCCTCTCTTTCTCATGG - Intergenic
1153789545 18:8565156-8565178 CCCTTTCCCTCTCCTTGCCATGG - Intergenic
1154493076 18:14936136-14936158 ACCTTTCCCTTTCCTTCTCCTGG + Intergenic
1154532466 18:15361512-15361534 CCCTTTCTCCCTCCTTCAGATGG - Intergenic
1155030734 18:21981363-21981385 CCCTGTCCCTCTCCCTCTTCTGG + Intergenic
1155135521 18:22987755-22987777 CACTTTCTCTCTCTTCCTGGAGG + Intronic
1157106881 18:44782212-44782234 CCCTTTCTCTCTCCTTAACGTGG - Intronic
1157389318 18:47288084-47288106 TCCTTTCCAGCTCCTTCTGGCGG + Intergenic
1157934287 18:51856623-51856645 CCCTTTCTCTCTCCCTCCAGAGG + Intergenic
1158291868 18:55952784-55952806 CTCTTTCCCTGTCCTTTCGGGGG - Intergenic
1158623153 18:59049829-59049851 CCCTTCTGCTCTCCTTCTGAAGG + Intergenic
1159632282 18:70762901-70762923 CCCTTTGCCTCGCCCTGTGGCGG + Intergenic
1160108807 18:76005744-76005766 CCCTCTCTCTCTCTCTCTGGAGG + Intergenic
1160166714 18:76519344-76519366 CTCTTTCCCCCTCCTTCTGGTGG + Intergenic
1160591334 18:79946433-79946455 CACTTTTCCTCTCCTGCCGGAGG + Intronic
1161392235 19:4027504-4027526 ACTTTTTCCTCTTCTTCTGGGGG + Intronic
1161586616 19:5109188-5109210 CCCTTTCCCCCTTCCTCTTGAGG + Intronic
1162284561 19:9728496-9728518 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1162519874 19:11173482-11173504 GCCCTTCCCTCTCCTACTGGGGG - Intronic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1163679526 19:18672621-18672643 TCCTGTCGCTCTCATTCTGGTGG + Intergenic
1163767666 19:19172351-19172373 CCCCAGCCCCCTCCTTCTGGTGG + Intronic
1163943565 19:20516178-20516200 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1164044943 19:21529619-21529641 CTCTTTCTCTCTCCTTCTGTTGG + Intronic
1165561097 19:36680727-36680749 CACTTTGCCTCTTTTTCTGGTGG + Intergenic
1166197739 19:41218113-41218135 CCACTGCTCTCTCCTTCTGGTGG - Intergenic
1166453661 19:42922352-42922374 CCTTTTCTCTCTTCTTCAGGGGG + Intronic
1167104382 19:47421550-47421572 GTCTGTCTCTCTCCTTCTGGGGG + Intergenic
1167247735 19:48383839-48383861 CCATTTCCCTTTTATTCTGGTGG - Intronic
1168328304 19:55550015-55550037 CCCTCTCACTCTCCTCCCGGGGG - Intergenic
926117780 2:10224282-10224304 CCCGTTCTCTCCCCTCCTGGTGG - Intergenic
926211063 2:10869725-10869747 CTCTTTCACTCTCCTGCTGCTGG + Intergenic
927646079 2:24877783-24877805 CCTCTTCCCTCTCTGTCTGGTGG - Intronic
930869381 2:56154487-56154509 CCCTGTTCCTCTCTTTCAGGTGG - Intergenic
930917309 2:56709021-56709043 CTCTTTTCCTTTCCTTCTGAGGG - Intergenic
931451345 2:62369999-62370021 CACTGTCCCTGTTCTTCTGGAGG + Intergenic
931570415 2:63663223-63663245 CCCTTGCCCTCTGCTACTGTTGG + Intronic
931699622 2:64899070-64899092 CCTTTACCCTTTCCTTCTTGTGG - Intergenic
931741208 2:65247032-65247054 CCTTTTCAGTCTCCTTCTGCTGG - Intronic
