ID: 964529609

View in Genome Browser
Species Human (GRCh38)
Location 3:157652935-157652957
Sequence ATGTCTCTCTATGAGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964529609_964529614 25 Left 964529609 3:157652935-157652957 CCCACACACTCATAGAGAGACAT 0: 1
1: 0
2: 1
3: 24
4: 317
Right 964529614 3:157652983-157653005 CTCCTGCATATACACACATGTGG 0: 1
1: 0
2: 1
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964529609 Original CRISPR ATGTCTCTCTATGAGTGTGT GGG (reversed) Intronic
900754508 1:4424414-4424436 CTGTCTCACTGAGAGTGTGTTGG - Intergenic
902924517 1:19687386-19687408 ATGTCTCTTTAAAAGTGTTTGGG - Intronic
905038767 1:34935158-34935180 ATAACACTCTATGAGTGAGTTGG - Intergenic
905874760 1:41425836-41425858 ATGTCTGTGTATATGTGTGTAGG + Intergenic
905893208 1:41529779-41529801 ATGTGTATGTATGAGTGTGTGGG - Intronic
906579313 1:46923025-46923047 ATCTCTCACTATTATTGTGTGGG + Intergenic
908799333 1:67863135-67863157 ATGTCTCTCTATGAGTTTTATGG + Intergenic
912087360 1:106025857-106025879 AGGCTTCTCTATGAGTGAGTTGG - Intergenic
912557398 1:110525999-110526021 ATGTCTCTGTGTATGTGTGTGGG - Intergenic
915012046 1:152696672-152696694 ATGTGTGTGTATGTGTGTGTGGG - Intergenic
916555410 1:165890387-165890409 ATGTATCTGTATTGGTGTGTTGG + Intronic
916952662 1:169796351-169796373 AAGTCTCTCTATAAGCTTGTGGG - Intronic
917055338 1:170975755-170975777 ATCTCTCACTATTATTGTGTGGG + Intronic
917172137 1:172188566-172188588 ATGTCCCTCTATGGGTGAATGGG - Intronic
917974774 1:180231423-180231445 AAGTCTCTCTCTGTGTGTATGGG + Intronic
918451378 1:184662410-184662432 ATGTGTCTCTAAGACAGTGTGGG - Intergenic
918633701 1:186749291-186749313 ATGTCTGTGTATGTCTGTGTGGG + Intergenic
921655851 1:217736281-217736303 CTGTCTCCATATAAGTGTGTAGG - Intronic
1062951200 10:1505188-1505210 GTGTGTCTCTGTGTGTGTGTCGG - Intronic
1064996893 10:21303923-21303945 ATGTCTTTTTTTGTGTGTGTGGG - Intergenic
1067267489 10:44757968-44757990 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1067541105 10:47153727-47153749 ATGTCTTGCTGTGAGTGGGTGGG + Intergenic
1068857274 10:61810511-61810533 ATGTGTCTATATGTGTGTGTGGG - Intergenic
1070686267 10:78484985-78485007 GTGTCTCTGTGTGTGTGTGTGGG + Intergenic
1072783939 10:98268046-98268068 CTGTCTCTCTGTGAGTCTGCAGG - Intronic
1073620402 10:105041257-105041279 ATCTGTCTCCATGTGTGTGTGGG + Intronic
1074247330 10:111708081-111708103 ATGTCTCTGTATGAGATTGTTGG + Intergenic
1074869117 10:117563264-117563286 ATGTGTGTCTATGGGTGTGTGGG + Intergenic
1074869147 10:117563478-117563500 ATGTATGTCTATGGGTGTGTGGG + Intergenic
1074869170 10:117563674-117563696 ATGTGTGTCTATGGGTGTGTGGG + Intergenic
1075167591 10:120083347-120083369 ATGTCTCTGTGCGTGTGTGTGGG + Intergenic
1075212210 10:120500844-120500866 ATCTGTCTCAATGTGTGTGTGGG + Intronic
1075283230 10:121159418-121159440 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1075650489 10:124125233-124125255 ATGTCTCAGTGTGTGTGTGTTGG - Intergenic
1075773239 10:124959080-124959102 ATGTCTCTCAAAGAGTTTATAGG + Intronic
1075875061 10:125799391-125799413 CTGTGTGTCTATGTGTGTGTTGG + Intronic
