ID: 964530546

View in Genome Browser
Species Human (GRCh38)
Location 3:157663160-157663182
Sequence ATGCATTTATTTATGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1987
Summary {0: 1, 1: 0, 2: 17, 3: 253, 4: 1716}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964530546_964530552 18 Left 964530546 3:157663160-157663182 CCCTGTTTCATAAATAAATGCAT 0: 1
1: 0
2: 17
3: 253
4: 1716
Right 964530552 3:157663201-157663223 CCTCAGTGAAGACAAAGAGTTGG 0: 1
1: 1
2: 1
3: 19
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964530546 Original CRISPR ATGCATTTATTTATGAAACA GGG (reversed) Intronic
900734214 1:4285146-4285168 ATTTATTTATTTTTGAGACAGGG - Intergenic
900838201 1:5023358-5023380 ATTTATTTATTTTTGAGACAGGG - Intergenic
900846299 1:5104678-5104700 ATTTATTTATTTTTGAGACAGGG + Intergenic
901023135 1:6265109-6265131 ATGCACTTGATAATGAAACATGG + Intronic
901286618 1:8084812-8084834 ATGTATTTATTTTTGAGACAGGG + Intergenic
901292723 1:8136794-8136816 ATTTATTTATTTTTGAGACAGGG - Intergenic
901414997 1:9110514-9110536 ATTTATTTATTTTTGAGACAGGG - Intronic
901518655 1:9766651-9766673 ATCTATTTATTTTTGAGACAGGG - Intronic
901559214 1:10056831-10056853 ATTCATTTATTCATGAGACAAGG + Intronic
901606836 1:10465701-10465723 ATTTATTTATTTTTGAGACAGGG + Intronic
901861071 1:12074793-12074815 GTTTATTTATTTATGAGACAGGG + Intronic
902188952 1:14747280-14747302 ATTTATTTATTTTTGAGACAGGG + Intronic
902236186 1:15059013-15059035 ATTTATTTATTTTTGAGACAGGG - Intronic
902310118 1:15575761-15575783 ATTTATTTATTTTTGAGACAGGG + Intronic
902310970 1:15581340-15581362 ATTTATTTATTTTTGAGACACGG - Intronic
902352694 1:15869602-15869624 ATTTATTTATTTATGAGACAGGG + Intronic
902819294 1:18933749-18933771 ATTTATTTATTTTTGAGACAGGG - Intronic
902829592 1:19003077-19003099 AGACATTTATTAATGAAAAAGGG + Intergenic
902901949 1:19523568-19523590 ATTTATTTATTTTTGAGACAGGG - Intergenic
903055007 1:20629823-20629845 ATTTATTTATTTATGAGACAGGG - Intergenic
903079479 1:20797691-20797713 ATTTATTTTTTTATGAGACAGGG - Intergenic
903099930 1:21020481-21020503 ATTTATTTATTTTTGAGACAGGG - Intronic
903136473 1:21312608-21312630 ATTTATTTATTTAAGAGACAGGG - Intronic
903425189 1:23248218-23248240 ATTTATTTATTTTTGAGACAGGG - Intergenic
903436456 1:23353602-23353624 ATGTATTTATTTTTAATACAGGG + Intergenic
903439909 1:23379899-23379921 ATTTATTTATTTTTGAGACAGGG - Intergenic
903606634 1:24579720-24579742 ATTTATTTATTTTTGAAACAAGG - Intronic
903796854 1:25935755-25935777 ATTCATTTATTTTTGAGGCAGGG + Intergenic
903797056 1:25937350-25937372 ATTTATTTATTTTTGAGACAGGG + Intergenic
903922684 1:26812162-26812184 ATGTATTTATTTTTGAGATAGGG + Intergenic
903936412 1:26898124-26898146 ATTTATTTATTTTTGAGACAGGG - Intronic
904058512 1:27687874-27687896 GAGCATGCATTTATGAAACAGGG + Intergenic
904150704 1:28437233-28437255 ATTTATTTATTTTTGAGACAGGG + Intronic
904157919 1:28500282-28500304 ATGCAATTATTTATTTTACAAGG - Exonic
904161424 1:28524825-28524847 TTGTATTTATTTTTGAGACAGGG - Intronic
904174290 1:28615096-28615118 ATTTATTTATTTTTGAGACAAGG - Intronic
904184886 1:28696072-28696094 ATTTATTTATTTTTGAGACAGGG + Intronic
904210087 1:28881393-28881415 TTGTATTTATTTTTGAGACAGGG + Intergenic
904520830 1:31094480-31094502 ATTTATTTATTTTTGAGACAGGG - Intergenic
904552219 1:31328499-31328521 ATTTATTTATTTTTGAGACAGGG - Intronic
904925060 1:34041116-34041138 ATTTATTTATTTTTGAGACAGGG - Intronic
905216780 1:36414215-36414237 TTTTATTTATTTTTGAAACAAGG - Intergenic
905220758 1:36445719-36445741 ATTTATTTATTTTTGAGACAGGG + Intronic
905359591 1:37410321-37410343 GTTCATTTATTTATAACACAGGG - Intergenic
905687747 1:39920934-39920956 ATTTATTTATTTTTGAGACAAGG - Intergenic
905738308 1:40347048-40347070 ATTTATTTATTTTTGAGACACGG + Intronic
905749819 1:40452116-40452138 ATTTATTTATTTTTGAGACAAGG - Intronic
905757433 1:40523020-40523042 ATTTATTTATTTTTGAGACATGG + Intergenic
906010278 1:42517088-42517110 TTTTATTTATTTATGACACAGGG + Intronic
906207436 1:43994743-43994765 AGGTATTTATTTTTGAAACAGGG - Intronic
906420025 1:45657840-45657862 ACTCATTTATTTTTGAGACAGGG - Intronic
906611405 1:47206309-47206331 ATTTATTTATTTTTGAGACAGGG - Intergenic
906649310 1:47501296-47501318 ATTTATTTATTTTTGAGACAAGG + Intergenic
906765846 1:48432101-48432123 ATTTATTTATTTTTGAGACAAGG - Intronic
906769171 1:48468962-48468984 ATGTATTTATTTAAGAGACAGGG + Intronic
907119557 1:51996336-51996358 ATTTATTTATTTTTGAGACAGGG - Intergenic
907123644 1:52030297-52030319 ATTTATTTATTTTTGAGACAAGG - Intronic
907145596 1:52228083-52228105 ATTTATTTATTTTTGAGACAGGG + Intronic
907184200 1:52597253-52597275 ATTTATTTATTTTTGAGACAGGG + Intergenic
907220184 1:52901149-52901171 ATTTATTTATTTTTGAGACAGGG - Intronic
907421529 1:54350840-54350862 ATGCTTTTTTTTTTGAGACAGGG + Intronic
907529040 1:55074625-55074647 ATTTATTTATTTTTGAGACAGGG - Intronic
907709778 1:56868609-56868631 ATTTATTTATTTATGAGACAGGG - Intronic
907920773 1:58909773-58909795 ATAAACTTGTTTATGAAACATGG + Intergenic
908320443 1:62973119-62973141 ATTTATTTATTTATGAGACAGGG + Intergenic
908381369 1:63599780-63599802 ATTTATTTATTTTTGAGACAGGG - Intronic
908449751 1:64240766-64240788 ATTTATTTATTTTTGAGACAGGG + Intronic
908653678 1:66364391-66364413 ATGCATTAATCTATGAAGGAAGG - Intronic
909023184 1:70454609-70454631 ATGCATTTGATTTTGAGACAAGG + Intergenic
909903112 1:81161833-81161855 ATTTATTTATTTTTGAGACAGGG - Intergenic
909987549 1:82181403-82181425 ATTCATTTATTTTTGAGACAAGG + Intergenic
910012956 1:82487666-82487688 ATTTATTTATTTTTGAGACAGGG - Intergenic
910017391 1:82543798-82543820 ATGCATTTAAATAGGAAAGAAGG + Intergenic
910356434 1:86362304-86362326 ATTAATTTATTTTTGAAACAGGG + Intronic
910617138 1:89210974-89210996 AAACAGTTATTTATGAAACAAGG + Intergenic
910658765 1:89647239-89647261 ATGCTATTATGTATCAAACATGG + Intronic
910664121 1:89705770-89705792 ATTTATTTATTTTTGAGACAGGG - Intronic
910711708 1:90188745-90188767 ATTTATTTATTTTTGAGACAGGG + Intergenic
910869948 1:91824121-91824143 ATATATTTATTTTTGAGACAGGG - Intronic
910879594 1:91910996-91911018 ATTTATTTATTTTTGAGACAGGG + Intergenic
910939971 1:92522762-92522784 ATTCATTCATTTATGAGACAGGG + Intronic
911030492 1:93482153-93482175 ATTTATTTATTTTTGAGACAGGG - Intronic
911119989 1:94286659-94286681 ATTTATTTATTTTTGAGACAGGG - Intergenic
911271692 1:95809391-95809413 ACTCATTCATTGATGAAACAAGG + Intergenic
911356112 1:96822878-96822900 AAACATTTTTTCATGAAACATGG + Intronic
911457839 1:98149638-98149660 ATGCATTTATATCTCAAAAAAGG - Intergenic
911457901 1:98150465-98150487 ATGCATTTATATCTCAAAAAAGG + Intergenic
911517358 1:98882715-98882737 ATGTATTTGTTTAAGAAATAGGG + Intergenic
911564252 1:99443894-99443916 ATTTATTTATTTTTGAAACTGGG + Intergenic
911726678 1:101248716-101248738 ATGTATTTATTAAGGAGACAGGG + Intergenic
911926795 1:103842879-103842901 ATGTATTTATTTTTGATACAGGG - Intergenic
912187979 1:107303512-107303534 ATAAATCTATTCATGAAACAAGG - Intronic
912335787 1:108861337-108861359 ATTTATTTATTTTTGAGACAGGG + Intronic
912396033 1:109344700-109344722 TTATATTTATTTATGAGACAGGG + Intronic
912666920 1:111589716-111589738 ATTAATTTATTTTTGCAACAGGG + Intronic
912721830 1:112026745-112026767 ATTCATTTATTTCTCTAACAAGG - Intergenic
912808594 1:112775857-112775879 ATTTATTTATTTTTGAGACAGGG - Intergenic
912909977 1:113748539-113748561 ATGTGTTTATTTTTGAGACAGGG + Intronic
913023671 1:114812583-114812605 ATGCATTTATTTTGGAAAGTAGG + Intergenic
913048464 1:115093821-115093843 ATTTATTTATTTTTGAGACATGG - Intergenic
913134631 1:115876212-115876234 ATTTATTTATTTTTGCAACAAGG - Intergenic
913554459 1:119951153-119951175 ATTTATTTATTTTTGAGACAGGG + Intronic
914023202 1:143887299-143887321 ATTTATTTATTTTTGAGACAGGG - Intergenic
914405326 1:147365030-147365052 ATTTATTTATTTATTAGACATGG - Intergenic
914481053 1:148066084-148066106 ATTTATTTATTTTTGAGACAGGG + Intergenic
914661688 1:149795241-149795263 ATTTATTTATTTTTGAGACAGGG - Intronic
914693248 1:150050185-150050207 ATGCTTTTTTTTTTGAGACAGGG - Intergenic
914712898 1:150231576-150231598 ATTTATTTATTTTTGAGACAGGG - Intronic
914944850 1:152054996-152055018 ATTTATTTATTTTTGAGACAGGG + Intergenic
914976716 1:152371223-152371245 ATTTATTTATTTTTGAGACAGGG - Intergenic
915110201 1:153559483-153559505 ATTAATTTATTTTTGAGACAGGG - Intergenic
915155785 1:153874878-153874900 ATTTATTTATTTTTGAAACAGGG + Intronic
915485223 1:156215693-156215715 ATTTATTTATTTATGAGACAGGG + Intronic
915679334 1:157565024-157565046 ATGTATTTATTTTTGAGACGGGG - Intergenic
915870429 1:159554320-159554342 AGGTATTTATATATGTAACAGGG - Intergenic
916403803 1:164477039-164477061 ATGCATTTCTTTGTCAAGCAAGG + Intergenic
916542925 1:165774458-165774480 CTGTATTTATTTTTGAGACAGGG + Intronic
916547554 1:165820133-165820155 ATACTTTTATTTTTGAGACAGGG - Intronic
916858593 1:168778193-168778215 ATTTATTTATTTATGAAATAGGG - Intergenic
917027808 1:170661758-170661780 ATGCATTTAATTAAGGAACTGGG - Intergenic
917272134 1:173288427-173288449 ATTTATTTATTTTTGAGACAGGG - Intergenic
917303046 1:173598894-173598916 ATTCCTTTATTTTTGAAAAATGG - Intronic
917326830 1:173841790-173841812 ATGTATTTATTTTTGAGACACGG - Intronic
917348273 1:174051269-174051291 ATTTATTTATTTTTGAGACAGGG - Intergenic
917473512 1:175347432-175347454 ATTTATTTATTTTTGAGACAGGG + Intronic
918213114 1:182369263-182369285 ATTTATTTATTTATTAGACATGG + Intergenic
918312959 1:183299494-183299516 ATGATTTTATTTATATAACATGG + Intronic
918331052 1:183460891-183460913 ATTTATTTATTTATGAGATAGGG + Intergenic
918768854 1:188525942-188525964 ATGCATTTTTAAATGAAAAATGG + Intergenic
918793645 1:188863251-188863273 ATTTATTTATTTTTGAGACAGGG + Intergenic
918803459 1:189004913-189004935 ATTCATTTATTTATTAAATATGG + Intergenic
918876703 1:190055541-190055563 ACTCTTTTATCTATGAAACAGGG + Intergenic
919042285 1:192405470-192405492 ATACCTTTATTTATTATACATGG - Intergenic
919069157 1:192732063-192732085 ATTTATTTATTTTTGAGACAGGG - Intergenic
919111348 1:193222861-193222883 ATGGAATCATTTAAGAAACATGG - Intronic
919367421 1:196680749-196680771 AAACATGTATTTATGAATCATGG - Intronic
919528705 1:198687522-198687544 ATGCCTTTATATATGAAACAAGG - Intronic
919601665 1:199630797-199630819 CTACATTTATTTATGCAGCAGGG - Intergenic
919792823 1:201303188-201303210 ATGTATTTATTTTAGAGACAGGG + Intronic
919841584 1:201613244-201613266 ATGTATTTATTTTGGAAACTTGG + Intergenic
920118065 1:203635273-203635295 CCCCATTTATTTTTGAAACAGGG + Intronic
920129126 1:203717646-203717668 ATTTATTTATTTATGAGACGGGG + Intronic
920797176 1:209150711-209150733 ATGCATTCAGTTATAAAATAGGG - Intergenic
921015416 1:211186039-211186061 ACTTATTTATTTATAAAACAGGG + Intergenic
921204709 1:212838706-212838728 ATTTATTTATTTTTGAGACAGGG + Intronic
921567591 1:216738843-216738865 ATTTATTTACTTATGAGACAGGG + Intronic
921639421 1:217534207-217534229 ATTTATTTATTTTTGAGACAGGG - Intronic
921730977 1:218577609-218577631 ATGTATATATTTTTGAGACACGG + Intergenic
921836464 1:219783591-219783613 ATTTATTTATTTTTGAGACAGGG - Intronic
