ID: 964527479

View in Genome Browser
Species Human (GRCh38)
Location 3:157630815-157630837
Sequence CTACTTCAACACTAATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964527479_964527483 25 Left 964527479 3:157630815-157630837 CCAAAATATTAGTGTTGAAGTAG 0: 1
1: 0
2: 1
3: 17
4: 163
Right 964527483 3:157630863-157630885 TTTTTCCTTCATCAGAATCCTGG 0: 1
1: 0
2: 2
3: 34
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964527479 Original CRISPR CTACTTCAACACTAATATTT TGG (reversed) Intronic
904445061 1:30565295-30565317 CTAATACAAAACTAAAATTTTGG + Intergenic
904581068 1:31544686-31544708 AAACTTCAAAACTACTATTTGGG + Intergenic
908371434 1:63483090-63483112 CTACTAAAACAGTAATATTTGGG + Intronic
909861812 1:80615748-80615770 CTATATCAACAGTAATATTGGGG + Intergenic
910134063 1:83945492-83945514 ATACTTCAACAATAACAGTTGGG + Intronic
911342000 1:96651008-96651030 CCATTTCAGGACTAATATTTTGG - Intergenic
911989743 1:104678753-104678775 TTACTTTGACACTGATATTTAGG - Intergenic
913523329 1:119667103-119667125 CTTCTTCAACACTTTCATTTTGG + Intronic
915836159 1:159177158-159177180 CTCCATCACCACTAATATCTAGG + Intronic
918050331 1:180967849-180967871 CAACTTCAACATGAATTTTTTGG + Intergenic
919061355 1:192637800-192637822 CTACTTGAACTCTAATTTTAAGG + Intronic
919555114 1:199042727-199042749 ATACTTCAACAATAATATTGTGG + Intergenic
919628247 1:199933810-199933832 CAACTTTTACATTAATATTTTGG + Intergenic
921037151 1:211391511-211391533 CAACCTCAGCACTAACATTTTGG - Intergenic
923544772 1:234916177-234916199 CTCTTTCAACACTTCTATTTCGG - Intergenic
923614834 1:235528434-235528456 TTACTTCAACACAGCTATTTAGG - Intergenic
1063761776 10:9086918-9086940 CTACTTCAACTCTTATCTTTTGG + Intergenic
1064294881 10:14069910-14069932 CTATTTCAAGAATAATATTAAGG + Intronic
1067997347 10:51288871-51288893 TTACTTCAGCACTAATTTCTGGG + Intronic
1075756908 10:124819921-124819943 CTACTGCAACAATAAAACTTTGG - Intronic
1077878945 11:6332408-6332430 CTACTTCAACACTACCCTTGGGG - Intergenic
1079469325 11:20763480-20763502 ATACTCCAACACTAATATCTGGG - Intronic
1080963274 11:37185146-37185168 CCCCTTGAACACTAAAATTTAGG + Intergenic
1081007438 11:37763359-37763381 TTCCCTCAACAGTAATATTTAGG - Intergenic
1083997970 11:66281556-66281578 TTACTTTAACACAAAAATTTTGG - Intronic
1085462810 11:76704932-76704954 CTTCTTCATCATTAAAATTTCGG - Intergenic
1094809015 12:34119854-34119876 CAACTCCAACACTTATATTCAGG - Intergenic
1095840546 12:46687005-46687027 CTATGTTAACACTGATATTTGGG + Intergenic
1096545551 12:52336663-52336685 CTTCTTTAAAACTATTATTTTGG - Intergenic
1097472645 12:60014411-60014433 TTGCTTCAAAAATAATATTTTGG + Intergenic
1101396477 12:104352983-104353005 CTACTTAAACATTAATAATTTGG + Intergenic
1107089033 13:36456570-36456592 CTAATTCAGCATTAATAATTAGG - Intergenic
1107532293 13:41294877-41294899 CTAATACAAAACTAAAATTTTGG + Intergenic
1109477117 13:62894954-62894976 CGACTTCAACATAAAAATTTTGG - Intergenic
1110711305 13:78653915-78653937 CTACTTCAACATTAGGAATTTGG + Intronic
1112961517 13:105133073-105133095 CTGATTCATCACTAATATCTCGG - Intergenic
1113344115 13:109457405-109457427 CTACTTCCATAATAATATTGAGG - Intergenic
1114744402 14:25132349-25132371 CTATTGCAGAACTAATATTTTGG - Intergenic
1115060164 14:29177972-29177994 ATAATTCAACAATAATTTTTGGG + Intergenic
1116375101 14:44189087-44189109 TTACTAAAACATTAATATTTGGG + Intergenic