1076141871 10:128085970-128085992 GTTTCTCTCTATGGGTCTGTGGG + Intergenic
1076614316 10:131746185-131746207 ATGTATCCATATGTGTGTGTGGG - Intergenic
1076883381 10:133250263-133250285 GTGTCTCTCTCTGTGTCTGTTGG - Intergenic
1077314920 11:1914958-1914980 ATGTTTGTGTATGTGTGTGTTGG + Intergenic
1077630860 11:3810124-3810146 TTCTCTCTCTCTGAGTGTCTTGG + Intronic
1079114311 11:17631370-17631392 CTCTCTCTCTGTGTGTGTGTGGG + Intronic
1080334785 11:31183136-31183158 ATCTCTCACTATTATTGTGTGGG - Intronic
1080953840 11:37068817-37068839 ATGTGTGTCTGTGTGTGTGTAGG + Intergenic
1081241744 11:40715028-40715050 CTGCATGTCTATGAGTGTGTTGG - Intronic
1084219609 11:67669646-67669668 ATGTGTGTCTATGTGTGTATGGG + Intronic
1085000621 11:73030192-73030214 ATGTATATGTATGCGTGTGTGGG + Intronic
1085829215 11:79881934-79881956 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1086522632 11:87687834-87687856 ATCTCTCACTATTATTGTGTGGG - Intergenic
1088162202 11:106885944-106885966 TTGTCTCTCTCTGTATGTGTAGG - Intronic
1089571724 11:119415744-119415766 ATGTTTCTCCTTGAGTGTGTTGG + Intergenic
1090949589 11:131462024-131462046 ATGTCTCTCAACTAGTGAGTGGG + Intronic
1091150759 11:133326441-133326463 ATGTGTGTGTATGTGTGTGTGGG + Intronic
1092278523 12:7081294-7081316 CTGTCTCTCCCTCAGTGTGTGGG - Exonic
1092672586 12:10880930-10880952 GTGTCTCTTTCTGAGTGTTTGGG - Intronic
1092704758 12:11270045-11270067 ATTTCTGTGTATGTGTGTGTGGG + Intergenic
1092922074 12:13241279-13241301 ATGTATATATATGTGTGTGTGGG - Intergenic
1096095338 12:48931599-48931621 AGGTGTCTCTGTCAGTGTGTAGG + Intronic
1096976045 12:55699748-55699770 ATGTCTCCCTGGGTGTGTGTTGG + Intronic
1097350988 12:58548789-58548811 GTGTCTCTGTGTGTGTGTGTAGG - Intronic
1098993666 12:77094053-77094075 ATCTCTCACTATTATTGTGTGGG + Intergenic
1099400179 12:82194156-82194178 ATGGCTCACTATGAGTGAGCTGG + Intergenic
1100023812 12:90103263-90103285 GTGTATATCTGTGAGTGTGTGGG - Intergenic
1103196185 12:119045497-119045519 GTGTGTCTCTGTGAGTGTTTTGG - Intronic
1104636300 12:130439835-130439857 ATGTGTATCTGTGAGTCTGTGGG + Intronic
1105286694 13:19009936-19009958 ATGTCTTTTTAGGAGAGTGTTGG - Intergenic
1105722648 13:23132176-23132198 ATGAGTCTGTATGTGTGTGTGGG - Intergenic
1107187614 13:37543012-37543034 ATCTCTCACTATTATTGTGTGGG + Intergenic
1107803506 13:44132376-44132398 GTGTATCTGTATGTGTGTGTGGG - Intergenic
1109090235 13:58033299-58033321 GTGTGTCTCTGTGTGTGTGTGGG + Intergenic
1109695993 13:65958465-65958487 ATGCCTATGTATGAGTGTCTTGG + Intergenic
1109762811 13:66852262-66852284 ATGTCCCTCTGTTAGTGAGTGGG - Intronic
1110324391 13:74197476-74197498 GTGTGTCTGTGTGAGTGTGTGGG - Intergenic
1110803898 13:79733295-79733317 ATGTCCCACTATTAATGTGTGGG + Intergenic
1112642847 13:101296436-101296458 ATGTTTATATATGAGTGTGCAGG - Intronic
1112726486 13:102310677-102310699 CTCTCTCTCTGTGTGTGTGTGGG + Intronic
1113439532 13:110317133-110317155 GTGTGTCTGTATGTGTGTGTGGG - Intronic
1113439538 13:110317337-110317359 ATGTGTTTCTGTGTGTGTGTGGG - Intronic
1114364693 14:22013707-22013729 CTGCCTCTTTATGGGTGTGTTGG - Intergenic