921869279 1:220121078-220121100 ATTCATATACTTATGTAACAAGG + Intronic
922146222 1:222947921-222947943 ATGAATTTATTTCTAAATCATGG - Intronic
922181835 1:223241946-223241968 ATGTATGTATGTATGAGACAGGG + Intronic
922223146 1:223624082-223624104 ATTTATTTATTTTTGAGACAGGG + Intronic
922278745 1:224102420-224102442 ATTTATTTATTTTTGAGACAGGG - Intergenic
922303845 1:224327132-224327154 ATGTATTTATTTTTGAGATAAGG - Intronic
922369985 1:224900231-224900253 ATTTATTTATTTATGAGACAAGG - Intronic
922442318 1:225666046-225666068 ATTTATTTATTTTTGAGACAGGG + Intergenic
922491765 1:226023110-226023132 ATTTATTTATTTATTAACCATGG - Intergenic
922713976 1:227856556-227856578 ATTTATTTATTTTTGAGACAGGG - Intergenic
922912408 1:229228691-229228713 ATTTATTTATTTTTGAGACAGGG - Intergenic
922936806 1:229429352-229429374 ATTTATTTATTTTTGAAACAGGG + Intergenic
923290139 1:232537228-232537250 ATTTATTTATTTTTGAGACAGGG - Intronic
923374904 1:233351893-233351915 ATTTATTTAGTTTTGAAACAGGG + Intronic
923392479 1:233527506-233527528 ATGCCATAATTTATAAAACAAGG + Intergenic
923665779 1:235997298-235997320 ATTCATTGAGGTATGAAACATGG - Intronic
923675860 1:236080419-236080441 ATTTATTTATTTTTGAGACAGGG - Intergenic
923714970 1:236417107-236417129 ATTTATTTATTTTTGAGACAGGG - Intronic
923903704 1:238358963-238358985 ATGCAATGATTTATGATAGATGG - Intergenic
923928371 1:238662232-238662254 ATTTATTTATTTATTAAAGACGG - Intergenic
924021777 1:239791109-239791131 ATTCATTTATTTTTGAGACAGGG + Intronic
924097134 1:240564199-240564221 ATTTATTTATTTTTGAGACAGGG - Intronic
924115238 1:240738722-240738744 ATTTATTTATTTTTGAGACAGGG - Intergenic
924252309 1:242144772-242144794 ATTTATTTATTTTTGAGACAGGG - Intronic
924365869 1:243292739-243292761 AGCCATGCATTTATGAAACATGG + Intronic
924375945 1:243409098-243409120 ATACATTTGTTTAAAAAACAAGG + Intronic
924504102 1:244664688-244664710 TTGTATTTATTTTTGAGACAGGG - Intronic
924657888 1:245990072-245990094 ATTTATTTATTTTTGAGACAGGG + Intronic
924715768 1:246572230-246572252 ATGTATGTATTTTTGAGACAGGG - Intronic
924870126 1:248033441-248033463 CTTCATTTTTTTTTGAAACAGGG + Intronic
1062881791 10:984923-984945 GTTTATTTATTTATGAGACAGGG - Intergenic
1063001794 10:1931863-1931885 ATTTATTTATTTTTGAGACAGGG + Intergenic
1063093998 10:2893090-2893112 ATTTATTTATTTTTGATACAGGG - Intergenic
1063392867 10:5661501-5661523 ATTTATTTATTTTTGAAACAGGG + Intronic
1063520901 10:6739689-6739711 ATGCATTTATTTATTTGAGATGG - Intergenic
1063578253 10:7281237-7281259 ATTTATTTATTTTTGAGACAGGG - Intronic
1063658835 10:8019296-8019318 ATTTATTTATTTATGAGACAGGG + Intergenic
1063706116 10:8432468-8432490 ATTTATTTATTTAAGAGACAGGG - Intergenic
1063742169 10:8835635-8835657 ATATATTTATTTTTGAGACAAGG - Intergenic
1063925132 10:10970073-10970095 ATTTATTTATTTTTGAGACAGGG + Intergenic
1064024863 10:11839956-11839978 ATTTATTTATTTTTGAGACAAGG + Intronic
1064195721 10:13242627-13242649 ATTTATTTATTTTTGAGACAGGG - Intergenic
1064569232 10:16675024-16675046 ATTTATTTATTTTTGATACAGGG - Intronic
1064682957 10:17830136-17830158 ATTTATTTATTTTTGAGACAGGG + Intronic
1064713719 10:18153586-18153608 ATTTATTTATTTTTGAGACAGGG + Intronic
1064862105 10:19838003-19838025 ATTTATTTATTTTTGAGACAGGG + Intronic
1064960087 10:20954327-20954349 ATACATTTGTTTATTAAATATGG + Intronic
1064992960 10:21272580-21272602 ATGTATTTATTTATTTGACATGG - Intergenic
1065345413 10:24743520-24743542 ATGTATATCTTTATAAAACAAGG + Intergenic
1065507448 10:26443552-26443574 ATTCATTCATTTTTGAGACAGGG + Intronic
1065653329 10:27917524-27917546 AGGCAGATATTAATGAAACAGGG + Intronic
1065763593 10:29006440-29006462 ATGTATTTATTTTTGAGACAGGG - Intergenic
1065766632 10:29036465-29036487 ATTTATTTGTTTATCAAACAGGG - Intergenic
1065769049 10:29059774-29059796 ATTTATTTATTTTTGAGACAAGG + Intergenic
1065880196 10:30031132-30031154 ATATATTTATTTTTGAGACAGGG + Intronic
1065904653 10:30239455-30239477 ATGAACTTATTTATGAACCAGGG - Intergenic
1065934364 10:30507763-30507785 ATTTATTTATTTTTGAGACAGGG + Intergenic
1066081556 10:31935591-31935613 ATTTATTTATTTTTGAGACAGGG - Intergenic
1066087901 10:31988926-31988948 ATTTATTTATTTTTGAGACAGGG - Intergenic
1066093375 10:32048872-32048894 ATTTATTTATTTTTGAGACAGGG + Intronic
1066183590 10:32986892-32986914 ATTTATTTATTTTTGAGACAAGG - Intronic
1066401419 10:35080469-35080491 ATTTATTTATTTTTGAGACAGGG + Intronic
1066410195 10:35161141-35161163 ATTTAATTATTTATGAGACAGGG + Intronic
1066431009 10:35351631-35351653 AGGGATATATTTCTGAAACAAGG + Intronic
1066448889 10:35510219-35510241 ATTTATTTATTTGTGAGACAAGG + Intronic
1066661618 10:37742207-37742229 ATTTATTTATTTTTGAGACAGGG + Intergenic
1067385158 10:45812100-45812122 ATTTATTTATTTTTGAGACAGGG - Intergenic
1067419132 10:46131663-46131685 ATGCATTGATTTTTTACACATGG + Intergenic
1067419890 10:46136059-46136081 ATTTATTTATTTTTGAGACAGGG + Intergenic
1067426128 10:46213460-46213482 ATTTATTTATTTTTGAGACAGGG - Intergenic
1067505240 10:46842542-46842564 ATTTATTTATTTTTGAGACAGGG + Intergenic
1067693063 10:48516519-48516541 ATTTATTTATTTTTGAGACAGGG - Intronic
1067811189 10:49428647-49428669 ATGGATTTCCTTATGAAAGATGG - Intergenic
1067936572 10:50617586-50617608 ATTTATTTATTTATGAGACAGGG + Intronic
1068153059 10:53159065-53159087 ATGCAAATTTTTATGAATCATGG + Intergenic
1068231513 10:54173573-54173595 AGGAATTTATTTATGAGTCATGG - Intronic
1068283046 10:54901271-54901293 ATTTATTTATTTTTGAGACAGGG - Intronic
1068304996 10:55197406-55197428 ATGCAATTCTGTATGAATCATGG + Intronic
1068574761 10:58672717-58672739 GAGCATTCATTTATAAAACAAGG - Intronic
1068692714 10:59933604-59933626 ATATATTTATTTTTGAGACAGGG + Intergenic
1068740691 10:60466119-60466141 ATGGGTCTATTTATGAAAAACGG + Intronic
1068759239 10:60689390-60689412 ATCTATTTATTTTTGAGACAGGG - Intronic
1068799059 10:61118666-61118688 ATTTATTTATTTTTGAGACAGGG - Intergenic
1068843049 10:61637741-61637763 ATTCAGTCATTTGTGAAACATGG - Intergenic
1068891222 10:62150032-62150054 ATGTATTTATTTATAAAATTTGG + Intergenic
1069204460 10:65664022-65664044 ATTTATTTATTTTTGAGACAGGG - Intergenic
1069230482 10:66003210-66003232 TTGCATTTGCTTATGAAACAAGG + Intronic
1069282190 10:66668803-66668825 ATTTATTTATTTTTGAGACAGGG - Intronic
1069312761 10:67059232-67059254 ATGTATTTATTTTTGGAAAATGG - Intronic
1069434145 10:68365603-68365625 ATGCATACATTTAAGAAAGATGG - Intronic
1069458979 10:68576654-68576676 ATTTATTTATTTTTGAGACAGGG - Intronic
1069606446 10:69741812-69741834 ATGCATTCATTTATCTAACAAGG - Intergenic
1070027280 10:72643971-72643993 ATTTATTTATTTTTGAGACAGGG + Intergenic
1070208947 10:74294860-74294882 ATGTATTTATTTTTGAGACAGGG + Intronic
1070451504 10:76562493-76562515 ATGCATTTTTCTATGTAACATGG - Intergenic
1071037635 10:81266342-81266364 ATTTATTTATTTTTGAGACAGGG + Intergenic
1072040798 10:91604320-91604342 ATGCATTTATATTAAAAACATGG + Intergenic
1072092635 10:92144276-92144298 ATTTATTTACTTATGAGACAGGG + Intronic
1072291191 10:93966716-93966738 ATTTATTTATTTTTGAGACAGGG + Intergenic
1072497660 10:95978369-95978391 ATTTATTTATTTTTGAGACAGGG + Intronic
1072532412 10:96331782-96331804 ATTTATTTATTTCTGAGACAGGG + Intronic
1072643552 10:97233343-97233365 ATTTATTTATTTTTGAGACAGGG - Intronic
1072676186 10:97468077-97468099 ATCCTTTTATGTATGAGACAGGG + Intronic
1072688605 10:97554555-97554577 ATTTATTTATTTATGAGACAGGG + Intronic
1072957491 10:99900288-99900310 ATTCATTTTTTTTTGAGACAGGG + Intronic
1072966182 10:99974779-99974801 TTTTATTTATTTATGAGACAGGG + Intronic
1072985105 10:100132593-100132615 ATTTATTTATTTAAGAGACAGGG - Intergenic
1073088421 10:100911620-100911642 ATTAATTTATTTTTGAGACAGGG + Intergenic
1073160936 10:101394157-101394179 TTGAATTTTTTTATGAAAGAAGG + Intronic
1073308018 10:102518551-102518573 ATTTATTTATTTTTGACACAGGG + Intronic
1073501014 10:103937146-103937168 ATTTATTTATTTTTGAGACAGGG - Intergenic
1073607299 10:104909334-104909356 TTGCATATATTTATCAACCACGG - Intronic
1073843487 10:107525746-107525768 ATTTATTTATTTTTGAGACAGGG + Intergenic
1074343809 10:112660985-112661007 ATTTATTTATTTTTGAGACAGGG + Intronic
1074352262 10:112749126-112749148 ATGCATTAATACATGAACCAAGG + Intronic
1074573501 10:114647000-114647022 ATTTATTTATTTTTGAGACAGGG + Intronic
1074669067 10:115767156-115767178 ACTCATTTATTTATTAAACATGG + Intronic
1074730229 10:116364111-116364133 ATCCATGCATTTATCAAACATGG + Intronic
1075040343 10:119103173-119103195 ATTTATTTATTTTTGAGACAGGG + Intergenic
1075097508 10:119482233-119482255 ATTTATTTATTTTTGAGACAAGG + Intergenic
1075142783 10:119854530-119854552 ATTTATTTATTTTTGAGACAGGG - Intronic
1075145023 10:119875252-119875274 ATTCATTCATTTAAGAGACAGGG + Intronic
1075173062 10:120133883-120133905 ATTTATTTATTTTTGAGACAGGG + Intergenic
1075467935 10:122665414-122665436 ATTCATTCATTTAGGAAATATGG - Intergenic
1075756095 10:124812634-124812656 ATTTATTTATTTTTGAGACAAGG - Intronic
1076017048 10:127035993-127036015 ATTTATTTATTTTTGAGACAGGG - Intronic
1077605323 11:3606642-3606664 ATTTATTTATTTATGAGACAAGG + Intergenic
1077648982 11:3952386-3952408 ATTTATTTATTTATGAGACAGGG - Intronic
1077740149 11:4837212-4837234 ATTTATTTATTTTTGAGACAAGG + Intronic
1077767160 11:5171433-5171455 AAAAATTTATTTCTGAAACAAGG + Intronic
1077803144 11:5561991-5562013 ATGTATTTTTTCATGAAATAGGG + Intronic
1077964583 11:7115129-7115151 ATGTATGTATTCATGAAAAATGG - Intergenic
1078276373 11:9851775-9851797 ATTTATTTATTTATGAGACTGGG + Intronic
1078389673 11:10926117-10926139 ATACATTTTTTTTTGAGACAGGG + Intergenic
1078424319 11:11236991-11237013 CAGCTTTTATTTATGAAGCAAGG + Intergenic
1078598503 11:12710562-12710584 ATTCATTTATTTAATAAAGAGGG + Intronic
1078700960 11:13682434-13682456 ATTCATTTATTTATTATCCATGG + Intronic
1078757320 11:14223355-14223377 ATTTATTTATTTATGAGACAGGG - Intronic
1079139953 11:17801963-17801985 ATGTGTTTTTTTATGAAACAGGG - Intronic
1079662469 11:23056903-23056925 ATTCATTTATTCATTCAACAGGG + Intergenic
1079852302 11:25551082-25551104 ATTCATTTATTTCTCAAATATGG - Intergenic
1079891119 11:26054433-26054455 ATTCAATTATTTTTGAGACAAGG - Intergenic
1079896347 11:26123847-26123869 ATGAATTTCTCTAAGAAACAGGG + Intergenic
1080138731 11:28889689-28889711 ATGCATTTATGAATAAAACATGG - Intergenic
1080431420 11:32203348-32203370 ATTTATTTATTTTTGAGACATGG - Intergenic
1080480416 11:32643074-32643096 ATGGATTTATATATGTAATATGG - Intronic
1080773235 11:35361971-35361993 ATTTATTTATTTTTGAGACAGGG - Intronic
1080814582 11:35741935-35741957 ATTTATTTATTTATGAGACAGGG + Intronic
1080929032 11:36788026-36788048 AAACATTTATTTATTAAAGAAGG + Intergenic
1081092018 11:38883270-38883292 ATTCATCTATTTAGGAAAAATGG - Intergenic
1081211294 11:40337555-40337577 AAGCATTGTTTTATGATACATGG + Intronic
1081213421 11:40363666-40363688 TTGCATGTATTTCTGAGACAAGG + Intronic
1081542145 11:44043074-44043096 ATACGTTTATTTTTGAGACAGGG - Intergenic
1081889087 11:46525292-46525314 ATTTATTTATTTTTGAAACAGGG - Intronic