1117873936 14:60230845-60230867 ACAGTTCAACAGTAATATTTGGG - Intergenic
1121878891 14:97481495-97481517 TTTCTTTAACATTAATATTTTGG + Intergenic
1121913668 14:97816445-97816467 CTAGCTCATCACTAATATTAGGG + Intergenic
1125039309 15:35165096-35165118 CTTCTTCTAGATTAATATTTAGG + Intergenic
1125312860 15:38399463-38399485 CCAGTTCTACACTAATATTAAGG + Intergenic
1126426375 15:48530896-48530918 CTAATTAACCACTAATATTTTGG - Intronic
1126604234 15:50459816-50459838 CTATTTCAAGACTATAATTTGGG - Intronic
1127018344 15:54714840-54714862 ATACTTCAGCAAGAATATTTTGG + Intergenic
1127064996 15:55227811-55227833 CTACTTAAACATTACTGTTTTGG - Intronic
1127856536 15:62958199-62958221 CTCCTACAACACTGATATCTAGG + Intergenic
1128427866 15:67560793-67560815 CTACTTAAACCAAAATATTTTGG - Intronic
1130723457 15:86413226-86413248 CAAATTCAACTCTAATATTGTGG - Intronic
1130926643 15:88390584-88390606 CTTGTTCAACACTGATCTTTGGG + Intergenic
1133574394 16:7074182-7074204 CTACTTCAATCCTAACATTTGGG - Intronic
1139946021 16:70642712-70642734 CAACTTCAACACATGTATTTTGG + Intronic
1143113089 17:4564191-4564213 GTACTTTAACAATAATATTCTGG - Intergenic
1144198986 17:12922400-12922422 GTACTTGAACACTCATATTATGG - Intronic
1147029485 17:37620286-37620308 ATAGTTTTACACTAATATTTGGG + Intronic
1147858655 17:43502772-43502794 CTACTGTAAATCTAATATTTTGG - Intronic
1148726307 17:49793297-49793319 TTATTTCCACACTGATATTTTGG - Intronic
1149206969 17:54259098-54259120 GTACTTAAGCACTAATATTTTGG + Intergenic
1149873830 17:60209664-60209686 CTATTTCAACAAATATATTTTGG + Intronic
1150087610 17:62286924-62286946 CTATTTCAACAAATATATTTTGG + Intergenic
1150454913 17:65299552-65299574 GGACTTCAACACAAAAATTTGGG - Intergenic
1158565181 18:58549037-58549059 CTTATTCATCACTAATAGTTTGG + Intronic
1158694118 18:59688169-59688191 CTAATTCAAAACTAACATTTCGG + Intronic
1166614267 19:44228934-44228956 CAACTGCAGCACTACTATTTTGG - Intronic
928736558 2:34297898-34297920 CTTTTTCAAGTCTAATATTTAGG + Intergenic
928744475 2:34395373-34395395 AAACTTCAACAGTAATAATTAGG + Intergenic
929392227 2:41483221-41483243 CTGCTTTAACAAAAATATTTTGG - Intergenic
930413751 2:51062592-51062614 CAATTTTAACACTTATATTTAGG - Intergenic
934018387 2:87916053-87916075 CTGATGCCACACTAATATTTTGG - Intergenic
934962036 2:98684524-98684546 ATTCTTCAACTCAAATATTTAGG + Intronic
942348094 2:175024282-175024304 CTACTTCAACTGTGACATTTAGG - Intergenic
942423437 2:175833419-175833441 CTATTTCAACAAGAATATATAGG + Intergenic
944815964 2:203375467-203375489 CAAGTTCAACACTGATATTTAGG - Intronic
948759472 2:240181873-240181895 CTCCTCCAACACTGAGATTTGGG + Intergenic
1176668321 21:9708060-9708082 TTAGTGCAAAACTAATATTTTGG + Intergenic
1179102970 21:38372456-38372478 CTATTTCAATATAAATATTTAGG + Intergenic
1182820783 22:33214399-33214421 CTACTTCAACATACAAATTTGGG + Intronic
1183019554 22:35016289-35016311 CTACTTTAACACTGTTAATTGGG - Intergenic
1184623506 22:45702477-45702499 CAACTTCAACTTTAATATTTTGG + Intronic
949942001 3:9162452-9162474 CGATTTCAATCCTAATATTTGGG + Intronic
951234121 3:20214658-20214680 CTAATTCAAGACTATTATTAAGG - Intergenic
951371243 3:21851802-21851824 CTACTTCTTCTCTAATATTGGGG + Intronic
956142463 3:66159569-66159591 CTAATTCATCATTAATATTCAGG + Intronic
956580776 3:70810107-70810129 CAACATCAACCTTAATATTTGGG + Intergenic