1114526821 14:23371763-23371785 ATGTCTGTGTATGGGTATGTTGG + Intergenic
1114972148 14:28045950-28045972 ATGTGTGTGTATGTGTGTGTAGG + Intergenic
1115535805 14:34372237-34372259 ATGTCTTTCTATGTGTGTCTTGG - Intronic
1115928589 14:38465649-38465671 ATTTCTCACTATTATTGTGTGGG + Intergenic
1117836246 14:59809435-59809457 ATTCCTCTCTATAAGTATGTTGG + Intronic
1118771384 14:68944880-68944902 AGGTCACCCTATGCGTGTGTGGG + Intronic
1118906404 14:70026929-70026951 ATGTGTGTGTATGAGTGTGATGG + Intronic
1119018216 14:71082461-71082483 ATCTCCCACTATGATTGTGTGGG + Intronic
1119729963 14:76945005-76945027 CTGTCTACCTGTGAGTGTGTGGG - Intergenic
1120471501 14:84931420-84931442 ATCTATCTCTCTGTGTGTGTAGG - Intergenic
1120533218 14:85659208-85659230 ATTTCTCTCTATAAGTTTGTAGG + Intergenic
1120653821 14:87165782-87165804 ATGTGTGTGTATGTGTGTGTTGG - Intergenic
1121815619 14:96925843-96925865 AAGTTTCTCCATGGGTGTGTGGG + Intronic
1122617172 14:103026974-103026996 ATTTGTCTTTATGAGTGAGTTGG - Intronic
1123079440 14:105685253-105685275 CTGTCTCTGTATGTGTGTCTAGG + Intergenic
1124862405 15:33455149-33455171 AGGTCTCTCCATGGGTGTGTGGG + Intronic
1126641231 15:50829137-50829159 ATGTCTCTCCATGTGTTTCTAGG + Intergenic
1127666562 15:61153440-61153462 TTCTCTCTCTCTGAATGTGTTGG - Intronic
1127822680 15:62673812-62673834 ATGTCTCTCTCTTAGTCTGAAGG + Exonic
1128342518 15:66832237-66832259 ATGTATGTGTGTGAGTGTGTGGG + Intergenic
1129366193 15:75056627-75056649 ATGACACTGTATGTGTGTGTTGG + Intronic
1129544723 15:76383119-76383141 ATGTATATATATGTGTGTGTAGG - Intronic
1129628507 15:77231871-77231893 ATGAATTTGTATGAGTGTGTAGG - Intronic
1130303547 15:82698446-82698468 GTGTGTCTCTATGAGGGTGTGGG - Intronic
1131059850 15:89397989-89398011 ATGTCTCTATATGTGGGTGCCGG - Intergenic
1133424391 16:5675243-5675265 CTCTCTTTCTATGTGTGTGTGGG - Intergenic
1134176315 16:12009370-12009392 ATGTTTTTGTATGTGTGTGTGGG + Intronic
1135051170 16:19194225-19194247 ATGTCTCTCTCTGAGCTTTTGGG + Intronic
1137391406 16:48084342-48084364 CTGTCTCCCTATGAGTTTGTAGG - Intronic
1138281916 16:55778731-55778753 GTGTGTCTCTTTGTGTGTGTGGG - Intergenic
1140046664 16:71444028-71444050 ATGTGTGTCTATGGGTGTGGGGG + Intergenic
1140249924 16:73287020-73287042 ATGTGGCTGTGTGAGTGTGTGGG + Intergenic
1140716820 16:77734099-77734121 ATGTTTATCTTTGCGTGTGTTGG - Intronic
1141216402 16:82028362-82028384 ATCTCTCTGTATCTGTGTGTAGG - Intergenic
1141216405 16:82028492-82028514 ATCTCTCTGTATCTGTGTGTAGG - Intergenic
1141216410 16:82028626-82028648 ATCTCTCTGTATCTGTGTGTAGG - Intergenic
1142976359 17:3646982-3647004 ATGTGTCTCTCTGAGAGTGCAGG + Intronic
1143117534 17:4589241-4589263 ATGTTTCTCTATAGGTGGGTGGG - Intronic
1144145601 17:12394947-12394969 TTCTCTCTCTGTGAGTATGTGGG - Intergenic
1146494195 17:33306375-33306397 ATTTCTCTGTATTAATGTGTGGG - Intronic
1146498073 17:33340738-33340760 ATGTGTGTCTCTGTGTGTGTTGG + Intronic
1148445963 17:47737294-47737316 CTGTGTCTCTGTGGGTGTGTGGG + Intronic
1149313546 17:55419303-55419325 GTGTTTGTCTATGTGTGTGTAGG + Intronic
1149627501 17:58090242-58090264 ATGTGTGTGTATGTGTGTGTGGG + Exonic