1081898834 11:46610311-46610333 ACACATGTATTTTTGAAACAGGG - Intronic
1081915472 11:46727770-46727792 ATTTATTTATTTTTGAGACAGGG - Intronic
1082051267 11:47772351-47772373 AACTATTTATTTTTGAAACAGGG + Intergenic
1082089176 11:48075427-48075449 ATTTATTTATTTTTGAGACAGGG + Intronic
1082853235 11:57783929-57783951 ACGTATTTATTTTTGAGACAGGG + Intronic
1083102413 11:60322619-60322641 CAGCATTTATTTATTAAACAGGG - Intergenic
1083330152 11:61893771-61893793 ATGTATTTATTTATTAAAGACGG - Intergenic
1083346199 11:61994512-61994534 ATTTATTTATTTTTGAGACAGGG - Intergenic
1083832923 11:65244498-65244520 ATTTATTTATTTTTGAGACAGGG + Intergenic
1083931484 11:65848561-65848583 ATTTATTTATTTTTGAGACAGGG - Intronic
1083982361 11:66183121-66183143 ATCTATTTATTTTTGAGACAGGG - Intronic
1084052500 11:66609260-66609282 ATTGATTTATTTTTGAGACAGGG - Intergenic
1084140290 11:67223407-67223429 ATTTATTTATTTTTGACACAGGG + Intronic
1084193831 11:67512103-67512125 ATTTATTTATTTTTGAGACAGGG + Intergenic
1084362603 11:68678497-68678519 ATGCATTTAGTTCTGGATCATGG - Intergenic
1084393770 11:68895675-68895697 ATGCAGTTTTTTTTGAGACAGGG + Intronic
1084432330 11:69118029-69118051 ATTTATTTATTTATGAGACAGGG + Intergenic
1084472350 11:69370393-69370415 ATTTATTTATTTATGAGAAAGGG + Intergenic
1084623630 11:70291674-70291696 ATTTATTTATTTTTGAGACAGGG + Intronic
1084637720 11:70403885-70403907 ATTGATTTATGTATGAGACAGGG + Intronic
1084749652 11:71196180-71196202 ATTAATTTATTTTTGAGACAGGG - Intronic
1084759572 11:71260834-71260856 ATTTATTTATTTTTGAGACAGGG - Intergenic
1084849338 11:71926259-71926281 ATTTATTTATTTTTGAGACAGGG - Intronic
1085055834 11:73403238-73403260 ATGCATTTTTTTTCAAAACATGG + Intronic
1085148823 11:74231062-74231084 ATTTATTTATTTAGGAGACAAGG + Intronic
1085352682 11:75810027-75810049 ATTTATTTATTTTTGAGACAGGG - Intergenic
1085373513 11:76035908-76035930 ATGTATTTACTCATGAGACAAGG - Intronic
1085564821 11:77503843-77503865 ATTAATTTATTTTTGAGACAAGG - Intergenic
1085620984 11:78037811-78037833 ATTTATTTATTTTTGAAACAGGG - Intronic
1085672349 11:78479903-78479925 ATTTATTTATTTATGAGACAAGG + Intronic
1085673385 11:78490753-78490775 ATTCTTTTTTTTTTGAAACAGGG - Intronic
1086151283 11:83613510-83613532 AGTTATTTATTTTTGAAACAGGG + Intronic
1086196768 11:84149744-84149766 ATTCATTTATTTATTTAAGATGG + Intronic
1086788418 11:91002543-91002565 ATGCATTTATTTATTAGAGATGG - Intergenic
1087266745 11:96069668-96069690 ATTCATTTATTTTTGAGATAGGG - Intronic
1087478424 11:98667364-98667386 ATTCATTTATTTTTGAGACAGGG - Intergenic
1087533336 11:99411511-99411533 ATTTATTTATTTTTGAGACAAGG - Intronic
1087533692 11:99416282-99416304 ATGCCTTTTTTTTTGAGACAAGG + Intronic
1087587805 11:100144138-100144160 TTGAATTGGTTTATGAAACATGG - Intronic
1087641253 11:100756389-100756411 ATATATTTATTTTTGAGACAGGG - Intronic
1087735306 11:101826287-101826309 ATTTATTTATTTTTGAGACAGGG - Intronic
1087820927 11:102710953-102710975 ATTTATTTATTTTTGAGACAGGG - Intergenic
1088266997 11:107997440-107997462 ATTTATTTATTTTGGAAACAGGG + Intergenic
1088403969 11:109451470-109451492 TTGCATTTATTTATTTAAGATGG + Intergenic
1088463835 11:110112203-110112225 ATACATATATTTTTGAGACAGGG + Intronic
1088555786 11:111059277-111059299 ATTTATTTATTTATGACACAGGG - Intergenic
1088694750 11:112357188-112357210 ATTCATTAATTTAGTAAACATGG - Intergenic
1089157287 11:116412189-116412211 ATTTATTTATTTTTGAGACAGGG - Intergenic
1089239837 11:117067975-117067997 ATTTATTTATTTTTGAGACAGGG - Intronic
1089268064 11:117281144-117281166 TTGCATTTTTTTAAGAGACAGGG + Intronic
1089371787 11:117965724-117965746 ATTTATTTATTTTTGAGACAAGG + Intergenic
1089446374 11:118556027-118556049 ATTAATTTATTTTTGAGACAGGG + Intronic
1089544209 11:119210368-119210390 ATTTATTTGTTTTTGAAACAGGG - Intronic
1089950402 11:122520238-122520260 ATTTATTTATTTTTGAGACAAGG - Intergenic
1090005387 11:122997824-122997846 ATTTATTTATTTATGAGACAGGG - Intergenic
1090038247 11:123267411-123267433 ATGCATTTTTTAAAGCAACAAGG - Intergenic
1090236607 11:125152857-125152879 ATTTATTTATTTTTGAGACAGGG + Intergenic
1090278299 11:125434953-125434975 ATTTATTTATTTTTGAGACAGGG + Intergenic
1090340999 11:126020133-126020155 AAGCATTGACTTATGAAAAAGGG - Intronic
1090516059 11:127428326-127428348 ATGCATTTATCTTTGAAGGATGG + Intergenic
1090593676 11:128297616-128297638 ATGCAAGTATTTATGCAAGATGG + Intergenic
1090819579 11:130329279-130329301 ATTTATTTATTTTTGAGACAGGG + Intergenic
1090865806 11:130699459-130699481 AATCTTTTATTTTTGAAACAGGG - Intronic
1090967022 11:131607672-131607694 ATGCTTTTGTCTATAAAACAAGG + Intronic
1091436408 12:476602-476624 ATTTATTTATTTATGAGGCAGGG - Intronic
1091553687 12:1555776-1555798 ATGTATTTATTTTTGAGACAGGG + Intronic
1091568599 12:1664866-1664888 ATTCATTTATTTTTGAAACAGGG - Intergenic
1091871248 12:3893091-3893113 ATTTATTTATTTTTGAGACAAGG + Intergenic
1092039193 12:5368539-5368561 ATTTATTTATTTTAGAAACAGGG - Intergenic
1092267123 12:6990179-6990201 ATTTATTTATTTTTGAGACAGGG - Intronic
1092343501 12:7696406-7696428 ATTTATTTATTTTTGAGACAGGG + Intergenic
1092353985 12:7779373-7779395 ATCTATTTATTTTTGAGACAAGG + Intergenic
1092427152 12:8384130-8384152 ATTTATTTATTTTTGAAACAGGG + Intergenic
1092630941 12:10376821-10376843 ATTTATTTATTTATGAGACAGGG + Intronic
1092814618 12:12301998-12302020 ATTTATTTATTTTTGAGACAGGG - Intergenic
1092870094 12:12798496-12798518 ATTTATTTATTTTTGAGACAGGG - Intronic
1093127089 12:15343678-15343700 ATATATTTATTTTTGAGACAGGG - Intronic
1093343423 12:18008033-18008055 TTGCATTTATTTATTTATCAAGG - Intergenic
1093442850 12:19219643-19219665 ATGCCTTTATTTTTAAAATATGG + Intronic
1093583811 12:20813250-20813272 ATGCATTAATTTACTCAACAAGG - Intronic
1093660987 12:21756585-21756607 ATTCATATATTTATCAAGCAAGG + Intronic
1093819292 12:23593070-23593092 ATTTATTTATTTTTGAGACAGGG - Intronic
1094016080 12:25866036-25866058 ATTTATCTATTTTTGAAACAGGG - Intergenic
1094084304 12:26573029-26573051 ATTTATTTATTTTAGAAACAGGG + Intronic
1094109313 12:26844352-26844374 ATTAATTTATTTTTGAGACAAGG - Intergenic
1094200543 12:27791052-27791074 ACTAATTTATTTATGAAACAGGG - Intronic
1094306385 12:29024333-29024355 CTGGATTTAATTATGAAAAAAGG - Intergenic
1094517062 12:31141113-31141135 ATTTATTTATTTCTGAGACAGGG + Intergenic
1094750051 12:33395848-33395870 ATGAATTTTCTTGTGAAACACGG - Intronic
1095367291 12:41422807-41422829 ATGTATATATTTATGAAATTTGG - Intronic
1095546615 12:43378909-43378931 AGGCATTTATTCAATAAACATGG + Intronic
1095736702 12:45565011-45565033 ATTTATTTATTTTTGAGACAGGG - Intergenic
1095742635 12:45623623-45623645 ATGTATTTATTTCAGAGACAGGG + Intergenic
1095850764 12:46801687-46801709 ATTCATTTATCTATGGTACAGGG - Intronic
1096025889 12:48360641-48360663 ATGTATTTATTTTTGAGACAGGG - Intergenic
1096058293 12:48673942-48673964 ATTTATTTATTTTTGAGACATGG - Intronic
1096118965 12:49074272-49074294 ATTTATTTATTTTTGAAACAGGG + Intergenic
1096656046 12:53092921-53092943 ATTCTTTTTTTTTTGAAACAGGG - Intergenic
1096657400 12:53100164-53100186 ATTTATTTATTTTTGAGACAGGG + Intronic
1096734481 12:53641864-53641886 ATTTATTTATTTTTGAAACAGGG - Intronic
1096990562 12:55798489-55798511 ATTTATTTATTTTTGAGACAGGG - Intronic
1097050438 12:56220008-56220030 ATTTATTTATTTTTGAGACAGGG - Intronic
1097088202 12:56485261-56485283 ATTTATTTATTTTTGACACAGGG + Intronic
1097230206 12:57506420-57506442 ATTTATTTATTTTTGAGACAGGG - Intronic
1097297432 12:57982086-57982108 ATTTATTTATTTTAGAAACACGG - Intergenic
1097644339 12:62218000-62218022 ATTTATTTATTTTTGAGACAGGG + Intronic
1097671873 12:62549603-62549625 ATTTATTTATTTTTGAGACAGGG - Intronic
1097795002 12:63851991-63852013 ATTTATTTATTTTTGAGACAGGG + Intronic
1097889796 12:64766003-64766025 ATTTATTTATTTTTGAGACAGGG - Intergenic
1098038917 12:66334770-66334792 ATTTATTTATTTTTGAGACAGGG - Intronic
1098044116 12:66382345-66382367 ATTTATTTATTTTTGAGACAGGG - Intronic
1098072401 12:66689923-66689945 ATTTATTTATTTTTGAGACAGGG + Intronic
1098268121 12:68744390-68744412 ATTTATTTATTTTTGAGACATGG + Exonic
1098326702 12:69311116-69311138 ATTTATTTATTTATGAGACAGGG + Intergenic
1098348329 12:69529612-69529634 ATTTATTTATTTTTGAGACAGGG - Intronic
1098764217 12:74465918-74465940 CTGTTTTTATTTATGAAAGATGG - Intergenic
1098921830 12:76309600-76309622 ATTTATTTATTTTTGAGACAAGG - Intergenic
1099019863 12:77390211-77390233 TTGCCTTTATTTATGCCACAGGG + Intergenic
1099139046 12:78946726-78946748 AAGCATGTATTTATAAAACCTGG + Intronic
1099206197 12:79730175-79730197 ATTTATTTATTTTTGAGACAGGG + Intergenic
1099352412 12:81590500-81590522 ATTTATTTATTTTTGAAACAGGG + Intronic
1099445207 12:82743736-82743758 AGGCATTTATTTGTTAAACAGGG - Intronic
1099601443 12:84743926-84743948 ATTTATTTATTTTTGAGACAGGG - Intergenic
1099710426 12:86217179-86217201 ATTTATTTATTTTTGAGACAGGG + Intronic
1099954384 12:89338724-89338746 ATTCATTTATTAATTCAACAAGG - Intergenic
1100022992 12:90092098-90092120 ATATATATATTTTTGAAACAGGG - Intergenic
1100039980 12:90304283-90304305 ATTTATTTATTTATGAGACAGGG + Intergenic
1100081321 12:90855028-90855050 ATTTATTTATTTTTGAAATAGGG + Intergenic
1100205742 12:92347215-92347237 ATTTATTTATTTTTGAGACAGGG - Intergenic
1100255176 12:92876076-92876098 ATTTATTTATTTTTGAGACAGGG + Intronic
1100308095 12:93369885-93369907 ATGAATTTATTTTTGAGACAGGG + Intergenic
1100314763 12:93434908-93434930 ATTTATTTATTTAAGAGACAGGG + Intronic
1100475739 12:94933779-94933801 ATTTATTTATTTTAGAAACAGGG + Intronic
1100485901 12:95027059-95027081 TTTCATTTATTTTTGAGACAGGG + Intronic
1100501589 12:95179494-95179516 ATTTATTTATTTATGAGACAAGG - Intronic
1100513919 12:95307389-95307411 ATTTATTTATTTTTGAGACAAGG - Intergenic
1100549373 12:95632894-95632916 ATTTATTTATTTTTGAGACAGGG + Intergenic
1100649544 12:96569983-96570005 TTTTATTTATTTATGAGACAGGG + Intronic
1100710334 12:97249312-97249334 CTGCATTTCTTCATAAAACAGGG - Intergenic
1100824877 12:98465219-98465241 ATTTATTTATTTTTGAGACATGG - Intergenic
1100845251 12:98651819-98651841 AATTATTTATTTATGAAACAGGG + Intronic
1101144318 12:101827134-101827156 ATGTATTTATTTTTGAGACAAGG + Intronic
1101152228 12:101893935-101893957 ATTAATTTATTTTTGAGACAAGG + Intronic
1101155414 12:101923083-101923105 ATTTATTTATTTTTGAGACAGGG - Exonic
1101385619 12:104254802-104254824 ATGTATTTATTTTAGAGACAGGG - Intronic
1101499521 12:105289355-105289377 ATGCATCTATTTGAGAAAGAGGG - Intronic
1101655954 12:106720386-106720408 ATTTATTTATTTTTGAGACAGGG + Intronic
1101690098 12:107070498-107070520 ATGCATTTATGTATGGGAGAAGG + Intronic
1101864556 12:108510833-108510855 ATTTATTTATTTTTGAGACAGGG - Intergenic
1101992003 12:109493830-109493852 ATTTATTTATTTGTGAGACAAGG + Intronic
1102020792 12:109680946-109680968 ATTTATTTATTTTTGAGACAGGG + Intergenic
1102166251 12:110809134-110809156 ATGTATTTATTTTTAAGACAGGG + Intergenic
1102179084 12:110898280-110898302 ATTTATTTATTTTTGAGACAAGG - Intronic
1102287044 12:111666118-111666140 ATTCATTCATTCAAGAAACAGGG + Intronic
1102392450 12:112560241-112560263 ATTTATTTATTTATGAGACAGGG + Intergenic