931883003 2:66586657-66586679 CACTGTCACTTTCCTTCTGGTGG - Intergenic
932309358 2:70727395-70727417 CCCTCTCCCTCTCCCTCTCCTGG + Intronic
932515515 2:72344027-72344049 CCATTTCTCTCTCCTCCTCGGGG + Intronic
932762114 2:74444830-74444852 TCCATTCTCTCACCTTCTGGTGG - Intergenic
933657965 2:84905145-84905167 CACTTTTCCTCTCCTTAGGGAGG - Intronic
934030489 2:88041345-88041367 CCCTACTTCTCTCCTTCTGGGGG - Intronic
934490522 2:94759477-94759499 TCCTTTCCCTCCCATTCTGAGGG - Intergenic
934744810 2:96752280-96752302 CCCTTTCTGTATCCTTCTTGAGG - Intergenic
935395126 2:102599618-102599640 CGGTTTCACTCTCCTCCTGGGGG + Intergenic
936820749 2:116517952-116517974 CCCTTTACCCCTCCTTTTGCTGG - Intergenic
937127202 2:119482302-119482324 CACTTCCCCTCTCCTGCTAGGGG - Intronic
938531566 2:132192732-132192754 CCCTTTCTCCCTCCTTCAGATGG - Intronic
938675598 2:133630624-133630646 GTCTTTCCCTCTCCTGCTGTTGG + Intergenic
939747355 2:145992409-145992431 CCCTTTCACCCTCCATCAGGAGG - Intergenic
939773643 2:146357373-146357395 CTCTTTCTCTCTCTTTCTGATGG + Intergenic
939989993 2:148868836-148868858 GCCTTTCCATCTCCAGCTGGAGG - Intergenic
940346740 2:152636679-152636701 CCATTTCCCTCTGTTTGTGGAGG + Intronic
940617559 2:156068873-156068895 CCCTTTTCCTATCCTTCTGAAGG + Intergenic
940896743 2:159088383-159088405 CTCCTTCCCTCTGCTTCTTGGGG + Intronic
941085049 2:161107782-161107804 TCCTTTCCCCCTCCTTCTCAAGG - Intergenic
941225088 2:162838703-162838725 CCATTCCCCTCACCTTCCGGAGG + Intronic
941862756 2:170301069-170301091 CCAATTCCCTTTCCTTTTGGAGG - Intronic
942051602 2:172146007-172146029 ACCATTCATTCTCCTTCTGGCGG - Intergenic
942368838 2:175258740-175258762 CCTTTTTCATCTGCTTCTGGGGG + Intergenic
942894944 2:181041306-181041328 CCCTTTACCTCTCCTCATAGGGG + Intronic
943411553 2:187555887-187555909 CCCTCTCCCTCTCCCTCTCACGG + Intronic
945007398 2:205423311-205423333 CCCTATCACTATCCTTTTGGAGG + Intronic
945366908 2:208965735-208965757 TGCTTTCCCTCTCCATCAGGTGG + Intergenic
946803748 2:223449322-223449344 ACATTTCCCTCTCCTACTGCAGG - Intergenic
947748396 2:232520928-232520950 CCGTTTCTCTCTGCTTCTTGGGG - Intronic
948719464 2:239889510-239889532 CCATTTCCCACTCCTGCTTGGGG - Intergenic
948893265 2:240917054-240917076 CCCATTGCCTCTTCTTCTGGAGG - Intergenic
949005587 2:241645164-241645186 CACTGTCCCTCTCATGCTGGAGG - Intronic
1168875875 20:1171839-1171861 CCCTCTCCCTCTCCTTCAGAAGG + Intronic
1169076997 20:2767425-2767447 CCCTTACCCGCTTCTCCTGGAGG + Intergenic
1170534626 20:17327551-17327573 CCCTTCCCCTCTCCTCCCTGGGG + Intronic
1170597578 20:17817317-17817339 CCCTTTCCCCAACCTCCTGGTGG + Intergenic
1171165485 20:22966878-22966900 CCCTTTCCCACTTCTGCTGTTGG - Intergenic
1173425481 20:42939452-42939474 TCCTTTTCCTTTCCTTCTTGAGG + Intronic