1150359934 17:64522940-64522962 ATGTATGTCTGTGTGTGTGTTGG + Intronic
1151177965 17:72304521-72304543 GTGTTTCTGTGTGAGTGTGTGGG + Intergenic
1151177976 17:72304750-72304772 GTGTTTCTGTGTGAGTGTGTGGG + Intergenic
1151177980 17:72304824-72304846 GTGTTTCTGTGTGAGTGTGTGGG + Intergenic
1151212840 17:72557773-72557795 ATGTCTGTGTATGAGTGTGTGGG - Intergenic
1151460458 17:74251220-74251242 ATGTGCCTGTATGTGTGTGTGGG + Intronic
1155302012 18:24438917-24438939 ATTTCTCTCTCTTTGTGTGTGGG - Intronic
1155517240 18:26636278-26636300 GTGTTTCTCTATGACTTTGTGGG - Intronic
1156031169 18:32714278-32714300 ATGGCTCTCTATGAGTTTATAGG + Intronic
1158429207 18:57368965-57368987 ATGTGTGTGTATGTGTGTGTGGG - Intronic
1158825747 18:61216795-61216817 ATGTCTCTTTACAAGTGTGGAGG - Intergenic
1159433102 18:68381819-68381841 ATATATCTCTATAAGTGTATTGG + Intergenic
1159968771 18:74622838-74622860 GTGTATCTGAATGAGTGTGTGGG + Intronic
1160118145 18:76101064-76101086 ATGTGTGTATGTGAGTGTGTGGG + Intergenic
1160330266 18:77984773-77984795 ATATGTCTGTATGGGTGTGTAGG + Intergenic
1160450592 18:78962353-78962375 ATGTGTGTGTATGGGTGTGTGGG - Intergenic
1160523276 18:79521057-79521079 ATGTGTGTCCATGTGTGTGTGGG + Intronic
1160523294 18:79521171-79521193 ATGTGTGTCCATGTGTGTGTGGG + Intronic
1160523306 18:79521243-79521265 ATGTGTGTCCATGTGTGTGTGGG + Intronic
1160957666 19:1700842-1700864 GTGTCTCTCTATGTCTCTGTGGG + Intergenic
1164686595 19:30170321-30170343 GTGTGTCTGTGTGAGTGTGTGGG + Intergenic
1165218832 19:34297973-34297995 TTGTATTTCTATGATTGTGTTGG - Intronic
1166479571 19:43159016-43159038 CTCTCTCTCTCTGTGTGTGTGGG - Intronic
1166869153 19:45860484-45860506 CTTTCTCTCTCTGTGTGTGTGGG - Intronic
925665461 2:6250528-6250550 ATGTCTGTGTGTGTGTGTGTTGG + Intergenic
925769695 2:7269916-7269938 ATGTGCCTGTATGAATGTGTGGG + Intergenic
926944519 2:18172305-18172327 TTGCCTCTGTATGTGTGTGTGGG + Intronic
929810963 2:45188928-45188950 ATGTGTTTGTGTGAGTGTGTTGG - Intergenic
929854766 2:45627536-45627558 ATGTCTCTCTATGAGCTTTTAGG - Intergenic
930400380 2:50877170-50877192 GTGTGTGTCTATGTGTGTGTTGG - Intronic
933063211 2:77764577-77764599 ATATATCTCTATGATTTTGTAGG - Intergenic
933255358 2:80074511-80074533 GTGTGTCTGTATGCGTGTGTGGG + Intronic
935615531 2:105076476-105076498 ATGTGTCTGTATGAATATGTAGG - Intronic
936554448 2:113481953-113481975 ATGTATATATATGAATGTGTGGG + Intronic
936699234 2:114990263-114990285 ATCTCTTTATATGATTGTGTTGG - Intronic
936804665 2:116315244-116315266 ATGTATGTATATGTGTGTGTAGG - Intergenic
938170032 2:129067713-129067735 ATGTGTGTCTATGTGTGAGTGGG + Intergenic
938585867 2:132690162-132690184 ATGTCTCCCCATGTCTGTGTGGG + Intronic
939605426 2:144249056-144249078 ATTTCTCTTTATGTGAGTGTAGG + Intronic
943186050 2:184608566-184608588 AGGTCACTCTATGACTGTGATGG - Intronic
943283628 2:185969009-185969031 TTGTCTCTATATGACTGTGGTGG + Intergenic
943721189 2:191205070-191205092 ATGTGTTTCTGTGTGTGTGTTGG + Intergenic
943990741 2:194688181-194688203 CTGTCTGTCTATGTCTGTGTGGG - Intergenic
945447894 2:209959755-209959777 ATGTGTCTGAATGTGTGTGTTGG + Intronic
946185973 2:217980494-217980516 CTCTCTCTCTGTGTGTGTGTAGG - Intronic