1102393480 12:112568400-112568422 ATCTATTTATTTATGAGGCAGGG - Intergenic
1102480349 12:113219040-113219062 ATTTATTTATTTTTGAGACAGGG + Intronic
1102525213 12:113507748-113507770 ATTTATTTATTTTTGAGACAGGG + Intergenic
1102693277 12:114778429-114778451 ATTTATTTATTTTTGAGACAGGG + Intergenic
1102994716 12:117340009-117340031 ATTTATTTATTTTTGAGACAGGG + Intronic
1103054804 12:117810315-117810337 ATTTATTTATTTTTGAGACAGGG + Intronic
1103105269 12:118218944-118218966 AGTTATTTATTTATGAGACAAGG - Intronic
1103240283 12:119407523-119407545 ATTAATTTATTTTTGAGACAGGG - Intronic
1103330180 12:120148824-120148846 ATTTATTTATTTTTGAGACAGGG + Intronic
1103404446 12:120665417-120665439 ATTTATTTATTTTTGAGACAGGG - Intronic
1103572631 12:121855140-121855162 ATGCATTTATTTAGCAAAACTGG + Intronic
1103613194 12:122136302-122136324 ATGCATTTATTTAAGAAAAGAGG - Intronic
1103654501 12:122459476-122459498 ATTTATTTATTTAAGAGACAGGG - Intergenic
1103691209 12:122775617-122775639 ATTTATTTATTTTTGAGACAGGG + Intronic
1103711344 12:122914945-122914967 ATTTATTTATTTTTGAGACATGG - Intergenic
1103730042 12:123021336-123021358 ATTTATTTATTTATGAGATAGGG + Intronic
1103732833 12:123039250-123039272 ATTTATTTATTTTTGAGACAGGG - Intronic
1104326813 12:127806409-127806431 ATTTATTTATTTTTGAGACAAGG - Intergenic
1104437796 12:128769617-128769639 ATTTATTTATTTTTGAGACAAGG + Intergenic
1105012345 12:132764078-132764100 ATTTATTTATTTTTGAGACAGGG - Intergenic
1105403017 13:20112047-20112069 ATTTATTTATTTATGAGCCAGGG - Intergenic
1105453125 13:20517975-20517997 ATGAATTTATTTGTTCAACAGGG + Intronic
1105612039 13:21977209-21977231 ATGTATTTTTTTTTGAGACAAGG - Intergenic
1105956739 13:25290319-25290341 ATTTATTTATTTTTGAGACAGGG + Intergenic
1106185983 13:27410551-27410573 ATTTATTTATTTTTGAGACAAGG + Intergenic
1107726218 13:43302365-43302387 ATGTATTTATTAAGAAAACATGG + Intronic
1107870371 13:44741164-44741186 ATTTATTTATTTTTGAGACAAGG + Intergenic
1108323939 13:49311898-49311920 ATTTATTTATTTTTGAGACAGGG + Intronic
1108406960 13:50113919-50113941 ATCTATTTATTTATGAGACAAGG - Intronic
1108556874 13:51602063-51602085 ATGCATTTATTGTTGGAACAGGG + Intronic
1108698893 13:52926920-52926942 ATTTATTTATTTTTGACACAGGG - Intergenic
1108720911 13:53131086-53131108 ATTCATTTACATATAAAACAAGG - Intergenic
1109145979 13:58780477-58780499 ATGGATTTTTTTTTGAGACAGGG + Intergenic
1109856829 13:68141064-68141086 TTAAATTTATTTATGAAACAAGG + Intergenic
1109909159 13:68887963-68887985 ATGCATATATTTCTGGTACAAGG + Intergenic
1109985844 13:69983759-69983781 ATTTATTTATTTTTGAAATAGGG - Intronic
1110043175 13:70792190-70792212 ATGAATTTATTTATCAAGAAAGG - Intergenic
1110233863 13:73196183-73196205 CTTTATTTATTTTTGAAACAGGG + Intergenic
1110483730 13:76014147-76014169 ATTTATTTATTTTTGAGACAGGG - Intergenic
1110574922 13:77044351-77044373 ATTTATTTATTTATGAGACAGGG - Intergenic
1110739080 13:78973265-78973287 ATACATTTAATTATGAAGCATGG - Intergenic
1110754074 13:79151293-79151315 ATGCATTTTTTATTGAAAAAGGG - Intergenic
1111218421 13:85174456-85174478 ATTTATTTATTTTTGAGACAGGG - Intergenic
1111484665 13:88880873-88880895 ATTTATTTATTTATTAGACAGGG + Intergenic
1111640117 13:90958310-90958332 ATTTAATAATTTATGAAACAGGG + Intergenic
1111869869 13:93817849-93817871 ATACATTATTTTTTGAAACAGGG - Intronic
1112132386 13:96538448-96538470 ATTTATTTATTTTTGAGACAGGG + Intronic
1112136035 13:96578565-96578587 ATTTATTTATTTATTAGACAGGG + Intronic
1112394951 13:99021014-99021036 CTGCCTTGATTTATGAAATATGG - Intronic
1112518367 13:100075638-100075660 ATTTATTTATTTTTGAGACAGGG - Intergenic
1112585145 13:100712448-100712470 ATTTATTTATTTTTGAGACAGGG + Intergenic
1112801897 13:103120567-103120589 ATTTATTTATTTAAGAGACAGGG - Intergenic
1112978509 13:105351866-105351888 ATTTATTTATTTTTGAGACAGGG - Intergenic
1113046525 13:106161131-106161153 AGGCATTTATTTTTTAAACTTGG - Intergenic
1113158011 13:107347445-107347467 ATGCTTTGAGTTATGAAAAAAGG + Intronic
1113214235 13:108019632-108019654 ATGATTTTATTTAGGTAACATGG - Intergenic
1113397883 13:109965601-109965623 ATTTATTTATTTTTGAGACAAGG - Intergenic
1113644650 13:111984941-111984963 ATGCTTTCATTTGTCAAACAAGG - Intergenic
1113739099 13:112698722-112698744 ATTTATTTATTTTTGAGACAAGG + Intronic
1113817894 13:113187963-113187985 AAGTATTCATTTAGGAAACACGG + Intronic
1113899916 13:113791006-113791028 TTGAATGTGTTTATGAAACATGG + Intronic
1114737099 14:25053057-25053079 ATGAGCTTACTTATGAAACAGGG - Intergenic
1114767925 14:25395478-25395500 GTTCATTTATTCATGAAAAAAGG - Intergenic
1114904264 14:27105351-27105373 ATGTATCTATTAATAAAACAGGG - Intergenic
1114913262 14:27227743-27227765 ATTCATTTATTTATTCAGCAAGG - Intergenic
1115190118 14:30739116-30739138 ATGTATGTATGTATGAGACAGGG + Intergenic
1115315645 14:32022133-32022155 ATACATATATATATGAAAGAAGG + Intergenic
1115477833 14:33833231-33833253 ATTTATTTATTTTTGAGACAGGG - Intergenic
1115579937 14:34747626-34747648 ATTGATTTATTTATGAGACAGGG - Intergenic
1115596501 14:34915076-34915098 ATTTATTTATTTTTGAGACAGGG + Intergenic
1115669524 14:35593845-35593867 ATTTATTTATTTTTGAGACAGGG - Intronic
1116397623 14:44465387-44465409 AAGCATTTATATAAGATACAGGG - Intergenic
1116472191 14:45298193-45298215 ATTTATTTATTTAAGAGACAGGG - Intergenic
1117444550 14:55791166-55791188 ATAAATTTGTTTATAAAACAAGG - Intergenic
1117537723 14:56717931-56717953 ATTTATTTATTTTTGAGACAGGG - Intronic
1117902424 14:60549419-60549441 ATTTATTTATTTATGAGACAGGG - Intergenic
1117903391 14:60559158-60559180 ATTTATTTATTTTTGAGACAAGG - Intergenic
1118047862 14:61991978-61992000 ATTCATTCATTCATGGAACATGG + Intergenic
1118262223 14:64258200-64258222 ATTTATTTATTTTTGAGACAGGG - Intronic
1118331513 14:64819172-64819194 ATGACTTTCTTTATGAAACTGGG - Intronic
1118376883 14:65185185-65185207 ATTTATTTATTTTTGAGACAGGG + Intergenic
1118495215 14:66301683-66301705 ATGCATGTATATGTAAAACATGG - Intergenic
1118553180 14:66980247-66980269 ATGCAATTATCCATGAAGCACGG + Intronic
1118622065 14:67622454-67622476 CTGCAATTATTTAATAAACAAGG - Intronic
1118838907 14:69496530-69496552 ATTTATTTATTTTTGCAACAGGG + Intronic
1118943586 14:70361400-70361422 ATTTATTTATTTTTGAAACAGGG - Intronic
1118948395 14:70410415-70410437 ATTTATTTATTTATGACATAGGG - Intronic
1118968445 14:70610370-70610392 ATTTATTTATTTTTGAGACAGGG - Intergenic
1119063516 14:71501311-71501333 ATTTATTTATTTTTGAGACAGGG - Intronic
1119310106 14:73638942-73638964 ATTCATTTATTTAAGAGGCAGGG + Intergenic
1119338976 14:73859124-73859146 AGGCATTTGTTGATGAAATAAGG + Intronic
1119360768 14:74047435-74047457 ATTTATTTATTTTTGAGACAGGG + Intronic
1119375229 14:74185764-74185786 ATTTATTTATTTTTGAGACAGGG + Intronic
1119387076 14:74264121-74264143 ATTTATTTATTTTTGAGACAGGG + Intergenic
1119513924 14:75233259-75233281 ATTTATTTATTTTTGAGACAGGG + Intergenic
1119557619 14:75565835-75565857 ATGTGTTTATTTTTGAGACAGGG + Intergenic
1119798193 14:77418534-77418556 ATTTATCTATTTATGAGACAGGG + Intronic
1119807956 14:77494888-77494910 ATTTATTTATTTTTGAGACAGGG + Intronic
1119826996 14:77665211-77665233 ATTTATTTATTTATGAGACAGGG - Intergenic
1119976483 14:79029850-79029872 ATTTATTTATTTATAAAACAGGG + Intronic
1120035600 14:79693817-79693839 ATACATATATTTAAGAAACTAGG - Intronic
1120035989 14:79698935-79698957 ATACATTTAATTCTGAAAAATGG - Intronic
1120608927 14:86614940-86614962 ATTCATTTATTTTTGAGACAGGG - Intergenic
1120708012 14:87764581-87764603 ATGCAAGTATTTATGTAATAGGG - Intergenic
1121060382 14:90902593-90902615 ATGCATTTATTTTTGATATAAGG - Intronic
1121102007 14:91255819-91255841 ATTTATTTATTTTTGAAACAGGG + Intergenic
1121114486 14:91334246-91334268 ATGCATTTCTTTTTGAGAGAGGG + Intronic
1121124688 14:91398648-91398670 ATTTATTTATTTTTGAGACAGGG - Intronic
1121531031 14:94653686-94653708 ATGTATTTATTTTTGAGACAGGG + Intergenic
1121586299 14:95065174-95065196 ATTTATTTATTTTTGAGACAGGG - Intergenic
1121797849 14:96750497-96750519 ATTTATTTATTTTTGAGACAGGG + Intergenic
1121815626 14:96925927-96925949 ATGCATTTATTTTTAAAAATAGG + Intronic
1121913420 14:97813785-97813807 ATTTATTTATTTATTGAACAAGG + Intergenic
1121939676 14:98058129-98058151 ATTTATTTATTTTTGAGACAGGG + Intergenic
1121978058 14:98424544-98424566 ATACATTTATTTTTGAGACAGGG + Intergenic
1122219897 14:100231096-100231118 ATTTATTTATTTTTGAGACAGGG + Intergenic
1122383794 14:101330229-101330251 ATTTATTTATTTTTGAGACATGG - Intergenic
1122554342 14:102569112-102569134 ATTCTTTTATTTTTGAGACAGGG - Intergenic
1122676538 14:103419282-103419304 ATTTATTTATTTATGAGACGGGG - Intronic
1122896124 14:104758004-104758026 AGTCATTTATTTGTGAAAGAGGG - Intronic
1123076626 14:105670576-105670598 ATTTATTTATTTTTGAGACAGGG + Intergenic
1123414916 15:20088322-20088344 CTGCATTTTTTTTTGAGACAGGG + Intergenic
1123524258 15:21095436-21095458 CTGCATTTTTTTTTGAGACAGGG + Intergenic
1124176320 15:27427887-27427909 ATTTATTTATTTTTGAGACATGG + Intronic
1125071093 15:35553887-35553909 ATTTATTTATTTCTGAGACAGGG - Intergenic
1125144955 15:36456228-36456250 ATGCATTTGCTTAGGAACCAGGG - Intergenic
1125204480 15:37137568-37137590 ATGCATTTAGTCATCAAAAAAGG - Intergenic
1125553198 15:40563354-40563376 ATTTATTTATTTGTGAGACAGGG - Intronic
1125624298 15:41093836-41093858 ATTTATTTATTTTTGAGACAGGG - Intronic
1125655397 15:41352593-41352615 ATTTATTTATTTTTGAGACAGGG + Intronic
1125673432 15:41489504-41489526 ATTTATTTATTTTTGAGACAGGG - Intergenic
1125847308 15:42868852-42868874 ATTTATTTATTTTTGAGACAAGG - Intronic
1126008965 15:44284721-44284743 ATGTATTTATTCTTGACACAGGG + Intergenic
1126120835 15:45249868-45249890 ATGTATTTATTTTAGAGACAGGG - Intergenic
1126152025 15:45532077-45532099 AGTCATTGATATATGAAACAGGG - Intergenic
1126398318 15:48242793-48242815 ATTTATTTATTTTTGACACATGG - Intronic
1126604992 15:50467561-50467583 ATTTATTTATTTTTGAGACAGGG + Intronic
1126672057 15:51125411-51125433 ATTTATTTATTTTGGAAACAGGG + Intergenic
1126757804 15:51941260-51941282 CTGCATTTATATATGACACTGGG - Intronic
1126789709 15:52209968-52209990 ATTTATTTATTTTTGAGACAAGG + Intronic
1126793370 15:52240723-52240745 ATTTATTTATTTTTGAGACAAGG - Intronic
1127200766 15:56647536-56647558 ATTTATTTATTTTTTAAACAAGG + Intronic
1127240460 15:57107898-57107920 ATTTATTTATTTTTGAGACAGGG - Intronic
1127250638 15:57233501-57233523 ATGTATTTATTTTTGAGACAGGG + Intronic
1127346387 15:58104899-58104921 AAGCATTTATTTAAGAAAAATGG - Intronic
1127425349 15:58850592-58850614 ATTTATTTATATATGAAACAGGG + Intronic
1127521799 15:59750323-59750345 ATTTATTTATTTTTGAGACAGGG + Intergenic
1127602233 15:60549378-60549400 ATGAATTAATTTAAGAAACAAGG + Intronic
1127729401 15:61784940-61784962 ATTTATTTATTTAAGAGACAAGG + Intergenic
1127852170 15:62923491-62923513 ATACATTTTTTTTTGAGACAGGG + Intergenic
1127927279 15:63558866-63558888 ATTTATTTATTTTTGAGACAGGG - Intronic
1128088602 15:64903834-64903856 ATTTATTTATTTTTGAGACAAGG - Intronic
1128173806 15:65536021-65536043 ATTTATTTATTTTTGAGACAGGG + Intronic