1175607034 20:60319494-60319516 CCCTTTCCCCTTCCTCCTTGCGG + Intergenic
1176179149 20:63741433-63741455 CACCAGCCCTCTCCTTCTGGGGG + Exonic
1176764894 21:13006698-13006720 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1180219121 21:46346826-46346848 CCGTCTCCTTCTCCTTCTGGAGG - Exonic
1180229542 21:46418730-46418752 GCCTTTCCCTCCCCTTGGGGTGG + Intronic
1180429469 22:15233157-15233179 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1180744460 22:18078216-18078238 CCCCTTCCTTTTCCTTCTCGGGG + Intronic
1180871243 22:19148551-19148573 CCCATCCCCTCTCCCGCTGGGGG + Intergenic
1181437932 22:22921193-22921215 CCTCTCCCCTCTCCCTCTGGGGG + Intergenic
1182363062 22:29758907-29758929 CCTATTCCTTCTCCCTCTGGAGG + Intronic
1183059384 22:35326861-35326883 CCCTCTCTCTCTCCTCCTAGAGG - Intronic
1183262828 22:36806942-36806964 CCCTCTCCTTCTGCCTCTGGGGG - Intronic
1183688617 22:39375905-39375927 CCCTTTGCCTGTCCCTTTGGGGG + Intronic
1184335844 22:43852596-43852618 CCTTTTCCTTTTCCTTTTGGAGG - Intronic
1184453604 22:44597084-44597106 CCCTTTCCCTCTCCCTCTCTGGG - Intergenic
1184472502 22:44703600-44703622 CCGTTTCCCTCTCCGTCAGTGGG + Intronic
1185190899 22:49435336-49435358 GCCTTTCCTCCTCGTTCTGGGGG + Intronic
949126402 3:450178-450200 CCCTCTCCCTCTTCTTCTTATGG + Intergenic
949150942 3:766260-766282 CACGCTGCCTCTCCTTCTGGTGG - Intergenic
949500116 3:4671651-4671673 CCCCTTCCCTTCCCTTCAGGTGG - Intronic
950567269 3:13777616-13777638 CACTTCCCCTCTGCTACTGGAGG - Intergenic
950734085 3:14990736-14990758 CTCTTTCCCTGTGTTTCTGGGGG + Intronic
952627385 3:35423109-35423131 GCCTTTCTCTCTTGTTCTGGTGG + Intergenic
953216819 3:40926398-40926420 CCCTTTACCACTCCTTGTGAAGG + Intergenic
955126554 3:56117971-56117993 CCCATTCCCTCTCCCTGGGGTGG - Intronic
955419870 3:58725401-58725423 CCCTTTCCCCCTGCTTCTGCTGG + Intronic
955633383 3:60999685-60999707 CTATTTCCCTTTCCTTCTGCAGG - Intronic
955774814 3:62421657-62421679 CCCCTTCCCCCTCCTTTGGGGGG - Intronic
956068259 3:65419736-65419758 CCCTTTTCCTTTCCTTCAGTTGG + Intronic
956415563 3:69025113-69025135 CCCTTTACCCCTCCTTCCCGGGG + Intronic
957228708 3:77482898-77482920 CCCTTTCAATTTCCTTCTGAAGG - Intronic
958012738 3:87901036-87901058 CTTTTTCTCTTTCCTTCTGGTGG - Intergenic
959739026 3:109694911-109694933 CCTTTTCCCCCTCCTTAGGGGGG + Intergenic
959794829 3:110413480-110413502 CCCTTTAACTCTCCCTCTGCTGG - Intergenic
960117694 3:113912825-113912847 CCCTTTCTCTCTCCTATTGGTGG - Intronic
960442823 3:117710253-117710275 CCCTTTCCCTTTCCTACTCTTGG + Intergenic
960586107 3:119322829-119322851 CCCTCTCCCCCTCCCCCTGGCGG - Intronic
961151424 3:124641712-124641734 CCCTTTCCCTGTCCTTCACAAGG - Intronic
961558528 3:127713063-127713085 CCCTTGCCCACTGCTGCTGGAGG - Intronic