946383188 2:219363502-219363524 GTGTCTGTTTATGTGTGTGTAGG + Intergenic
947036956 2:225870168-225870190 ATTTCTCTCCCTGTGTGTGTGGG - Intergenic
1170083363 20:12501474-12501496 AAGTCTCTCTTTGAGTTTCTTGG + Intergenic
1171157577 20:22890366-22890388 ATGTCTGTATGTGTGTGTGTTGG - Intergenic
1171290505 20:23980321-23980343 TTGTGTGTGTATGAGTGTGTGGG - Intergenic
1172362348 20:34322076-34322098 ATGGATGTCTGTGAGTGTGTGGG + Intergenic
1172849064 20:37947566-37947588 AGGTCCCTCTAGGAGGGTGTGGG + Intergenic
1173161918 20:40659092-40659114 CTTTCTCTGTATGCGTGTGTGGG + Intergenic
1174140692 20:48411522-48411544 ATGACTCTCTCTGAGTGAGAGGG - Intergenic
1174438883 20:50532728-50532750 GTGTCTGTCTATGTGTGGGTGGG + Intronic
1175133269 20:56805495-56805517 GTGTCTGTGTGTGAGTGTGTCGG - Intergenic
1175512488 20:59540998-59541020 ATGTGTCTGTATAAGTGAGTGGG + Intergenic
1176889471 21:14296872-14296894 ATGTGTGTGTGTGAGTGTGTGGG + Intergenic
1177171403 21:17659869-17659891 GTCTCTCGCTATGAGAGTGTTGG - Intergenic
1180067945 21:45421974-45421996 GTGTGTCTGTGTGAGTGTGTTGG - Intronic
1184597880 22:45525413-45525435 ATTTCTCTCTCTGTGTCTGTGGG + Intronic
949220097 3:1621999-1622021 ATATCTCTTTATGTGTGTGTGGG + Intergenic
950925769 3:16740125-16740147 ATGTCTTTCCATGTGTTTGTTGG + Intergenic
951278844 3:20722111-20722133 ATGTAACTCTATTTGTGTGTTGG + Intergenic
955227649 3:57074239-57074261 ATGTGTGTGTATGTGTGTGTTGG - Exonic
955835093 3:63045866-63045888 ATCTCTATCTGTGATTGTGTAGG + Intergenic
956640769 3:71413429-71413451 ATGTGTGTATATGTGTGTGTGGG - Intronic
956700200 3:71952119-71952141 ATGCCTCTTTATGTGTGTGCTGG + Intergenic
956939609 3:74142615-74142637 ATGACTCTTTATGAGAGTGAGGG - Intergenic
957649460 3:82981371-82981393 TTCTCTCCCTATGACTGTGTAGG - Intergenic
957696587 3:83647782-83647804 ATCTCCCTCTATTATTGTGTGGG + Intergenic
958663641 3:97105759-97105781 ATCTCTCACTATTACTGTGTGGG + Intronic
958694322 3:97508763-97508785 ATCTCCCTCTATTATTGTGTGGG + Intronic
958783132 3:98566602-98566624 ATGTTTCTGTAAGAGTGTTTTGG + Intronic
958845473 3:99260094-99260116 GTGTTTCTCTCTGAGTGTGAGGG + Intergenic
959850392 3:111079774-111079796 ATGTTTCTCAAAGATTGTGTTGG - Intronic
960334312 3:116397394-116397416 ATGTGTGTGTATGTGTGTGTGGG - Intronic
960470375 3:118057120-118057142 ATCACTCTATATGAGTGTCTTGG - Intergenic
960776777 3:121265010-121265032 AAGTCTCCCTATTATTGTGTGGG - Intronic
960875705 3:122293134-122293156 ATGTGTGTCTTTGTGTGTGTTGG + Intergenic
962453668 3:135545250-135545272 ATCTCTCTCCATGTGTGTTTTGG + Intergenic
964529609 3:157652935-157652957 ATGTCTCTCTATGAGTGTGTGGG - Intronic
966379731 3:179332054-179332076 ATGTCTCTCTATGCTATTGTTGG - Intronic
967336225 3:188347747-188347769 ATGACCCACTGTGAGTGTGTGGG + Intronic
967376888 3:188814102-188814124 GTGTGTCTGTATGTGTGTGTGGG - Intronic
967525968 3:190493071-190493093 ATGGATCTCTTTGAGTGTTTGGG - Intergenic
967850147 3:194076221-194076243 ATGGCTCTCTAAGAGTATTTAGG - Intergenic
968063483 3:195744998-195745020 GTGTCTCTCTGTGAGGGTGTTGG + Intergenic
968828798 4:2920436-2920458 ATTTCTCACTATTATTGTGTGGG + Intronic