1128193782 15:65731470-65731492 TTGCAGTTATTAATGAAAAAAGG - Intronic
1128196168 15:65758318-65758340 ATTTATTTATTTTTGAGACAGGG + Intronic
1128200744 15:65804567-65804589 ATTTATTTATTTTTGAGACAGGG - Intronic
1128298322 15:66544336-66544358 ATTTATTTATTTTTGAGACAGGG + Intronic
1128414501 15:67432031-67432053 ATTTATTTATTTTTGAGACAGGG - Intronic
1128721088 15:69948869-69948891 ATTTATTTATTTTTAAAACAGGG + Intergenic
1129003325 15:72351965-72351987 ATTTATTTATTTTTGAGACAGGG + Intronic
1129023199 15:72542820-72542842 ATGAATATTTTTATAAAACAAGG + Intronic
1129119078 15:73384332-73384354 ATTTATTTATTTTTGAGACAGGG + Intergenic
1129194983 15:73958598-73958620 ATTTATTTATTTTTGAGACAGGG - Intergenic
1129427689 15:75476150-75476172 ATTTATTTATTTTTGAGACAGGG - Intronic
1129490514 15:75920814-75920836 ATTTATTTATTTTTGAGACAGGG - Intronic
1129547135 15:76408211-76408233 ATGTATTTGTTGATGAAACCTGG + Intronic
1129767071 15:78176919-78176941 ATTTATTTATTTTTGAAACAGGG - Intronic
1129922518 15:79332044-79332066 ATTTATTTATTTTTGAGACAAGG - Intronic
1129948792 15:79566730-79566752 ATGAATATATTTATAATACATGG - Intergenic
1130516401 15:84629200-84629222 ATTTATTTATTTTTGAGACAGGG - Intergenic
1130638591 15:85648830-85648852 ATTTATTTATTTTTGAGACAGGG - Intronic
1130813505 15:87406481-87406503 CTTCATTTATTTATTGAACAAGG - Intergenic
1131082467 15:89548226-89548248 ATTTATTTATTTTTGAGACAGGG + Intergenic
1131134496 15:89923223-89923245 ATTAATTAATTTTTGAAACAAGG - Intergenic
1131254002 15:90849589-90849611 ATTTATTTATTTTTGAGACAGGG - Intergenic
1131342005 15:91611333-91611355 ATTGATTTATTTTTGAGACAGGG - Intergenic
1131922756 15:97347955-97347977 AGGCATTTATGTGTGCAACAGGG - Intergenic
1132073914 15:98803510-98803532 ATTTATTTATTTATGAGATAGGG + Intronic
1132235784 15:100220104-100220126 ACTCATTTATTTATTGAACAAGG + Intronic
1132534225 16:469399-469421 ATTTATGTATTTATGAGACAGGG + Intronic
1133091320 16:3405999-3406021 ATTTATTTATTTTTGAGACAGGG - Intronic
1133319036 16:4901680-4901702 ATTTATTTATTTTTGACACAAGG - Intronic
1133319067 16:4901931-4901953 ATTTATTTATTTTTGAGACAAGG - Intronic
1133447540 16:5874939-5874961 ATGCATTTATTTATGGGGGACGG - Intergenic
1133633637 16:7645790-7645812 ATGCATTTCATACTGAAACAAGG + Intronic
1133701399 16:8312510-8312532 ATTTATTTATTTTTGAGACAAGG - Intergenic
1133925466 16:10188650-10188672 ATTTATTTATTTTTGAGACAGGG + Intergenic
1134023315 16:10936815-10936837 CTCCATTTATTTGTGAGACAGGG + Intronic
1134180042 16:12040354-12040376 ATTTATTTATTTTTGAGACAGGG - Intronic
1134223647 16:12375042-12375064 ATGCATTTTTTTTTAAGACAGGG - Intronic
1134467600 16:14493218-14493240 ATTTATTTATTTTTGAGACAGGG + Intronic
1134652989 16:15925549-15925571 ATTTATTTATTTTTGAGACAGGG - Intergenic
1134662598 16:15995672-15995694 ATTTATTTATTTTTGAGACAGGG + Intronic
1134753309 16:16644188-16644210 ATGCATCAATTTTTAAAACATGG - Intergenic
1134826746 16:17290943-17290965 ATTTATTTATTTTTGAGACACGG + Intronic
1134891189 16:17843099-17843121 ATGTATTTGTTTTTGAGACATGG - Intergenic
1134992746 16:18714895-18714917 ATGCATCAATTTTTAAAACATGG + Intergenic
1135048751 16:19175118-19175140 ATGTATTTATTTTTGAGACAGGG - Intronic
1135086992 16:19483162-19483184 ATTTATTTATTTTTGAGACAGGG + Intronic
1135091279 16:19520003-19520025 ATTTATTTATTTTTGAGACAGGG - Intronic
1135306787 16:21374111-21374133 ATTTATTTATTTTTGAGACAGGG - Intergenic
1135416976 16:22275954-22275976 ATTTATTTATTTTTGAGACAGGG + Intronic
1135503560 16:23017357-23017379 ATGGATTTATTTACTGAACAAGG - Intergenic
1135624924 16:23986258-23986280 ATGTATTTATTTTTGAAACAGGG + Intronic
1135706085 16:24676297-24676319 ATGTATTTATTTATTTAAGATGG + Intergenic
1135960304 16:26989477-26989499 ATTCATTTATTTCAGAGACACGG - Intergenic
1136000450 16:27288481-27288503 ATTTATTTATCTATGAGACAGGG - Intronic
1136236716 16:28918606-28918628 ATTCATTTATTATTGAGACAGGG - Intronic
1136303528 16:29353253-29353275 ATTTATTTATTTTTGAGACAGGG - Intergenic
1136389811 16:29956802-29956824 ATGTATTTATTTTAGAGACAGGG + Intronic
1137284812 16:47006631-47006653 ATTTATTTATTTATGAGACAGGG - Intergenic
1137289829 16:47044519-47044541 ATTTATTTATTTTTGAGACAGGG - Intergenic
1137431122 16:48418520-48418542 ATTTATTTATTTTTGAGACAGGG - Intronic
1137467974 16:48728391-48728413 ATTTATTTATTTTTGAGACAGGG - Intergenic
1137618993 16:49863976-49863998 ATTCATTTTTTTTTGAGACAGGG + Intergenic
1137630482 16:49940015-49940037 AGGCATTTACTTAAGAAAAAGGG - Intergenic
1137653642 16:50141491-50141513 ATTTATTTATTTTTGAGACAGGG - Intergenic
1137973809 16:53012968-53012990 ATTTATTTATTTAGGAGACAGGG - Intergenic
1137980823 16:53068046-53068068 ATTTATTTATTTTTGAGACAGGG - Intronic
1138050118 16:53767580-53767602 ATGAATTTTTTTTTTAAACAGGG + Intronic
1138465696 16:57187985-57188007 ATGCATATATATATGCAAAAGGG - Intronic
1138517725 16:57546128-57546150 ATTTATTTATTTTTGATACAGGG + Intronic
1138523026 16:57582645-57582667 ATTTATTTATTTTTGAGACACGG - Intronic
1138581239 16:57941856-57941878 ATTCATTTATTTTTGAGACAGGG + Intronic
1138638723 16:58365180-58365202 ATGCATTAATTTAAAGAACAAGG - Intronic
1138814415 16:60187883-60187905 ATGTATTTATTTATTTAAGAAGG + Intergenic
1138836526 16:60442977-60442999 CTGCATTTACTTATCAAAAATGG - Intergenic
1138845124 16:60555542-60555564 ATGAATATGATTATGAAACAGGG - Intergenic
1139150704 16:64379041-64379063 ATGCAATTATTTAAGAGCCATGG + Intergenic
1139161125 16:64510421-64510443 TTGCATTAATTGTTGAAACAAGG - Intergenic
1139178206 16:64715083-64715105 ATTTATTTATTTTTGAGACAGGG + Intergenic
1139254249 16:65525971-65525993 ATGCTTTTCTGTATGAAAAAAGG - Intergenic
1139444096 16:66986204-66986226 ATTTATTTATTTTTGAGACAGGG - Intergenic
1139770004 16:69266721-69266743 TTTATTTTATTTATGAAACAGGG + Intronic
1139793042 16:69456144-69456166 ATTTATTTATTTTTGAGACAGGG + Intronic
1139844238 16:69908236-69908258 ATTTATTTTTTAATGAAACAGGG - Intronic
1140131763 16:72168086-72168108 ATGTCTTCATTCATGAAACAAGG + Intronic
1140357744 16:74320593-74320615 ATTTATTTATTTTTGAGACAGGG - Intergenic
1140413260 16:74754532-74754554 ATTTATTTATTTTTGAGACAGGG + Intronic
1140422014 16:74827339-74827361 AAGCATTTATTCAAGAAAAATGG + Intergenic
1140443459 16:75004618-75004640 ATTTATTTATTTTTGAGACAGGG + Intronic
1140447357 16:75041334-75041356 ATTTATTTATTTTTGAGACAGGG + Intronic
1140507655 16:75484015-75484037 ATTTATTTATTTTTGAGACAGGG - Intronic
1140742969 16:77957912-77957934 ATGCATTTATTTTTGAGACAGGG + Intronic
1140851333 16:78937629-78937651 ATTTATTTATTTATGAGACAAGG + Intronic
1140962904 16:79934012-79934034 ATGCAGGTATTTATCAAACAGGG - Intergenic
1140972449 16:80026769-80026791 ATACATTTATTTAACAAACAAGG - Intergenic
1141061797 16:80879976-80879998 ATTTATTTATTTTTGAGACAAGG - Intergenic
1141064896 16:80906316-80906338 ATTTATTTATTTTTGAGACAGGG - Intergenic
1141105922 16:81233662-81233684 ATTTATTTATTTAAGAGACATGG - Intergenic
1141106787 16:81240694-81240716 ATTTATTTATTTTTGAGACAGGG - Intronic
1141124847 16:81393936-81393958 ATTTATTTATTTTTGAGACAGGG + Intergenic
1141309948 16:82903812-82903834 GTGCTCTTATTTACGAAACATGG - Intronic
1141668131 16:85476640-85476662 ATTTATTTATTTTTGAGACAGGG + Intergenic
1142359147 16:89618532-89618554 ATGCATTTAGTTTTGAGACAGGG + Intronic
1142575345 17:903386-903408 ATGCTTTTTTTTTTGAGACAGGG + Intronic
1142971940 17:3618067-3618089 ATGCAGTGATTTGTGAATCATGG - Intronic
1143113534 17:4567518-4567540 ATGTATTTATTTTTGAGACAGGG + Intergenic
1143168875 17:4914520-4914542 ATTTATTTATTTTTGAGACAGGG + Intergenic
1143242135 17:5452710-5452732 ATTTATTTATTTTTGAGACAGGG - Intronic
1143616986 17:8057770-8057792 ATTCATTCATTCGTGAAACAGGG - Intergenic
1143882384 17:10039674-10039696 ATTTATTTATTTTTGAGACAGGG - Intronic
1143977452 17:10840440-10840462 ATGTATTTATTTTTGAGACAAGG + Intergenic
1144496761 17:15751044-15751066 ATTCATTTATTTATGACAGATGG + Intergenic
1144706834 17:17374168-17374190 ATGTATTTATTTTTGAGACAGGG + Intergenic
1144904879 17:18633849-18633871 ATTCATTTATTTATGACAGATGG - Intergenic
1144932106 17:18868107-18868129 ATTTATTTATTTTTGAGACAGGG - Intronic
1145004136 17:19327663-19327685 ATTCATTTATTTATCAGATAGGG - Intronic
1145030888 17:19504452-19504474 TTGTATTTATTTTTGAATCAGGG - Intronic
1145290563 17:21542409-21542431 ATGCATTTCTTTATAATTCAAGG - Intronic
1145752527 17:27365646-27365668 ATTTATTTATTTTTGAGACAGGG + Intergenic
1146029396 17:29351969-29351991 ATTTATTTATTTTTGAGACAGGG + Intergenic
1146043636 17:29483082-29483104 ATTTATTTATTTTTGAGACATGG + Intronic
1146078348 17:29754671-29754693 ATTTATTTATTTTTGAGACAGGG + Intronic
1146156346 17:30527341-30527363 ATTAATTTATTTTTGAGACAGGG - Exonic
1146487039 17:33251334-33251356 ATTTATTTATTTTTGAGACAGGG + Intronic
1146894386 17:36530927-36530949 ATTTATTTATTTAAGAGACAGGG + Intronic
1146900381 17:36581882-36581904 ATACTTTTATTTCTGAGACAGGG + Intronic
1146988231 17:37242722-37242744 ATTTATTTATTTTTGAGACAGGG - Intronic
1147147890 17:38496465-38496487 ATGTATTTATTTTTGAGATAGGG - Intronic
1147151054 17:38514193-38514215 ATTTATTTATTTTTGAGACAGGG + Intergenic
1147289468 17:39430074-39430096 ATTTATTTATTTTTGAGACAGGG - Intronic
1147335039 17:39722492-39722514 ATTTATTTATTTTTGAGACAGGG - Intronic
1147344522 17:39780367-39780389 ATTTACTTATTTTTGAAACAGGG + Intronic
1147473142 17:40683244-40683266 ATGTATTTATTTTTGAGACAAGG - Intergenic
1147666146 17:42149569-42149591 ATTTATTTATTTTTGAGACAGGG - Intronic
1147682636 17:42261565-42261587 ATTTATTTATTTTTGAGACAGGG + Intronic
1147863620 17:43538678-43538700 ATCCATTTATTTTTGAGAGAGGG - Intronic
1147884307 17:43674515-43674537 ATTTATTTATTTTTGAGACAGGG + Intergenic
1148054997 17:44788732-44788754 ATTCATTTATTTTTGAGATAGGG + Intergenic
1148096395 17:45055382-45055404 ATTTATTTATTTTTGAGACAGGG + Intronic
1148488754 17:48009507-48009529 ATTTATTTATTTTTGAAACAGGG + Intergenic
1148672535 17:49421563-49421585 ATTTATTTATTTAGGAGACAGGG + Intronic
1148911496 17:50945306-50945328 ATGTATTTATTTTTGAGACAGGG + Intergenic
1149087822 17:52740312-52740334 ATGTATTTATTTTAGAGACAGGG - Intergenic
1149143419 17:53460750-53460772 ATTTATTTATTTCTGAGACAGGG - Intergenic
1149222185 17:54428039-54428061 AGGCATTGATTTTTGCAACAAGG + Intergenic
1149318398 17:55459983-55460005 ATTTATTTATTTGAGAAACAGGG - Intergenic
1149458372 17:56807881-56807903 ATTTATTTATTTTTGAGACAGGG - Intronic
1149460023 17:56821093-56821115 ATTTATTTATTTTAGAAACAGGG + Intronic
1149609228 17:57947794-57947816 ATTTATTTATTTATGAGACAGGG - Intronic
1149672985 17:58432177-58432199 ATTCATTTATTTATCCAACAAGG + Intronic
1149830921 17:59871200-59871222 ATTTATTTATTTTTGAGACAGGG + Intronic
1149901254 17:60481416-60481438 ATTTATTTATTTAGGAGACAGGG - Intronic
1150121972 17:62611348-62611370 ATTAATTTGTTTATCAAACATGG + Intronic
1150187905 17:63205076-63205098 ATTTATTTATTTTTGAGACAGGG - Intronic
1150413253 17:64964721-64964743 ATTTATTTATTTATGAAATAGGG - Intergenic
1150554742 17:66244274-66244296 TTATATTTATTTTTGAAACAGGG + Intronic