961563335 3:127746458-127746480 CCTTTTCTCTCTGGTTCTGGGGG + Intronic
962251655 3:133839659-133839681 CCCTTCCCATCTCCCACTGGTGG - Intronic
962314790 3:134352612-134352634 CCCACTCCCACTCCTGCTGGGGG + Intergenic
962921411 3:139953649-139953671 CCCCTTCCCTCTCCCTCAGGTGG + Intronic
963021548 3:140876786-140876808 CCCTCTCCTTCTCCTTTTGATGG - Intergenic
963535108 3:146518102-146518124 TTCATTCCCTCTCCTTCTGTAGG + Intronic
963965328 3:151362355-151362377 CCCTTTCCCTCTGTTTATTGTGG + Intronic
964445414 3:156752686-156752708 CCTCTTCCTCCTCCTTCTGGAGG - Intergenic
964522773 3:157585594-157585616 CCCTTTCCCTCTCCTTCTGGGGG + Intronic
964892578 3:161554842-161554864 CCATTTTCCTCTGCTTTTGGGGG - Intergenic
964972410 3:162578092-162578114 CCCTCTCCCTCCCCTTTTGATGG - Intergenic
965417190 3:168411040-168411062 CCCTTTTCCTCTCCTGCAGATGG - Intergenic
966767068 3:183472869-183472891 CCCCTGCCCTTTCCTTCTGATGG - Intergenic
966850270 3:184160681-184160703 CACGTTTCCTCTCTTTCTGGGGG - Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
968504526 4:965705-965727 GCCTCTCCCTCTCCCTCTGGGGG - Intronic
968625988 4:1626925-1626947 CCCCCACCCTCTCCATCTGGAGG - Intronic
968797970 4:2721633-2721655 CCCTCCCTCTCTCCTGCTGGAGG + Intronic
969626667 4:8309136-8309158 CACTGTCCCTCTTCCTCTGGAGG - Intergenic
970792301 4:19873093-19873115 CTCTTTCCCTCTCATTCATGTGG + Intergenic
971136267 4:23871938-23871960 CCCTTTCCTCTTCCCTCTGGAGG - Intronic
972796352 4:42425121-42425143 CAATTTCTTTCTCCTTCTGGGGG + Intronic
974002740 4:56527616-56527638 TCCCTTCCCTCTTCTTCTGAAGG - Intergenic
975310361 4:72897573-72897595 CCCCCTCCCTCTCTTTCTGTAGG - Intergenic
975470736 4:74763614-74763636 CCCTTTCTCTCCCATTCAGGAGG - Intronic
975649081 4:76574051-76574073 CACTTTCCCTCTCCTCCCTGAGG + Intronic
976092555 4:81472938-81472960 CCCTCCCCCTCTCCTTCCTGGGG + Intronic
976211015 4:82669728-82669750 CTCTTTTCCCCTCCTCCTGGTGG - Intronic
976860620 4:89661675-89661697 TCTTTGCCCTTTCCTTCTGGTGG + Intergenic
976970368 4:91095373-91095395 CCCTTTCCCTGCCCTTTGGGGGG + Intronic
977952390 4:102987646-102987668 TACTTTCCCTCTCCTCCTGCTGG + Intronic
978404349 4:108363683-108363705 CCCTAACCCTCTCCTTCTCTTGG - Intergenic
979358486 4:119733360-119733382 CCCTTTCCATCCCTTTCTCGGGG - Intergenic
979999031 4:127467119-127467141 CCCTTTCTCTCTCTCTGTGGTGG - Intergenic
980779780 4:137480685-137480707 ACCTTTCCCTCTCCTTTTGGGGG - Intergenic
981471233 4:145137893-145137915 GCCTTTCCCTCTGCTACAGGAGG + Exonic
982235331 4:153246869-153246891 CTCTTCCCCTCTGCCTCTGGTGG + Intronic
982314975 4:154023050-154023072 CCCTTTCCCCCTCTTTCTGGGGG - Intergenic
982785877 4:159536238-159536260 CCCTTTCTCTCTTCTTCTTCTGG + Intergenic
982857939 4:160408591-160408613 CTCTTTCCCTTCCCTTCCGGAGG + Intergenic