969649355 4:8455043-8455065 CTGTCTCTCCCTGAGTTTGTTGG + Intronic
970134945 4:12912269-12912291 ATATCTTTTTATGAATGTGTCGG - Intergenic
971132880 4:23832978-23833000 TTAGCTTTCTATGAGTGTGTTGG - Intronic
972382524 4:38532703-38532725 ATGACTCTCTAGAACTGTGTTGG - Intergenic
973284570 4:48401381-48401403 ATCTCTCACTATTATTGTGTGGG + Intronic
974145956 4:57947792-57947814 ATGTCTAACTGTGTGTGTGTGGG - Intergenic
977053806 4:92163675-92163697 AAGTCTCTGTATGTGTGTCTTGG - Intergenic
978364276 4:107964437-107964459 GTTTTTCTCTATGCGTGTGTAGG - Intergenic
979181685 4:117736512-117736534 ATCTCTCACTAGGATTGTGTAGG - Intergenic
979757000 4:124353132-124353154 ATGTCTCCCTCTGAGTGAGGGGG - Intergenic
979790579 4:124776098-124776120 ATCTCTCTCCATGAGTGTTTTGG + Intergenic
979866074 4:125754975-125754997 GTGTCTCTCTCTGTGTGTATGGG - Intergenic
980493167 4:133556040-133556062 AAGTCTTTCTATGAGGGGGTAGG + Intergenic
981479204 4:145219589-145219611 ATTTCTCTCTTTGAATGTGTGGG + Intergenic
981632958 4:146842430-146842452 ATGACTCTCTATAAGTCTGTGGG - Intronic
981740275 4:147994247-147994269 ATGTCTCTGTTGGAATGTGTGGG + Intronic
983427462 4:167605018-167605040 ATGTCTCTCAATATCTGTGTGGG + Intergenic
983628988 4:169830078-169830100 ATCTCCCACTATGATTGTGTGGG - Intergenic
985220492 4:187698374-187698396 ATGTCACTCTATGAATTTTTAGG + Intergenic
988485383 5:31664413-31664435 GTGTCTGTGTATGAGTGTGATGG - Intronic
989115086 5:37944831-37944853 CTCTCTCTCTGTGTGTGTGTAGG - Intergenic
990568771 5:57056753-57056775 ATGTTTCTCTATTTTTGTGTAGG - Intergenic
992936754 5:81715129-81715151 GTCTGTCTCTGTGAGTGTGTGGG - Intronic
993215402 5:85016444-85016466 AAGTCTCTCTATTAGTTTGCTGG + Intergenic
994333981 5:98542199-98542221 ATTTCTCACTATCATTGTGTGGG - Intergenic
994802535 5:104397308-104397330 GTCTCTCACTATGATTGTGTGGG - Intergenic
995120134 5:108527377-108527399 ATGTCTCTCCATGTGTTTATTGG + Intergenic
995353654 5:111212377-111212399 CTCTCTCTCTGTGTGTGTGTTGG + Intergenic
996225528 5:120989506-120989528 GTGTGTGTGTATGAGTGTGTTGG - Intergenic
998523599 5:142822437-142822459 TTAACTCTCTGTGAGTGTGTTGG + Intronic
998858709 5:146422195-146422217 ATGTCTCTGTAAGGGTGTTTTGG + Intergenic
999819560 5:155212534-155212556 ATGTATGTGTATGTGTGTGTAGG + Intergenic
999911394 5:156204461-156204483 GTGTGTGTGTATGAGTGTGTTGG - Intronic
1000367496 5:160505191-160505213 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1000422170 5:161050705-161050727 ATGTATCTATATGTGTGTATGGG + Intergenic
1000749041 5:165072235-165072257 ATCTCTCACTATTATTGTGTGGG + Intergenic
1001226444 5:169948507-169948529 ATGTGTTTCTATGTGTGTGTAGG - Intronic
1002025901 5:176396157-176396179 ATGTCTCTTGGTGGGTGTGTGGG - Intronic
1002261403 5:177996053-177996075 CTGTCTCTGAATGTGTGTGTAGG + Exonic
1005948344 6:30611904-30611926 GTGTCTGTCTCTGTGTGTGTAGG - Intronic
1007910681 6:45511249-45511271 ATGTATCTCTAGGAGTTTCTTGG - Intronic
1009643753 6:66371008-66371030 ATCTCCCACTATGATTGTGTAGG + Intergenic
1010660578 6:78566431-78566453 AAGTGTCTCTAGGAATGTGTGGG + Intergenic