1150798562 17:68260492-68260514 ATTTATTTATTTTTGAAATAGGG + Intronic
1150881049 17:69028464-69028486 ATGCATTTAATTATTTAACTGGG - Intronic
1151644094 17:75417813-75417835 ATTTATTTATTTTTGAGACAGGG - Intergenic
1151644796 17:75423079-75423101 ATTTATTTATTTATTAGACAGGG - Intergenic
1151721530 17:75859308-75859330 ATGTATTTATTTTTGATACAGGG + Intergenic
1151723459 17:75871556-75871578 ATGTATTTATTTTTGAGACAGGG + Intergenic
1151838642 17:76601326-76601348 ATGTATTTATTTTTGAGAGAGGG - Intergenic
1151872472 17:76845626-76845648 ATTTATTTATTTTTGAGACAGGG - Intergenic
1151940836 17:77290806-77290828 ATTTATTTATTTATGAGACAGGG - Intronic
1152123324 17:78432169-78432191 ATTTATTTATTTTTGAGACAGGG - Intronic
1152216123 17:79033694-79033716 ATTTATTTATTTAGGAGACAGGG - Intronic
1153036549 18:768707-768729 ATTTATTTATTTTTGAGACAGGG + Intronic
1153084116 18:1263447-1263469 TTTCATTTATTTTTGAGACAGGG + Intergenic
1153225971 18:2900192-2900214 ACTCATTTATTTTTGAGACAGGG + Intronic
1153295767 18:3544743-3544765 ATTTATTTATTTTTGAGACAAGG + Intronic
1153319105 18:3754004-3754026 ATTTATTTATTTTTGAGACAGGG + Intronic
1153518305 18:5925979-5926001 ATTTATTTATTTTGGAAACAAGG - Intergenic
1153628081 18:7040758-7040780 ATGAATGGATATATGAAACATGG + Intronic
1153801366 18:8673425-8673447 ATTTATTTATTTTTGAGACATGG - Intergenic
1153849743 18:9081998-9082020 ATTCATTTATTTTTGAGACAGGG + Intergenic
1153933815 18:9902668-9902690 ATTTATTTATTTATGAGACATGG - Intergenic
1154331483 18:13432721-13432743 ATTTATTTATTTAAGAGACAGGG + Intronic
1155901274 18:31394063-31394085 ATAAAACTATTTATGAAACAGGG - Intronic
1156346526 18:36261814-36261836 AGGCATTTTTTTAAAAAACATGG - Intronic
1156814243 18:41290041-41290063 ATTTATTTATTTTTGAAACAGGG - Intergenic
1156860958 18:41835763-41835785 ATTAATTTATTTAAGAGACAGGG - Intergenic
1156988191 18:43374525-43374547 ATTTATTTATTTTTTAAACAAGG + Intergenic
1157313722 18:46571461-46571483 ATTTGTTTATTTTTGAAACAGGG - Intronic
1157872632 18:51244795-51244817 ATTTATTTATTTTTGAGACAGGG + Intergenic
1157876398 18:51277929-51277951 ATTTATTTATTTTTGAGACAGGG + Intergenic
1157907448 18:51582301-51582323 ATATTTTTATTTTTGAAACAGGG + Intergenic
1158486594 18:57872061-57872083 AAGCACTTATTTAAGAAAAATGG + Intergenic
1158658714 18:59365165-59365187 ATTTATTTATTTTTGAGACAAGG - Intergenic
1158670311 18:59468376-59468398 ATGCATTTATTTTTGAGACAGGG - Intronic
1158705317 18:59787354-59787376 TTGCATTTCTTTATGGAACGGGG - Intergenic
1158708155 18:59812755-59812777 TTGCTTTTGTTTTTGAAACAGGG + Intergenic
1159146638 18:64462982-64463004 ATGTATTTATATAAGAAACTAGG + Intergenic
1159207501 18:65272609-65272631 ATTTATTTATTTTTGATACAAGG + Intergenic
1159211902 18:65334068-65334090 ATGCATCTATTTCTGAAAACTGG + Intergenic
1159249649 18:65857492-65857514 ATTTATTTATTTTTGATACAGGG - Intronic
1159404242 18:67978799-67978821 GTGTATTTAGTTATGATACATGG + Intergenic
1160009603 18:75096095-75096117 ATTTATTTATTTTTGAGACAGGG + Intergenic
1160592941 18:79953999-79954021 ATGTATTTATTTTTGAGATAGGG - Intergenic
1160709212 19:543155-543177 ATTTATTTATTTTTGAGACAGGG + Intergenic
1160771485 19:833736-833758 TTTCATTTATTTTTGAGACACGG + Intergenic
1160987438 19:1845655-1845677 ATGAATTAATTTTTGAGACAGGG - Intronic
1161110032 19:2463950-2463972 ATTTATTTATTTTTGAGACAGGG - Intergenic
1161128893 19:2576551-2576573 ATTTATTTATTTAAGAAACAGGG + Intronic
1161402109 19:4071006-4071028 ATTCATTTATTTTTAAAAAATGG - Intergenic
1161496005 19:4586018-4586040 ATGTATTTAGTTAAGAGACAGGG - Intergenic
1161533659 19:4805308-4805330 ATTTATTTATTTTTGAAACAAGG - Intergenic
1161548477 19:4896961-4896983 ATTTATTTATTTTTGAGACACGG + Intronic
1161549113 19:4901310-4901332 ATGTATTTATTTTTGAGACAGGG - Intronic
1161874877 19:6900476-6900498 ATATATTTATTTTTGAGACAAGG - Intronic
1161934981 19:7365950-7365972 ATGTATTTTTTTTTGAGACAGGG + Intronic
1162177272 19:8840306-8840328 ATTTATGTATTTATGAGACAAGG + Intronic
1162193958 19:8969122-8969144 TTTCATTTATTTTTGAGACATGG - Intronic
1162421830 19:10569823-10569845 ATGTATTTATTTTTGAGTCAGGG + Intergenic
1162503056 19:11065580-11065602 ATTTATTTATTTTTGAGACAGGG + Intergenic
1162539801 19:11287968-11287990 ATTTATTTATTTTTGAGACAAGG + Intergenic
1162543281 19:11311435-11311457 ATTTATTTATTTTTGAGACAGGG + Intronic
1162562450 19:11424474-11424496 ATGGATTTTTTTTTGAGACACGG - Intronic
1162570603 19:11470048-11470070 ATTTATTTATTTTTGAGACAGGG - Intronic
1162590161 19:11586240-11586262 ATTTATTTATTTATGAAATAGGG - Intronic
1162748800 19:12815397-12815419 ATGCTTTTTTTTTTGAGACATGG - Intronic
1162871572 19:13590604-13590626 ATTTATTTATTTATGAGACAGGG + Intronic
1162928184 19:13941037-13941059 ATTCATTCATTTTTGAGACAGGG - Intronic
1163002817 19:14379400-14379422 TTGAATTTATTCATGTAACAAGG + Intergenic
1163180922 19:15601140-15601162 ATTAATTTATTTTTGAGACAGGG + Intergenic
1163295772 19:16411704-16411726 ATTCATTTATTTTTGAGGCAGGG + Intronic
1163339463 19:16695660-16695682 ATTCATTTATTTATGAGACAGGG - Intergenic
1163348194 19:16758281-16758303 ATGTATTTATTTTAGAGACAGGG + Intronic
1163383385 19:16983525-16983547 ATTAATTTATTTTTGAGACAGGG - Intronic
1163431700 19:17271945-17271967 ATTTATTTATTTTTGAGACAGGG + Intronic
1163750941 19:19077177-19077199 ATTTATTTATTTTTGACACAGGG - Intronic
1163780845 19:19247087-19247109 ATTTATTTATTTTTGAAACAGGG + Intronic
1163840487 19:19605617-19605639 ATTTATTTATTTATGAGACAGGG - Intronic
1163941983 19:20503532-20503554 TTTGATTTATTTATGCAACAAGG - Intergenic
1164285795 19:23816139-23816161 ATTCATTTATTTTTGAGATAGGG + Intronic
1164415401 19:28043106-28043128 ATTTATTCATTTATGAGACAGGG + Intergenic
1164519955 19:28971558-28971580 ACTTATTTATTTATGAGACAGGG + Intergenic
1165190987 19:34063287-34063309 ATTTATTTATTTTTGAGACAGGG - Intergenic
1165208644 19:34214316-34214338 ATTTATTTATTTATGAGACAGGG + Intronic
1165301049 19:34969370-34969392 ATTTATTTATTTTTGAGACAGGG + Intergenic
1165353008 19:35286892-35286914 ATTTATTTATTTTTGAGACAGGG + Intergenic
1165474195 19:36020242-36020264 ATTTATTTATTTTTGAGACAGGG - Intronic
1165555700 19:36629916-36629938 ATTTATTTATTTATGAGACAGGG - Intergenic
1165584412 19:36901233-36901255 AAGCATTAAGTTATGAAATAGGG + Intronic
1165612362 19:37166838-37166860 CTTTATTTATTTATGAGACAGGG + Intronic
1165804123 19:38570152-38570174 ATTTATTTATTTTTGAGACAAGG - Intronic
1165887251 19:39087013-39087035 ATTTATTTATTTTTGAGACAGGG + Intronic
1165892358 19:39121517-39121539 ATTTATTTATTTTTGAGACAGGG + Intergenic
1166087891 19:40488967-40488989 ATTTATTTATTTTTGAGACAGGG - Intronic
1166118587 19:40670981-40671003 ATTTATTTATTTTTGACACAGGG + Intronic
1166384584 19:42373405-42373427 ATGTATTTATTTTTAAGACAGGG + Intronic
1166549014 19:43652655-43652677 ATTTATTTATTTTTGATACAGGG + Intronic
1166617964 19:44268135-44268157 ATGTATGTATTTTTGAGACAGGG - Intronic
1166718115 19:44981895-44981917 ATTTATTTATTTGTGAGACAGGG - Intronic
1166786876 19:45372865-45372887 ATTTATTTATTTTTGAGACAAGG + Intergenic
1166815566 19:45543014-45543036 ATTTATTTATTTTTGAGACAGGG + Intronic
1166847155 19:45735680-45735702 ATTTATTTATTTTTGAGACAGGG + Intronic
1167011584 19:46812337-46812359 ATTTATTTATTTTTGAGACAGGG - Intergenic
1167011954 19:46814360-46814382 ATTTATTTATTTTTGAGACAGGG + Intergenic
1167073976 19:47237802-47237824 GTTTATTTATTTATAAAACAGGG - Intergenic
1167195997 19:48028916-48028938 ATGTATTTATTTTTGAGACAGGG - Intergenic
1167316984 19:48769954-48769976 ATTTATTTATTTTTGAGACAAGG - Intergenic
1167604251 19:50472863-50472885 ATTCATTTAATTTTGAGACAGGG - Intronic
1167867719 19:52341813-52341835 ATTTATTTATTTTTGAGACAGGG + Intronic
1168040811 19:53757179-53757201 ATTGATTTATTTTTGAGACAGGG + Intergenic
1168082832 19:54022892-54022914 GTGTATTTATTTTTGAGACAGGG - Intergenic
925238743 2:2302938-2302960 ATACATGTATTTATGCAAAAGGG - Intronic
925669877 2:6300304-6300326 ATTTATTTATTTCTGAGACAGGG + Intergenic
925762949 2:7204611-7204633 ATTTATTTATTTTTGAGACAGGG + Intergenic
925763901 2:7212428-7212450 ATTTATTTATTTTTGAGACAGGG - Intergenic
925797684 2:7564582-7564604 ATCCATTTATTTTTAAGACAGGG - Intergenic
926196508 2:10767051-10767073 ATGCATTTTATTAAGAAAAATGG + Intronic
926250653 2:11153981-11154003 ATTTATTTATTTTTGAGACAGGG + Intergenic
926573392 2:14554118-14554140 ATTTACTTATTTATGAGACAGGG - Intergenic
926710797 2:15878512-15878534 ATGCATTTATTGATCATAAAAGG - Intergenic
926765999 2:16323183-16323205 ATTTATTTATTTTTGAGACAGGG + Intergenic
926797837 2:16633418-16633440 ATTTATTTATTTTTGAGACAGGG + Intronic
926860466 2:17303398-17303420 ATGGTTTTATTTATAAAACTAGG + Intergenic
926986088 2:18625258-18625280 ATTTATTTATTTTTGAGACAGGG - Intergenic
927324842 2:21792228-21792250 ATGCCTTTATTTATAAAGTAAGG - Intergenic
927375636 2:22409768-22409790 ATGCATTTAATTATAAAAATGGG - Intergenic
927582572 2:24266928-24266950 ATTTATTTATTTTTGAAACTGGG - Intronic
927597051 2:24405983-24406005 ATTTATTTATTTTTGAGACAGGG - Intergenic
927923897 2:26996157-26996179 TTTTATTTATTTTTGAAACAAGG + Intronic
928079416 2:28296104-28296126 ATTTATTTATTTTTGAGACAGGG - Intronic
928098671 2:28421950-28421972 ATGCATTTGTTTCTCAAAGATGG + Intergenic
928505245 2:31944961-31944983 ATTCATTTATTTCTTAACCAAGG - Intronic
928529911 2:32180433-32180455 ATTTATTTATTTTTGAGACAGGG + Intronic
928586717 2:32766790-32766812 ATTTATTTATTTTTGCAACAGGG + Intronic
928657292 2:33465514-33465536 ATTTATTTATTTTTGACACAGGG - Intronic
928826086 2:35422917-35422939 ATATATATATATATGAAACATGG - Intergenic
929002700 2:37363622-37363644 ATTTATTTATTTAAGAGACAGGG - Intronic
929169691 2:38919037-38919059 ATTTATTTATTTTTCAAACAGGG - Intronic
929239235 2:39636790-39636812 ATTTATTTATTTTTGAGACAGGG + Intergenic
929490987 2:42395945-42395967 ATTCTTTTTTTTTTGAAACAAGG - Intronic
929619802 2:43343032-43343054 ATTTATTTATTTTTGAAACAAGG + Intronic
930213690 2:48670828-48670850 ATTTATTTATTTTTGAGACAGGG + Intronic
930414685 2:51076616-51076638 ATTCATTTTTTCATGAATCATGG + Intergenic
930507569 2:52303883-52303905 ATGTATTTTTTTATTAAAAATGG + Intergenic
930695423 2:54406806-54406828 ATTTATTTATTTTTGAGACACGG + Intergenic
930801850 2:55451099-55451121 ATTTATTTATTTTTGAGACAAGG + Intergenic
930806423 2:55495101-55495123 ATTTATTTATTTTTGAGACAGGG - Intergenic
930974903 2:57445906-57445928 ATGCATGTATTCACGAAAAAAGG + Intergenic
931314441 2:61114661-61114683 ATACATATATTTTTGAGACAGGG + Intronic
931356714 2:61543499-61543521 ATATATTTATTTTTGAGACAGGG + Intergenic
931360671 2:61575160-61575182 ATGCAATTTTTTTTGAGACAGGG - Intergenic
931492564 2:62764695-62764717 AAGCATTCTTTTATCAAACAAGG - Intronic
931505076 2:62917284-62917306 ATTCATTCATTTTTGAGACAGGG - Intronic
931529283 2:63195468-63195490 ATGGATTTTTTTTTGAGACAGGG + Intronic
931559372 2:63541635-63541657 ATGCATTTATTGATAAGAGAAGG - Intronic
931731458 2:65157139-65157161 ATTTATTTATTTTTGAGACAGGG - Intergenic
931991810 2:67797715-67797737 TTGCATTTATTTCTGGCACATGG + Intergenic
932025002 2:68123819-68123841 ATTTATTTATTTTTGAGACAGGG + Intronic