983283012 4:165705121-165705143 TCCTTTCCAGGTCCTTCTGGAGG - Intergenic
983896520 4:173086928-173086950 CCCTTTACCTCAACTCCTGGAGG + Intergenic
983965313 4:173802251-173802273 CACAATCCCTCTCCTTTTGGGGG - Intergenic
984956923 4:185053983-185054005 CCCTTTCCATCCTTTTCTGGGGG + Intergenic
985275145 4:188231076-188231098 CCCTTTCCCTCTACATCTTCTGG + Intergenic
985881645 5:2642872-2642894 CCCGTTCCCCCTCGTCCTGGAGG - Intergenic
986329081 5:6704334-6704356 GCCTATGCCTGTCCTTCTGGTGG + Intergenic
986491928 5:8301796-8301818 AACTTTCCCTGTCTTTCTGGAGG - Intergenic
986812415 5:11374007-11374029 CCTTTTCCCTTTCCTTCTGCAGG + Intronic
987008064 5:13731362-13731384 GCCTTTCCCTAACCCTCTGGTGG - Intronic
988220048 5:28333391-28333413 TCCTTTCCCTCTCCCCCTAGGGG + Intergenic
988692028 5:33581951-33581973 GCCTTTCCCCCAGCTTCTGGTGG - Intronic
989144208 5:38232595-38232617 CCCTTTCCCTTTCCTCCTCTAGG - Intergenic
989161568 5:38396248-38396270 CTCTCTCTCTCTCCTTCTGTGGG - Intronic
989496596 5:42116244-42116266 CCCTCTCGCTCTCCTTTTGATGG - Intergenic
990513697 5:56512767-56512789 CACTTTCACCCTCTTTCTGGAGG - Intronic
992147249 5:73863548-73863570 CCATTTTCCTCTCCTCCTGCAGG + Intronic
992155857 5:73954516-73954538 CCCTTTACCATCCCTTCTGGAGG - Intergenic
992610649 5:78505424-78505446 TCCATTCCTTCTCTTTCTGGAGG - Intronic
993328680 5:86570209-86570231 CCTTTACCCTTTCCTTCTTGTGG - Intergenic
993416007 5:87632379-87632401 CCCTTTCCCTTTTCTTCTTCAGG - Intergenic
993971812 5:94429401-94429423 CCCTTTTCCCCTGTTTCTGGGGG + Intronic
994784313 5:104136585-104136607 CCCTGTCCCCCACCTTCTGCTGG - Intergenic
995473475 5:112526279-112526301 CCCTTTCCCACTCCTTTCGAGGG - Intergenic
995697865 5:114900069-114900091 CCCTTTGCCTCCCCAGCTGGTGG + Intergenic
996403813 5:123088422-123088444 CTCTTTCCCTCTCCTTCTTGGGG - Intergenic
996522423 5:124441911-124441933 ACCCTTCCCTGTGCTTCTGGAGG - Intergenic
997580752 5:135015337-135015359 CCCTTTCCCTCTAGCTCTGCAGG - Intergenic
999274655 5:150321413-150321435 CCCTCTCCCTCACTTTCAGGTGG + Intronic
999391849 5:151199069-151199091 CCCTTTCCTTCTCCACCTGGGGG + Exonic
1000781371 5:165486581-165486603 CCATTTCCCTTTACTTCTGTGGG + Intergenic
1000907438 5:166979381-166979403 CCCTCTCTCTCTCTTTCTTGAGG + Intergenic
1001373104 5:171226660-171226682 CTCTTTCCCCCTTTTTCTGGAGG - Intronic
1001709674 5:173768126-173768148 CCCTGTCCCTGACCTCCTGGAGG - Intergenic
1001837795 5:174846353-174846375 CTCTTTCTTTCTCTTTCTGGTGG - Intergenic
1001923230 5:175617082-175617104 CCCTTTCACTCTACTTCTCCGGG - Intergenic
1002078543 5:176724019-176724041 TCCTGTCCCCCTGCTTCTGGAGG - Intergenic
1002597291 5:180332388-180332410 CCGTTTCCCTCTCCCCCTAGAGG + Intronic
1003486526 6:6584912-6584934 CCCTTTCCCTGACCTTTTGTGGG + Intergenic