1011815877 6:91189828-91189850 ATCTCTCACTATTATTGTGTGGG + Intergenic
1013251233 6:108335418-108335440 ATGTATCTGTGTGAGAGTGTAGG + Intronic
1016398175 6:143648756-143648778 GTGTGTCTCTGTGTGTGTGTGGG + Intronic
1017276152 6:152571071-152571093 ATATCTCTGTATTACTGTGTAGG - Intronic
1017762509 6:157581524-157581546 ATCTCTCACTATTATTGTGTGGG + Intronic
1019129426 6:169862822-169862844 GTGTCTGTGTGTGAGTGTGTGGG + Intergenic
1020557301 7:9686455-9686477 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1021219329 7:17957515-17957537 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1022529931 7:31060613-31060635 ATGTCTCTCTTTGTCTCTGTAGG + Intronic
1023731608 7:43197320-43197342 GTTTCTCTGTGTGAGTGTGTGGG - Intronic
1023864928 7:44234069-44234091 ATGTCTCTCCAGGAGTGTTCAGG - Intronic
1024158003 7:46646215-46646237 CTCTCTCTCTCTGTGTGTGTGGG - Intergenic
1024659269 7:51477633-51477655 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1026123114 7:67554789-67554811 ATGTATTTCTGTGTGTGTGTGGG + Intergenic
1026928286 7:74208803-74208825 GTGTCTCTCTGTGTGTGTCTTGG + Intronic
1027637349 7:80691525-80691547 AAGTCTCCCTATTATTGTGTGGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027906478 7:84190514-84190536 ATGTATGTGTGTGAGTGTGTGGG + Intronic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1029019867 7:97353245-97353267 ATGTATGTGTATGTGTGTGTTGG - Intergenic
1029311048 7:99665157-99665179 ATTTCTCTCAATAAGTATGTGGG - Exonic
1030935121 7:115576180-115576202 ATGCATCTCTCTGAGTGTGAGGG + Intergenic
1031898284 7:127379858-127379880 CTCTCTCTCTGTGTGTGTGTGGG - Intronic
1032707475 7:134433684-134433706 ATTTCTTTCTATGTGTGTATGGG - Intergenic
1035336399 7:158130456-158130478 ATGTGTGTATATGAGTGTGTTGG - Intronic
1035336459 7:158131730-158131752 ATGTGTGTGTATGAGTGTGTTGG - Intronic
1035336498 7:158132654-158132676 CTGTGTGTATATGAGTGTGTAGG - Intronic
1035877424 8:3206604-3206626 ATGTGTGTGTATGTGTGTGTGGG + Intronic
1037616192 8:20520971-20520993 GTGTGTCTCTATGTGTGTCTAGG - Intergenic
1037992760 8:23332434-23332456 GTGTGTCTGTAGGAGTGTGTGGG - Intronic
1039811838 8:41056097-41056119 CTGTCTCTCTCTGTGTGTATGGG - Intergenic
1040766685 8:50919506-50919528 ATCTCTCACTATTATTGTGTGGG - Intergenic
1040940901 8:52832224-52832246 ATTTCTTTTCATGAGTGTGTTGG + Intergenic
1041889587 8:62854306-62854328 ATCTCTCACTATTATTGTGTGGG + Intronic
1041957394 8:63571153-63571175 ATCTCTCTGTATCAGTGTGCAGG + Intergenic
1042758553 8:72245586-72245608 CTCTCTCTCTCTGTGTGTGTAGG - Intergenic
1043661194 8:82744268-82744290 GTATGTCTCTATGTGTGTGTGGG - Intergenic
1044886196 8:96780883-96780905 ATGTATATGTATGTGTGTGTCGG + Intronic
1045325409 8:101114201-101114223 ATGTGTGCCTATGTGTGTGTTGG + Intergenic
1045914418 8:107449377-107449399 ATGTGTGTGTGTGAGTGTGTGGG - Intronic
1046312607 8:112458214-112458236 CTGTTTCTCTGTGTGTGTGTGGG - Intronic
1047822971 8:128541605-128541627 ATGTGTGTCTATCAGTGTGTAGG + Intergenic
1048615685 8:136073296-136073318 TTGTCTTTCAATGAGTGTGATGG - Intergenic
1048878692 8:138856254-138856276 ATGTCTCTGCATGTGTGTGCAGG + Intronic