932247885 2:70212457-70212479 CTGCATTTGTGTTTGAAACAAGG + Exonic
932327041 2:70870216-70870238 ATTAATTTATTTTTGAGACAGGG + Intergenic
932622932 2:73276628-73276650 ATGCATTTATATATAACACATGG + Intronic
932885786 2:75548137-75548159 ATTTATTTATTTTTGAGACAGGG + Intronic
933037315 2:77416699-77416721 AAGCCTTTTTTTATTAAACATGG - Intronic
933135829 2:78733939-78733961 ATTTATTTATTTATGAAAAGTGG - Intergenic
933440767 2:82311025-82311047 ATTTATTTATTTTTGAGACAGGG + Intergenic
933506087 2:83178595-83178617 ATTCATTTATTTATTTAAGATGG - Intergenic
933506230 2:83180708-83180730 ATTCATTTCTTTTTGAGACAAGG + Intergenic
933740365 2:85529249-85529271 CTGCCTTTTTTTTTGAAACAGGG + Intergenic
933874470 2:86604861-86604883 ATGGACTTATTTATTACACAAGG - Exonic
934065305 2:88335165-88335187 ATTCATTTATTTATTAGAGATGG - Intergenic
934068150 2:88359122-88359144 ATTTATTTATTTATGAAATATGG - Intergenic
934074997 2:88420649-88420671 ATTTATTTATTTTAGAAACAAGG - Intergenic
934102999 2:88670802-88670824 ATTTATTTATTTATGAGACAGGG - Intergenic
934103797 2:88678079-88678101 ATTTATTTATTTTTGACACATGG - Intergenic
934882661 2:97996755-97996777 ATTTATTTATTTTTGAGACAGGG + Intergenic
934944282 2:98526629-98526651 TAGCATTTATTTAAGAAAAATGG + Intronic
935119572 2:100172026-100172048 ATTTATTTATTTTTGAGACAGGG + Intergenic
935247033 2:101227685-101227707 ATTTATTTATTTTTGAGACAGGG + Intronic
935464610 2:103381620-103381642 ATTTATTTATTTTTGAAATAGGG + Intergenic
935501196 2:103841707-103841729 ATTTATTTATTTGGGAAACATGG + Intergenic
935521756 2:104115043-104115065 ATTTATTTATTTTTGATACAGGG - Intergenic
935522348 2:104123122-104123144 ATTCATTTATTTTTGAGACAAGG + Intergenic
935553780 2:104485098-104485120 ATACATATATTTAAGAGACAGGG - Intergenic
935642182 2:105301213-105301235 ATTTATTTATTTTTGAGACAGGG - Intronic
935740294 2:106141465-106141487 ATTTATTTATTTTTGAGACAGGG + Intronic
935855376 2:107267637-107267659 ATTCATTTATTTAGCAAACATGG + Intergenic
935890933 2:107677199-107677221 ATGCATAAATTAATGAAACATGG - Intergenic
936268291 2:111028181-111028203 ATTTATTTATTTTTGAGACAGGG - Intronic
936465713 2:112747520-112747542 ATGCAGGTGTTTATGAAAGAGGG + Intronic
936586632 2:113763909-113763931 ATTTATTTATTTTTGAGACAGGG - Intergenic
936866537 2:117081310-117081332 ATGTATTTTTTTTTGAGACAGGG + Intergenic
936887535 2:117330953-117330975 ATACATTTTTTTTTGAGACAGGG + Intergenic
936919504 2:117673234-117673256 AAGTACTTATTTATAAAACAGGG - Intergenic
936956439 2:118027146-118027168 ATTTATTTATTTTTGAAACAGGG - Intergenic
937342107 2:121097659-121097681 ATGTATTTATTTTTGAGACAGGG - Intergenic
937387847 2:121453286-121453308 ATTTATTTATTTTTGAGACAGGG - Intronic
937413928 2:121699422-121699444 ATGCATATTTTTTTGAGACAGGG - Intergenic
937662621 2:124447699-124447721 ATGTATTTATATAGGAAACAGGG + Intronic
937727235 2:125181428-125181450 ATTGATATATTTATTAAACAGGG + Intergenic
937824119 2:126345967-126345989 ATGCATTTATTTATGGAGTCAGG - Intergenic
937967271 2:127523201-127523223 ATGCTTTTTTTTTTGAGACAGGG - Intronic
938284489 2:130098187-130098209 ATTAATTTATTTTTGAGACAGGG - Intronic
938335128 2:130486753-130486775 ATTAATTTATTTTTGAGACAGGG - Intronic
938354697 2:130633916-130633938 ATTAATTTATTTTTGAGACAGGG + Intronic
938431118 2:131240704-131240726 ATTAATTTATTTTTGAGACAGGG + Intronic
938772986 2:134516552-134516574 ATTTATTTATTTTTGAGACAGGG - Intronic
938858087 2:135336679-135336701 ATGAATTTTTTTATGAAACAGGG + Intronic
939689952 2:145246312-145246334 AAGAATTTATTTAGAAAACAAGG - Intergenic
939920985 2:148112984-148113006 ATTTATTTATTTAAGAGACAGGG - Intronic
940179416 2:150915396-150915418 ATTTATTTATTTAAGAGACAGGG + Intergenic
940862663 2:158786921-158786943 ATGAATGTATTACTGAAACAGGG + Intergenic
940882459 2:158960223-158960245 ATGTATTGATTTTTGAGACAGGG - Intergenic
940926666 2:159371148-159371170 ATTTATTTATTTTTGAGACAGGG + Intronic
940965982 2:159837628-159837650 ATGTATTTATTTAAGATTCAGGG - Intronic
941176750 2:162206517-162206539 ATTCATTTTTTTTTGAACCAAGG + Intronic
941384217 2:164833345-164833367 ATTTATTTATTTTTGAGACAGGG - Intronic
941555764 2:166979128-166979150 ATGCCTTTTTTCATGGAACATGG + Intronic
941599603 2:167525638-167525660 TTGTATTTATTTTTGAGACAGGG + Intergenic
941727784 2:168882592-168882614 ATTTATTTATTTTTGAGACAGGG - Intronic
941957832 2:171222339-171222361 ATTTATTTATTTTTGAGACAGGG + Intronic
942160488 2:173180667-173180689 ATGGATTTATTTTTGAGACAAGG - Intronic
942199283 2:173554499-173554521 ATGTATTTATTTTTGAGACAGGG - Intergenic
942296044 2:174518176-174518198 ACGTATTTATTTTTGAGACAGGG + Intergenic
942537789 2:176983474-176983496 ATTTATTTATTTTTGATACAGGG - Intergenic
942562501 2:177235428-177235450 ATTTATTTATTTATGAGACAGGG - Intronic
942574320 2:177347266-177347288 ATTTATTTATTTTTGAGACAGGG + Intronic
943217877 2:185062258-185062280 GTGCATGCATTTATGTAACAAGG + Intergenic
943651639 2:190463811-190463833 ATTTATTTATTTTTGAGACAGGG - Intronic
944093269 2:195937895-195937917 AGACATTTATTAATGTAACAGGG + Intronic
944165868 2:196720111-196720133 AGGAATTTACTTATAAAACATGG - Intronic
944199662 2:197092326-197092348 ATGTGTTTCTTTATGAAGCATGG - Intronic
944289776 2:197992269-197992291 ATTAATTTATTTTTGAGACAGGG + Intronic
944460634 2:199945926-199945948 ATGCCCTTGTTTTTGAAACATGG - Intronic
944575655 2:201088733-201088755 ATTAATTCATTTATGAGACAGGG - Intergenic
944674159 2:202021103-202021125 ATTTATTTATTTATGAGACAGGG + Intergenic
944812604 2:203342584-203342606 ATTTATTTATTTTTGAGACAAGG + Intronic
944813714 2:203354049-203354071 ATTTATTTATTTTTGAGACAAGG + Intronic
945239771 2:207665802-207665824 ATTCTTTTTTTTTTGAAACAGGG + Intergenic
945583052 2:211621106-211621128 ATGTATTTATTCTTGAGACAGGG - Intronic
945824670 2:214706849-214706871 ATTCAGGTATTTCTGAAACAGGG - Intergenic
945832038 2:214799108-214799130 ATTTATTTATTTTTGATACAGGG - Intronic
945868923 2:215205883-215205905 AGGGCTTTATTTATAAAACAAGG + Intergenic
946232324 2:218299451-218299473 ATTCATTTATTTTTGAGACAGGG + Intronic
946442529 2:219708809-219708831 ATTTATTTATTTTTGAGACAGGG + Intergenic
946733029 2:222727352-222727374 ATTTATTTATTTTTGAGACAGGG + Intergenic
946842735 2:223834745-223834767 ATTTATTTATTTTTGAGACAGGG - Intronic
947036776 2:225867793-225867815 ATGCTTTTATATATGCATCATGG + Intergenic
947080280 2:226388274-226388296 ATTTATTTATTTACGAGACAGGG - Intergenic
947111551 2:226724308-226724330 ATTTATTTATTTCTGAAACAAGG + Intergenic
947145804 2:227063975-227063997 ATGCTTTTATTTGTTTAACAAGG + Intronic
947211014 2:227708637-227708659 AAGCATTTATCTATCAAAGAAGG - Intronic
947265700 2:228277594-228277616 ATTCATTTATTTTTGAGACAGGG - Intergenic
947487112 2:230561452-230561474 ATTTATTTATTTTTGAGACAAGG - Intergenic
947762684 2:232614992-232615014 TTGTATTTATTTATTAAAGATGG + Intronic
947865458 2:233395175-233395197 ATTTATTTATTTTTGAGACAAGG + Intronic
948002079 2:234576403-234576425 ATTTATTTATTTTTGAGACAGGG - Intergenic
948119558 2:235519077-235519099 ATGTGTTTATTTATGAGACAGGG + Intronic
948277825 2:236723638-236723660 ATGTATTTATTTTTGAGACAGGG + Intergenic
948352385 2:237351423-237351445 ATGCATTAATTTGTGAAAACTGG - Intronic
948360703 2:237418108-237418130 CTACATTTCTTTCTGAAACACGG - Intergenic
1168826005 20:814525-814547 ATTTATTTATTTTTGAGACAGGG + Intergenic
1169048221 20:2554289-2554311 ATCGATTTATTTTTGAGACAGGG - Intronic
1169071422 20:2734399-2734421 ATTAATTTATTTTTGGAACAGGG - Intronic
1169133068 20:3177249-3177271 ATTTATTTATTTTTGAGACAAGG - Intergenic
1169139616 20:3219872-3219894 ATTTATTTATTTTTGAGACAGGG - Intronic
1169300351 20:4436831-4436853 ATGTATATATTTTTGAGACAGGG + Intergenic
1169733380 20:8810964-8810986 ATTTATTTATTTTTGAGACAGGG - Intronic
1169789660 20:9395967-9395989 ACTCATTTATTTTTGAAACAAGG - Intronic
1169886559 20:10405091-10405113 ATACACTTATTTAGGAAAAAAGG - Exonic
1169922038 20:10745357-10745379 ATTCATTTGTTTCTGAAAGATGG - Intergenic
1170166943 20:13369437-13369459 ATTTATTTATTTTTGAGACAGGG - Intergenic
1170196941 20:13699116-13699138 ATTTATTTATTTTTGAGACAAGG + Intergenic
1170212708 20:13861180-13861202 ATTTATTTATTTTTGAGACAGGG + Intronic
1170560096 20:17549827-17549849 ATTTATTTATTTTTGAGACAGGG - Intronic
1170620144 20:17989080-17989102 ATTTATTTATTTTTGAGACAGGG - Intronic
1170630933 20:18064354-18064376 GTGCATTGATTTATGAGAGAGGG + Intergenic
1170651436 20:18246145-18246167 ATTAATTTATTTTTGAGACAGGG + Intergenic
1170654451 20:18273068-18273090 ATTCATTTATTTATGACACAGGG - Intergenic
1170824808 20:19784348-19784370 ATGCATTTAGTTATTACAAAGGG + Intergenic
1170995287 20:21349734-21349756 ATTTATTTATTTATGAGACAGGG - Intronic
1171019521 20:21572796-21572818 ATTTATTTATTTTTGAGACAGGG + Intergenic
1171224733 20:23432537-23432559 ATGCCTTTATTTATGGCAAATGG + Intergenic
1171983979 20:31646589-31646611 ATTTATTTATTTTTGAGACAAGG - Intergenic
1171999719 20:31764174-31764196 ATGTATATATTTTTGAGACAGGG + Intronic
1172121957 20:32603728-32603750 ATTTATTTATTTTTGAGACAGGG + Intronic
1172201217 20:33127388-33127410 ATTTATTTATTTTTGAGACAAGG - Intergenic
1172333183 20:34090751-34090773 ATTTATTTATTTATGAGACAGGG + Intronic
1172338768 20:34138615-34138637 ATTTATTTATTTTTGAGACAGGG - Intergenic
1172369401 20:34376439-34376461 ATGTATTTATTTTTGAGACACGG - Intronic
1172403526 20:34670544-34670566 ATTCTTTTATTTTTGAGACAAGG + Intronic
1172798212 20:37557973-37557995 ATTTATTTATTTTTGAGACAGGG - Intergenic
1172830481 20:37829836-37829858 ATGTATTTATTTAGGAGACAGGG + Intronic
1173075273 20:39812515-39812537 ATACATTTATTTAGTAACCAAGG - Intergenic
1173240129 20:41288031-41288053 ATTTATTTATTTTTGAGACAGGG + Intronic
1173535936 20:43813444-43813466 ATGTATTTATTTTTATAACAGGG + Intergenic
1173701018 20:45071773-45071795 ATTTATTTATTTTTGAGACAAGG + Intronic
1173712512 20:45172870-45172892 ATGCATTTATTTTGGATATATGG - Intergenic
1173734479 20:45349376-45349398 ATTTATTTATTTTTGAGACAGGG - Intergenic
1173789226 20:45816915-45816937 ATGCATTTATTTAATATACAAGG - Exonic
1173982078 20:47232358-47232380 ATTTATTTATTTTTGAGACAAGG - Intronic
1174142659 20:48427033-48427055 ATTTATTTATTTTTGAGACAGGG + Intergenic
1174229770 20:49036929-49036951 ATTTATTTATTTTTGAGACAGGG + Intergenic
1174250114 20:49213010-49213032 ATTTATTTATTTTTGAGACAGGG + Intergenic
1174263583 20:49315264-49315286 ATTCATTTATTTTTGAGACAGGG + Intergenic
1174292780 20:49520671-49520693 ATTTATTTATTTTTGAGACAGGG + Intronic
1174313913 20:49682087-49682109 ATTTATTTATTTTTGAGACAGGG - Intronic
1174443662 20:50575918-50575940 ATTTATTTATTTTTGAGACAGGG - Intronic
1174540159 20:51282913-51282935 ATTCATTCATTTTTGAGACAGGG - Intergenic
1174862664 20:54105887-54105909 TTGCATTTAATTTTGAATCAAGG + Intergenic
1174888676 20:54365158-54365180 ATGCATATGCTTATGAAAGATGG + Intergenic
1174895098 20:54440117-54440139 ATTTATTTATTTTTGAGACAGGG + Intergenic
1175180866 20:57146318-57146340 ATGAATTCATGTATGAATCAAGG - Intergenic
1175434949 20:58938792-58938814 AAGCATGTATTTAAGAAAAATGG - Intergenic