1005417963 6:25621694-25621716 CATTTTCCCTCTCCTTGTAGTGG + Intergenic
1005731226 6:28698795-28698817 CTCTTTCCCTTTCCTTCTATGGG - Intergenic
1005777134 6:29146417-29146439 CCCCTACCCTCTCCTTCAGATGG + Intergenic
1006455587 6:34130081-34130103 CCCTCACCCTCTCCTTCCCGAGG + Intronic
1006988648 6:38194243-38194265 CACTTCCCCTCACCTGCTGGAGG - Intronic
1007309546 6:40934632-40934654 CCCATTCCCTCTCCTCCTCCAGG - Intergenic
1008055141 6:46938243-46938265 CCCTTTCCCTTCCTTTCTGCTGG + Intronic
1008552228 6:52644275-52644297 CCCATTCCTGCTCCATCTGGAGG + Intergenic
1009422223 6:63475916-63475938 CCTTTTCCCTCTTCCTCTGAAGG - Intergenic
1010929035 6:81777961-81777983 CCCCTTCCCACTCCTTCCAGTGG + Intergenic
1011204028 6:84872269-84872291 CCATTTCCTTCTCGTTCTTGTGG - Intergenic
1012612285 6:101230898-101230920 CCTTTACCCTTTCCTTCTTGTGG - Intergenic
1014547109 6:122746852-122746874 CCCTTTCCCTCTCCTTTCAGAGG + Intergenic
1016190744 6:141261396-141261418 GCCTTTCCCTCTCAGACTGGTGG - Intergenic
1018283010 6:162207645-162207667 TTCCTTCCCTCTCCTTCTGAAGG + Intronic
1019207375 6:170373828-170373850 CTCTTTTCCTGTGCTTCTGGAGG - Intronic
1019712211 7:2522932-2522954 CCTTTTTCCTCCCCTCCTGGTGG + Intronic
1021017893 7:15558029-15558051 CCCTTTCTCTCTGCTTTTTGGGG + Intronic
1021280865 7:18716834-18716856 CCAATTCCCTCTGCTTCTGTTGG + Intronic
1022041766 7:26588222-26588244 CCCATTCCCTCTCCTCCTGTGGG + Intergenic
1022515763 7:30974233-30974255 GCCTGTCCCTCTCCTTCTCTGGG - Intronic
1023000484 7:35802048-35802070 CCCTTTCTATCTCCTCCGGGGGG - Intronic
1023237802 7:38108765-38108787 ACCTTTCCCTCTCCTGCAGAGGG - Intergenic
1023607240 7:41941890-41941912 CCCTGGCCCTCTCCTTTTGGGGG + Intergenic
1023623816 7:42097077-42097099 TCCTTTCCCTCTCCTTTTCCTGG - Intronic
1023734958 7:43226706-43226728 CCCTTGCACTCTCTTTCAGGAGG - Intronic
1023882863 7:44330298-44330320 CCCTTTCTCTATCCTGCTGCTGG - Intronic
1024233137 7:47377948-47377970 CACCTTCCCTCCCCTTCTAGAGG + Intronic
1024262195 7:47581403-47581425 CTCTTTCCCTTTCCCTTTGGTGG - Intronic
1024889595 7:54185056-54185078 ACCTTTCCCTTACCTCCTGGGGG + Intergenic
1024942853 7:54780300-54780322 CCCACTCCCACTCCTTCTGAAGG - Intergenic
1026442619 7:70457406-70457428 CACGTCCTCTCTCCTTCTGGAGG + Intronic
1026930726 7:74221683-74221705 TCCTTCGCCTCACCTTCTGGGGG - Exonic
1029350845 7:100011847-100011869 CCCCTTCCCTCTCCCTGGGGTGG - Intergenic
1030793177 7:113755029-113755051 GCCTTAACCTCTCCTTTTGGTGG + Intergenic
1031038797 7:116817270-116817292 TCCTTTCCTTCTCCTTCTCCTGG - Intronic
1031101909 7:117491547-117491569 GCCTTTCCCCTACCTTCTGGTGG + Intronic
1031380584 7:121080816-121080838 CTCTTCCAGTCTCCTTCTGGTGG + Intronic
1032732783 7:134660416-134660438 GCCTCTCTCTCTCCTTGTGGTGG - Intronic