1049130742 8:140838330-140838352 AGCTCTCTCAAGGAGTGTGTTGG - Intronic
1049135154 8:140891395-140891417 ATGTTTCTCGATGGGTGTTTAGG - Intronic
1049305520 8:141900807-141900829 GTGTCTATGTGTGAGTGTGTGGG + Intergenic
1049525580 8:143125096-143125118 ATGTGTGTACATGAGTGTGTGGG - Intergenic
1050631317 9:7561616-7561638 GTGTCTGTATCTGAGTGTGTTGG - Intergenic
1052133650 9:24883363-24883385 ATGTGTTTCTGTAAGTGTGTGGG + Intergenic
1052724990 9:32218137-32218159 ATGTCTCAATAAGAGTGTGGTGG - Intergenic
1056920666 9:90785641-90785663 CTCTCTCTCTTTGTGTGTGTGGG - Intergenic
1056974014 9:91234025-91234047 AAGTCTCTCTCTGAGCTTGTTGG - Intronic
1058099724 9:100905676-100905698 TTCTCTCTCTCTGTGTGTGTGGG + Intergenic
1058335075 9:103817614-103817636 ATGTCACTGAATCAGTGTGTTGG + Intergenic
1058836552 9:108862847-108862869 ATTTCTCTCTGTTGGTGTGTGGG - Exonic
1059060492 9:111030958-111030980 ATGTATATTTATGTGTGTGTGGG - Intronic
1060162756 9:121381189-121381211 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1060780155 9:126405947-126405969 ATATCTATCTCTGTGTGTGTAGG - Intronic
1061663918 9:132149098-132149120 TTGTCTCACTATGTGTGTGAGGG + Intergenic
1186482374 X:9905737-9905759 ATGGCTGTGTATGTGTGTGTGGG + Intronic
1186694531 X:12016197-12016219 ATTTCTCTCTAGGGGTGTCTTGG - Intergenic
1188365086 X:29305920-29305942 GTGTATGTATATGAGTGTGTTGG + Intronic
1188712444 X:33416786-33416808 ATGACTCTGTATGAGTTTCTTGG - Intergenic
1188977015 X:36688240-36688262 GTAACTGTCTATGAGTGTGTGGG + Intergenic
1189067538 X:37826577-37826599 GTGTCTCTGTGTGTGTGTGTTGG - Intronic
1189589404 X:42495724-42495746 ATGTGTCTGTATGTGTGTCTGGG + Intergenic
1190708984 X:53051745-53051767 TTGTATGTGTATGAGTGTGTGGG + Intronic
1191110113 X:56797868-56797890 ATGTATCTCCATGTGTGTATGGG - Intergenic
1192005308 X:67205501-67205523 ATGTTTGTGTATGTGTGTGTGGG + Intergenic
1192154646 X:68734895-68734917 ATGCCTCACACTGAGTGTGTTGG - Intergenic
1193048137 X:77074719-77074741 ATCTCTCACTATTATTGTGTAGG + Intergenic
1194132877 X:90104086-90104108 AAGTCTCACTATTATTGTGTGGG + Intergenic
1194330470 X:92578376-92578398 ATCTCTCACTATTATTGTGTGGG + Intronic
1194455585 X:94099083-94099105 AAATCTCTCTATGAGTCTGATGG + Intergenic
1195127183 X:101820201-101820223 GTCTCTCACTATTAGTGTGTGGG + Intergenic
1195474172 X:105265166-105265188 TTGTCTTTGAATGAGTGTGTGGG + Intronic
1196298287 X:114024555-114024577 ATGTCTCTCCCTTGGTGTGTAGG - Intergenic
1196474073 X:116061926-116061948 AAGTCTCTCTATGAAAGTCTGGG - Intergenic
1196592093 X:117497376-117497398 GTCTCTCTCTATTATTGTGTGGG - Intergenic
1199135869 X:144252039-144252061 ATTTCCTTCTATGAGTGCGTGGG - Intergenic
1199248485 X:145632729-145632751 CTCTCTCTCTCTGTGTGTGTGGG - Intergenic
1199682653 X:150237998-150238020 ATGTATGTGTATGTGTGTGTAGG - Intergenic
1199782886 X:151079630-151079652 GTGTGTGTGTATGAGTGTGTTGG + Intergenic
1199845393 X:151689034-151689056 CTCTCTCTCTGTGTGTGTGTGGG - Intergenic
1200478665 Y:3674166-3674188 AAGTCTCACTATTATTGTGTGGG + Intergenic
1200639174 Y:5697446-5697468 ATCTCTCACTATTATTGTGTGGG + Intronic
1200869161 Y:8078471-8078493 ATGAATCTCTATGAGCATGTAGG - Intergenic