958192554 3:90201453-90201475 GTACTTCAACAATCACATTTTGG + Intergenic
958415970 3:93873382-93873404 GTACTTCAACAATCACATTTTGG + Exonic
958581298 3:96027595-96027617 TTATTTCAAAACTAATATATAGG + Intergenic
958980966 3:100719149-100719171 CTACTTTAACACTAATTAGTTGG - Intronic
959380467 3:105635409-105635431 CTTCTTCACCACTATTATATAGG + Intergenic
959716541 3:109439658-109439680 CTCCTTCTACTCTAAAATTTTGG + Intergenic
959856581 3:111165802-111165824 CTACTTCAAGAATAATATTTGGG + Intronic
960485576 3:118248940-118248962 CTTTTTAAACATTAATATTTGGG + Intergenic
962184728 3:133246249-133246271 GAACTTCAAAACTAATAGTTTGG - Intronic
962939216 3:140110363-140110385 CTATTTTCACAGTAATATTTTGG + Intronic
963566198 3:146934149-146934171 CTAATTTAACACCAATATCTTGG - Intergenic
964527479 3:157630815-157630837 CTACTTCAACACTAATATTTTGG - Intronic
965614120 3:170575753-170575775 CTACTTCAACTGTAATACATAGG + Intronic
966010882 3:175075178-175075200 CAGCTTCACCACTTATATTTTGG - Intronic
970351072 4:15202261-15202283 GTTCTTCAACACTGAGATTTTGG + Intergenic
971434266 4:26603432-26603454 CTACATCAAAACTAATCTTTAGG + Intronic
975714816 4:77195576-77195598 TTACTTCAAAACTAATACTCTGG + Intronic
975976789 4:80106711-80106733 TTTGTTCAACAGTAATATTTAGG - Intronic
975992637 4:80274664-80274686 CTACTTCATCAGTAATTATTTGG - Intronic
976954315 4:90876326-90876348 TTGCTTCAAAAATAATATTTAGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978556990 4:109991571-109991593 CTACTGCCACCCTAACATTTAGG - Intronic
979357897 4:119727393-119727415 CTTCTTCAACACAAATATATTGG + Intergenic
979658263 4:123222379-123222401 GTTCTTAAACACTAATATTCTGG + Intronic
980135257 4:128852570-128852592 CTACTGTAACACTTAAATTTAGG + Intronic
983308370 4:166022935-166022957 CTACTTCTGCAATAATATTAGGG - Intronic
983751997 4:171285413-171285435 CTACTTCAACGTTAACTTTTTGG + Intergenic
984292494 4:177813110-177813132 CTACCTAAACACTACTCTTTGGG + Intronic
984686617 4:182675934-182675956 CTACTTAAACACATATATTGTGG - Intronic
985088803 4:186342789-186342811 CTCCTTAAACACTCATCTTTAGG + Intergenic
985406460 4:189643451-189643473 TTAGTGCAAAACTAATATTTTGG - Intergenic
988132839 5:27127693-27127715 ATACTGCAAAAATAATATTTTGG + Intergenic
988151275 5:27384785-27384807 TTAATTCAAAAATAATATTTTGG + Intergenic
989040949 5:37228835-37228857 CTCCTTTAAAATTAATATTTGGG - Intronic
990611530 5:57461778-57461800 TCACTTCAACTCTATTATTTGGG + Intergenic
993019095 5:82569360-82569382 CTACCTCAACAATACTATTCTGG + Intergenic
994150182 5:96438760-96438782 CTATTTGAAAAATAATATTTCGG + Intergenic
994272607 5:97798963-97798985 TTATTTCTACATTAATATTTAGG - Intergenic
995440161 5:112182468-112182490 CTTCTTCAAAACTTATATATAGG + Intronic
995931317 5:117449527-117449549 CTACTTCAACAGGTATATCTGGG - Intergenic
997855177 5:137366711-137366733 CTACTTAATCACTTATATCTTGG - Intronic
997911809 5:137881956-137881978 CTACTTCTACAAGAATATTTTGG - Exonic
998981387 5:147706648-147706670 ATACTCCATCAGTAATATTTGGG - Intronic
999335147 5:150709279-150709301 ATACTTCAACATTATTACTTTGG + Intronic
1006240084 6:32670091-32670113 CAACATCAGCAGTAATATTTTGG + Intergenic
1008170970 6:48204862-48204884 CTACTTCCTCAAAAATATTTAGG - Intergenic
1009787812 6:68361121-68361143 CTACTTCAACATCAACATCTGGG + Intergenic
1011385210 6:86789243-86789265 CTAATTCTACAGTAATAATTTGG + Intergenic