1032846400 7:135755307-135755329 TCCTTTCCCTCTCCTCATGAGGG - Intergenic
1034546908 7:151795152-151795174 CCCACTCTCCCTCCTTCTGGGGG - Intronic
1034881447 7:154765741-154765763 CACCTTCCCTGTCCTGCTGGGGG - Intronic
1034951872 7:155303561-155303583 ACCTTTCCGTCTCCCTCAGGGGG - Intronic
1034975645 7:155448086-155448108 CCCTTTCCCCCTCCACCTGCAGG - Intergenic
1037387263 8:18356735-18356757 CCCTTACCCTCTCCTTCAAGGGG - Intergenic
1037840844 8:22244624-22244646 CCCCTTCCCTGTGCTCCTGGTGG - Intergenic
1038666183 8:29540064-29540086 CCACTGCCCTGTCCTTCTGGAGG - Intergenic
1038828609 8:31033324-31033346 CCCCTTCCCTCCCCTCCTGGCGG - Exonic
1038878882 8:31584519-31584541 CTCTTTCCCTCTCCCTTCGGAGG + Intergenic
1039179970 8:34855542-34855564 CCCTTTCTCTGTCCTACTGTGGG - Intergenic
1039598207 8:38809768-38809790 CCCTTTTCCCCTCCTTCTGTAGG - Intronic
1039838271 8:41275238-41275260 CCCTCTCGCTCTCCTACTGGAGG - Intronic
1039911755 8:41832237-41832259 CCCCGTCTCTCCCCTTCTGGTGG - Intronic
1042964702 8:74337818-74337840 ACCTTTCTCTGTCCCTCTGGTGG - Intronic
1043648575 8:82557600-82557622 CTCTTTCCCTCTCCTTGAGTGGG + Intergenic
1043675619 8:82949131-82949153 CACTTTCCCCTTCCATCTGGTGG - Intergenic
1043722275 8:83559696-83559718 CCCCTTCCCTCTTCTTCAGTAGG - Intergenic
1044425851 8:92049072-92049094 TTCTTTCCCTCTCTTTCTAGTGG + Intronic
1044852519 8:96442939-96442961 CCCTCTCCCTCTTCTTCTCCTGG + Intergenic
1044896523 8:96898397-96898419 TCCTTTCCCTTTCCTTCTTTAGG - Intronic
1044969272 8:97604364-97604386 CCCTCTCCCTCTCCCTCTCCAGG + Intergenic
1045224608 8:100232287-100232309 TCCTCTCCCTCTCCTTCTGTAGG + Intronic
1045468051 8:102487426-102487448 CCCATTCCTTCTCTTCCTGGTGG - Intergenic
1046735902 8:117777073-117777095 CCCTCTCCCTCTCCCTCTCCAGG + Intergenic
1046799967 8:118415203-118415225 CCCTTTGCCTTTTCTTCTGAAGG - Intronic
1046867578 8:119167877-119167899 CCATTTCAGTCTCCTGCTGGTGG + Intronic
1047338570 8:123958416-123958438 CCCTGTCCCTCACCTACAGGAGG + Intronic
1047478770 8:125260520-125260542 ACCTTTCACTTTCCTTCTCGGGG + Intronic
1047896494 8:129372096-129372118 CTCTTTCCCTTTCCTTGTGATGG - Intergenic
1048394606 8:134002155-134002177 CCTTTTCACTCTACCTCTGGTGG + Intergenic
1048884497 8:138898780-138898802 CCCTTCTCCACTCCTGCTGGTGG + Intronic
1049176606 8:141196737-141196759 GCCTCTGCCTCACCTTCTGGGGG - Intergenic
1049680085 8:143914210-143914232 GCCTTCGCCTCTCCTGCTGGTGG - Intergenic
1051061394 9:13049208-13049230 CCCTTTCCTTCTCCTTATCCAGG - Intergenic
1051641741 9:19230429-19230451 CCCTCTCCCTTTCCTCCTGCGGG - Exonic
1051823410 9:21193213-21193235 CCCTGTCCCTATTCTTCAGGAGG + Intergenic
1051871463 9:21742466-21742488 CCCTTTCCCTCACCTTCTTCAGG - Intergenic
1053142738 9:35691145-35691167 CCCCTTCCCCCTCCTCCCGGCGG - Intergenic
1053274546 9:36773314-36773336 TCCTTTGCCTCTCCTTGTGAAGG + Intergenic
1053347365 9:37387723-37387745 CCCATTCCCTCTCCCCCTGGTGG - Intergenic
1053710176 9:40799228-40799250 CCCTTTCTCCCTCCTTCAGATGG - Intergenic
1056621793 9:88221007-88221029 GCCTCTCCCTCTCCCTTTGGCGG - Intergenic
1056805413 9:89725026-89725048 GCCTCTCTCTCACCTTCTGGAGG - Intergenic
1057801904 9:98195915-98195937 CCCTTCCCTGCTCTTTCTGGAGG - Intergenic
1058171258 9:101683818-101683840 CTCTCTCTCTCTCCTTATGGTGG - Intronic
1058706452 9:107641473-107641495 CCCTCTCCCTCACCCTCTTGTGG - Intergenic
1060735042 9:126061457-126061479 TCCTTTCCATCCCCCTCTGGTGG - Intergenic
1061291689 9:129653949-129653971 CCCTCTCCCTCTCCCTCCCGGGG - Intergenic
1061896771 9:133652354-133652376 CTGTGTCCCTCTCCTTCTGGTGG - Intronic
1062117173 9:134815691-134815713 CCCATTTCCCCTCTTTCTGGTGG + Intronic
1062380377 9:136284110-136284132 CCCCTCCCCTCTCCTCCTGCTGG - Intronic
1185553471 X:1002250-1002272 CCCTGCCCCTCTCCTTCTCCAGG - Intergenic
1185909592 X:3969806-3969828 CCCTTTCCCACTCCCTTCGGGGG - Intergenic
1187303399 X:18073471-18073493 CTCTCTCCCTCTCCTTCATGTGG + Intergenic
1187364010 X:18651851-18651873 CCCTTTCCTCTTCCTTCTGTGGG + Intronic
1189264904 X:39707160-39707182 CCATTTACCTCTACTTCTAGAGG - Intergenic
1189280733 X:39818757-39818779 TCCTTCCCCTCTCCTTCTGCAGG - Intergenic
1189298980 X:39938366-39938388 ACCTTTCCCCCTACTTTTGGGGG - Intergenic
1189388717 X:40558127-40558149 GCCTCTCCCTCAGCTTCTGGTGG + Intergenic
1189532169 X:41896462-41896484 CCATTTCCCTCTCTTTCTCTTGG + Intronic
1190315278 X:49146570-49146592 CCCTTTCTCGCCCCTTCGGGGGG + Intergenic
1190426211 X:50336312-50336334 CCCTTTCCCTGTCCTTTTGGGGG + Intronic
1190713750 X:53087576-53087598 CCATCTCCCTCTCATTCTGTGGG + Intronic
1191718219 X:64207181-64207203 TGCTTACCCTCTCCTTGTGGAGG - Intergenic
1191947532 X:66552111-66552133 CCCTTTCCCATTCCTTCTTTTGG + Intergenic
1191954009 X:66624829-66624851 CCCTTTCCCACTTCTGCTGTTGG - Intronic
1193365717 X:80629865-80629887 CCCTTTCCATCTCCTTCTTGAGG - Intergenic
1193668013 X:84348063-84348085 CCCTTTTTTTCTCTTTCTGGTGG + Intronic
1196069022 X:111498913-111498935 CCCTTACCCTCTCCCTCTTCAGG + Intergenic
1197301198 X:124783015-124783037 TCTTTTCCTTCTCCTTCAGGTGG - Intronic
1198969718 X:142267566-142267588 CCCTTTCCCTGCCCTTTGGGGGG - Intergenic
1199299635 X:146197782-146197804 TCCTTTTCCTTTCCTTTTGGAGG - Intergenic
1200367860 X:155686705-155686727 CCCTTTCTTTGTCCTTCTGCTGG - Intergenic
1200394445 X:155975286-155975308 CCCTTTCCCTCTCCTTTCAGGGG + Intergenic
1200943065 Y:8805382-8805404 CCCTTTCCCTCTCCTTTCAGGGG - Intergenic
1201554786 Y:15256674-15256696 CCTTTTCCCTCTTCTTTTGGGGG - Intergenic