1014792856 6:125694007-125694029 CTACTTCTACTTTTATATTTCGG + Intergenic
1014910808 6:127090672-127090694 CCACTCCAACAAAAATATTTAGG + Intergenic
1015639577 6:135316640-135316662 CTAATTAAACACTAGTATTAAGG - Intronic
1017360908 6:153570368-153570390 CTATGTCAATAATAATATTTGGG + Intergenic
1020593811 7:10178533-10178555 ATACTTCACTTCTAATATTTAGG - Intergenic
1020786395 7:12578522-12578544 CTATTTCAACATTTAAATTTTGG + Intronic
1021073755 7:16274949-16274971 CTACTATAAAACCAATATTTGGG + Intronic
1022676177 7:32501468-32501490 TTTCTTCAACTTTAATATTTTGG + Intronic
1024827196 7:53404505-53404527 GTTCCTCAACAATAATATTTTGG - Intergenic
1027735232 7:81924002-81924024 TAACTTCAACAATAGTATTTTGG - Intergenic
1029891535 7:103935110-103935132 GTACTTCAACACAAATTCTTGGG - Intronic
1030327755 7:108239387-108239409 CTAGTTCTAGACTTATATTTAGG + Intronic
1030632456 7:111910532-111910554 CTATTAAAACGCTAATATTTTGG + Intronic
1030768636 7:113443719-113443741 CTAATTCAACAAATATATTTAGG + Intergenic
1030900301 7:115115256-115115278 CCAGTTCAGCACTAATATTTTGG - Intergenic
1032788231 7:135218952-135218974 GTCCTTCAACACAAAAATTTGGG + Intergenic
1032950157 7:136899807-136899829 CTTCTTCAGAGCTAATATTTGGG + Intronic
1035993980 8:4525130-4525152 CTACTCCAACATTATTATTTGGG + Intronic
1040568748 8:48590042-48590064 CTACTTCAATAGTGATGTTTTGG - Intergenic
1043084742 8:75815038-75815060 CAACTTCTATACTAATATTTTGG - Intergenic
1046164461 8:110413278-110413300 CTACTTGGAGATTAATATTTGGG + Intergenic
1047596732 8:126385639-126385661 AAACTTCAAAATTAATATTTTGG + Intergenic
1047914024 8:129562202-129562224 CTACAACAAAACTATTATTTGGG + Intergenic
1048415561 8:134224289-134224311 CTCCTTCAACACAATTATTGAGG - Intergenic
1048564189 8:135577248-135577270 CTACTTCCTCAATAATATTGTGG + Intronic
1050342309 9:4653049-4653071 CTTTTTCAAGACTACTATTTTGG - Intronic
1052337491 9:27335293-27335315 CTACTCCAACACTTTAATTTCGG + Intronic
1056137814 9:83646863-83646885 TTACATCAACCCTCATATTTGGG + Intergenic
1058133237 9:101277235-101277257 CTACTTAGAGACTAATATTGGGG + Intronic
1058316439 9:103573151-103573173 TTGCTTCTACATTAATATTTTGG - Intergenic
1058399656 9:104599826-104599848 AGACTTCAACAGGAATATTTCGG - Intergenic
1058793630 9:108475392-108475414 CTACTTCAAGAATAAAGTTTAGG - Intergenic
1203657545 Un_KI270753v1:12895-12917 TTAGTGCAAAACTAATATTTTGG - Intergenic
1185723510 X:2401082-2401104 CTACTGGAAGAATAATATTTGGG + Intronic
1187585290 X:20654213-20654235 TTACTTCAACAGTTCTATTTTGG + Intergenic
1188846700 X:35080833-35080855 TTACTTCAATACCAATATATAGG - Intergenic
1194258477 X:91664905-91664927 CTACTTTAACACGAGTGTTTTGG - Intergenic
1195555292 X:106214513-106214535 CTCCTCCAACACTAATCTTCAGG - Intergenic
1196693688 X:118588186-118588208 CAACCTCCACAGTAATATTTTGG - Exonic
1196708059 X:118733377-118733399 GTTCATCATCACTAATATTTAGG - Intronic
1198229283 X:134674076-134674098 CTACTTGAACACCAAAATCTTGG + Intronic
1198670223 X:139072056-139072078 CTGCTTCAACAGTGATGTTTCGG + Intronic
1198973941 X:142314136-142314158 CAACTTCAGCACTAATTTATTGG + Intergenic
1199126146 X:144123085-144123107 CTGATGCCACACTAATATTTTGG + Intergenic
1199886487 X:152026367-152026389 CTACTTTGACATTAATATCTGGG - Intergenic
1200577243 Y:4904404-4904426 CTACTTTAACACGAGTGTTTTGG - Intergenic
1201374815 Y:13307867-13307889 TTACTTCAAAACTAATAGTATGG + Intronic