1176006248 20:62864685-62864707 ATGTATATATTTTAGAAACAGGG + Intergenic
1177063962 21:16406027-16406049 ATTAATTTATTTTTGAGACAGGG - Intergenic
1177081824 21:16649096-16649118 ATCCACTGATTTTTGAAACATGG + Intergenic
1177526114 21:22292559-22292581 ATTTATTTATTTTTGAAACGTGG + Intergenic
1177568810 21:22859629-22859651 ATGTATTTATTTTTGAGATAGGG + Intergenic
1177715850 21:24839283-24839305 ATTTATTTATTTTTGAGACATGG - Intergenic
1178180693 21:30157777-30157799 ATGCTTCTGTCTATGAAACATGG + Intergenic
1178196556 21:30351743-30351765 ATTTATTTATTTTTTAAACAGGG + Intronic
1178289749 21:31356945-31356967 ATTCATTTATTTTTTAAAGATGG - Intronic
1178295345 21:31405239-31405261 ATTTATTTATTTTTGAGACACGG - Intronic
1178394740 21:32233146-32233168 ATGCCTTTATTCAGAAAACAAGG - Intergenic
1178681671 21:34677573-34677595 ATCCATTTTTTGATGATACAGGG - Intronic
1178780403 21:35598006-35598028 TTGAATTTTTTTTTGAAACAGGG - Intronic
1178929867 21:36808129-36808151 ATGCATTTTTCTATGTTACATGG + Intronic
1179483904 21:41696997-41697019 ATTTATTTATTTTTGAGACAGGG + Intergenic
1179708944 21:43200833-43200855 ATTTATTGATTTTTGAAACAAGG + Intergenic
1179843672 21:44095054-44095076 AATTATTTATTTATGAGACAAGG + Intronic
1179896887 21:44368124-44368146 ATCTATTTATTTTTGAGACAGGG + Intronic
1180615822 22:17125928-17125950 ATTTATTTATTTTTGAGACAGGG - Intronic
1180659302 22:17452077-17452099 ATTTATTTATTTTTGAGACAGGG + Intronic
1180714885 22:17865117-17865139 ATTTATTTATTTAAGAGACAGGG + Intronic
1180926396 22:19558253-19558275 ATTTATTTATTTTTGAGACAGGG + Intergenic
1181284945 22:21745216-21745238 ATTTATTTATTTTTGAGACAGGG + Intergenic
1181737977 22:24896970-24896992 ATGTATTTATTTATTTAAGATGG - Intronic
1182297936 22:29320807-29320829 ATTTATTTATTTTTGAAACAGGG + Intergenic
1182333482 22:29567841-29567863 ATTTATTTATTTTTGAAACCAGG - Intronic
1182445872 22:30389137-30389159 ATGCATTTATTTTTGAGACAGGG + Intronic
1182562400 22:31170832-31170854 ATTTATTTATTTTTGAGACAAGG + Intronic
1182613117 22:31565691-31565713 ATTTATTTATTTTTGAGACAGGG - Intronic
1182660923 22:31924618-31924640 TTTCTTTTATTTTTGAAACAGGG - Intergenic
1182746880 22:32612830-32612852 ATTTATTTATTTAGGACACAGGG - Intronic
1183140591 22:35934939-35934961 ATTCATTTATTTTTGAGACAGGG + Intronic
1183559907 22:38564160-38564182 ATTCATTTATTTTTGAGACAAGG - Intronic
1183609504 22:38889615-38889637 ATTTATTTATTTTTGAGACAGGG + Intergenic
1183630800 22:39031560-39031582 ATTTATTTATTTTTGAGACAGGG - Intronic
1183637002 22:39070260-39070282 ATTTATTTATTTTTGAGACAGGG - Intronic
1183654850 22:39178681-39178703 ATTTATTTATTTTTGAGACAGGG - Intergenic
1183668570 22:39258761-39258783 ATTTATTTATTTTTGAGACAGGG - Intergenic
1183901805 22:41011343-41011365 ATTTATTTATTTTTGAGACAAGG + Intergenic
1184018740 22:41805903-41805925 ATTTATTTATTTTTGAGACAGGG - Intronic
1184208291 22:43019408-43019430 ATTTATTTATTTTTGAGACAGGG - Intergenic
1184216506 22:43070917-43070939 ATGTATTTATTTTTGAGACAGGG + Intronic
1184672529 22:46022652-46022674 ATTTATTTATTTTTGAGACAGGG - Intergenic
1184698734 22:46154677-46154699 ATTTATTTATTTTTGAGACAGGG + Intronic
1185157343 22:49202044-49202066 ATATATTTATTTTTGAGACAGGG + Intergenic
1185237510 22:49723340-49723362 ATGTATTTATTTTTGAGACAGGG - Intergenic
1185290708 22:50025631-50025653 ATTTATTTATTTTTGAGACAAGG - Intronic
1185361168 22:50407890-50407912 ATTTATTTATTTTTGAGACAGGG + Intronic
1185383302 22:50520256-50520278 ATTTATTTATTTTTGAGACAGGG + Intronic
949132159 3:516485-516507 ATCCCTTTATTAATGTAACACGG + Intergenic
949199143 3:1351624-1351646 ATGGATTATTTTATGAAAGATGG + Intronic
949239906 3:1858740-1858762 ATTCATTTATATATAATACATGG - Intergenic
950233985 3:11302460-11302482 ATGAATTTATTTATCAAAGAAGG + Intronic
950308302 3:11933959-11933981 ATTTATTTATTTTTGAGACAGGG + Intergenic
950484025 3:13262273-13262295 ATGTATTTATTTTTGAGGCAAGG - Intergenic
950510602 3:13423851-13423873 ATTTATTTATTTTTGAGACAGGG + Intergenic
950608715 3:14110192-14110214 ATGTATTTATTTTAGAAACAGGG - Intergenic
950648951 3:14395352-14395374 ATTTATTTATTTTTGAGACAGGG - Intergenic
950783289 3:15410897-15410919 TTTTATTTATTTATGAAACAGGG + Intronic
950783746 3:15414913-15414935 ATTTATTTATTTTTGAGACAGGG - Intronic
950877606 3:16290543-16290565 ATGTATTTATTTTTTAAACATGG + Intronic
950956632 3:17060321-17060343 AGGCATATATTTAAGAAACCTGG + Intronic
951213823 3:20005102-20005124 ATTTATTTATTTTTGAGACAGGG - Intronic
951221968 3:20078171-20078193 ATTTATTTATTTTTGAGACAGGG - Intronic
951554072 3:23903118-23903140 ATTTATTTATTTTTGAGACAGGG + Intronic
951556837 3:23929431-23929453 ATTTATTTATTTTTGAGACAGGG + Intronic
951758623 3:26119827-26119849 ATTTATTTATTTATGAGATAGGG + Intergenic
951959747 3:28304185-28304207 ATGTATTTTTTTAAGAGACAGGG - Intronic
951992631 3:28692675-28692697 ATTTATTTATTTAAGAGACAGGG + Intergenic
952587971 3:34916055-34916077 ATTTATTTATTTTTGAGACAGGG + Intergenic
952763955 3:36939128-36939150 ATTTATTTATTTATGAGACAGGG - Intronic
953139332 3:40212912-40212934 ATATATTTATTTTTGAGACAGGG - Intronic
953165267 3:40459175-40459197 ATTTATTTATTTTTGAGACAGGG - Intronic
953175012 3:40542942-40542964 ATGTATTTATTTTTGAGACAGGG + Intronic
953257990 3:41307821-41307843 ATGTATGTATGTATGAAACGGGG - Intronic
953306087 3:41831032-41831054 ATTGATTTATTTATTAGACAGGG + Intronic
953467766 3:43139062-43139084 AAGCATTAATTTAAGAAAAACGG - Intergenic
953581539 3:44161585-44161607 ATTCATTTATTCAAGAAACATGG - Intergenic
953593600 3:44285458-44285480 ATTTATTTATTTTTGAGACACGG - Intronic
953644998 3:44745744-44745766 ATTTATTTATTTTTGAGACAGGG + Intronic
954021447 3:47745720-47745742 ATTTATTTATTTTTGAGACAGGG - Intronic
954057233 3:48037398-48037420 CTTTATTTATTTATGAGACAGGG + Intronic
954063232 3:48086627-48086649 ATTTATTTATTTTTGAGACAGGG - Intronic
954094732 3:48316764-48316786 ATTCATTTATTTATGAGACCAGG - Intronic
954205563 3:49056493-49056515 AACCATTTACTTATGATACAAGG + Intronic
954281549 3:49582973-49582995 ATTTATTTATTTATGAGACAGGG + Intronic
954319963 3:49825572-49825594 TTTTATTTATTTATGAGACAGGG + Intergenic
954343386 3:49974234-49974256 ATTTATTTATTTTTGAGACAGGG + Intronic
954485066 3:50840738-50840760 CTCCATTTATTTTTGAAAAATGG - Intronic
954543762 3:51415486-51415508 ATTTATTTATTTTTGAGACAGGG - Intronic
954606410 3:51914019-51914041 TTGCATTTTTTTAAAAAACAGGG - Intergenic
954844359 3:53542571-53542593 ATTTATTTATTTAAGCAACAGGG - Intronic
954893875 3:53958683-53958705 ATTTATTTATTTTTGAGACAGGG - Intergenic
954902276 3:54030315-54030337 ATTTATTTATTTTTGAGACAGGG + Intergenic
954922011 3:54199370-54199392 ATTTATTTATTTTTGAGACAGGG + Intronic
955258184 3:57356434-57356456 ATTTATTTATTTTTGAGACAAGG - Intronic
955595759 3:60588653-60588675 ATTCATTTATTTTTGAGACAGGG + Intronic
955619467 3:60847129-60847151 ATGCTTTTGCTTATGAAATAAGG - Intronic
955633645 3:61002268-61002290 TTGCTTTTATTTTTGAGACAAGG + Intronic
956337670 3:68182200-68182222 ATTCATTTATGTTTGAGACAGGG - Intronic
956426247 3:69138760-69138782 ATTAATTTATTTTTGAGACAGGG + Intergenic
956683946 3:71807066-71807088 ATTTATTTATTTTTGAGACAAGG + Intergenic
956804130 3:72791578-72791600 AAGCATTTATTTATCAATCATGG + Intronic
956826259 3:72999367-72999389 ATTAATTTATTTTTGAAAGATGG - Intronic
956853257 3:73251956-73251978 TTGTATTTATTTTTGAGACAGGG + Intergenic
957161407 3:76614707-76614729 AGGCATTTATCCATCAAACATGG - Intronic
958144505 3:89606469-89606491 ATTTATTTATTTTTGAAGCAGGG - Intergenic
958268969 3:91474662-91474684 GTGCATTTATTTCAGAAATACGG + Intergenic
958704215 3:97633402-97633424 ATGAATTTTTTTATGACATATGG - Intronic
958791526 3:98656909-98656931 ATTTATTTATTTTTGAGACAGGG + Intergenic
958860517 3:99439603-99439625 AATCACTTATTTATGAAAAAGGG + Intergenic
958893264 3:99803899-99803921 ATTTATTTATTTTTGAGACAGGG + Intergenic
959044922 3:101463340-101463362 ATTTATTTATTTATGATACATGG - Intronic
959515341 3:107260047-107260069 ATTTATTTATTTTTGAGACAGGG - Intergenic
959709375 3:109369866-109369888 TTTCATTTATTTTTGAGACAGGG + Intergenic
959950059 3:112170602-112170624 ATGCATATATTTATCTAAAAAGG - Intronic
960228909 3:115201554-115201576 ATTTATTTATTTTTGAGACAGGG + Intergenic
960392594 3:117096838-117096860 ATTTATTTATTTTTGAGACAAGG - Intronic
960615809 3:119595090-119595112 ATTTATTTATTTTTGAGACAGGG - Intergenic
960837072 3:121917679-121917701 ATTTATTTATTTTTGAGACAGGG - Intronic
960857859 3:122121521-122121543 ATGCATTTATTTTATAATCATGG - Intergenic
961851320 3:129822054-129822076 ATGTATTTATATTTGAGACAGGG - Intronic
961900951 3:130211370-130211392 AAACATTTTTTTAAGAAACATGG + Intergenic
962035619 3:131648364-131648386 ATGTATTTAATTTTGAGACAGGG - Intronic
962132162 3:132692606-132692628 ATTTATTTATTTAAGAAACAGGG - Intronic
962189262 3:133292949-133292971 ATGCTTTTATTTCTGAGACCAGG + Intronic
962527152 3:136247118-136247140 ATTTATTTATTTTTGAGACAGGG - Intergenic
962549195 3:136471842-136471864 ATTTATTTATTTTTGACACAGGG + Intronic
962579275 3:136783180-136783202 ATTTATTTATTTTTGACACAGGG - Intergenic
963024975 3:140910689-140910711 ATTTATTTATTTTTGAGACAGGG - Intergenic
963125042 3:141808313-141808335 ATACATTTATTTACTCAACATGG - Intronic
963172155 3:142261951-142261973 ATGTATTTATTTTTGAGACAGGG - Intergenic
963293968 3:143524549-143524571 ATGCATATTTTTTTGAAATAAGG + Intronic
963886922 3:150593390-150593412 ATACTTTTTTTTTTGAAACAGGG + Intronic
963902928 3:150749499-150749521 ATGTATGTATTTTTGAGACAGGG - Intronic
963964912 3:151356383-151356405 ATTTATTTATTTTTGAGACAGGG - Intronic
964009120 3:151868501-151868523 ATTTATTTATTTTTGAGACAGGG - Intergenic
964106377 3:153044532-153044554 ATTTATTTATTTTTGAGACAGGG - Intergenic
964166778 3:153716570-153716592 ATGCATTTGTGAATAAAACAAGG - Intergenic
964253224 3:154744564-154744586 ATGTATTTATTTTTGAGACAGGG - Intergenic
964264886 3:154883872-154883894 ATTCATTTTTTTTTGAGACAGGG - Intergenic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
964575467 3:158161753-158161775 ATGTATGTATTTTTGAGACATGG - Intronic
964782651 3:160358015-160358037 ATTTATTTATTTTTGAGACAGGG + Intronic
964798319 3:160524347-160524369 ATTTATTTATTTTTGAGACAGGG + Intronic
964903826 3:161693828-161693850 ATGCATTTATCTTAGAAACTTGG + Intergenic
965097139 3:164245237-164245259 ATGCATTTTTTTAAGAGACGTGG + Intergenic
965199393 3:165636924-165636946 ATTTATTTATTTTTGAGACAGGG - Intergenic
965606530 3:170502902-170502924 ATACTTTTATTTTAGAAACAAGG - Intronic
965874940 3:173305482-173305504 ATGTATTTATTTAAGAGACTGGG + Intergenic
965893469 3:173544358-173544380 ATGCATTTATTTCAGACATAAGG + Intronic
965957243 3:174386159-174386181 ATCTTTTTATCTATGAAACAGGG - Intergenic
966010183 3:175065604-175065626 ACACATTTATGTTTGAAACAAGG + Intronic
966183599 3:177208711-177208733 ATTTGTTTATTTGTGAAACAGGG - Intergenic
966198648 3:177338884-177338906 ATGCATTTTATGGTGAAACAAGG - Intergenic
966205865 3:177405854-177405876 ATGCAATTATTTATTACAGAAGG - Intergenic
966270890 3:178104349-178104371 ATTTATTTATTTTTGAGACAGGG + Intergenic
966359268 3:179117016-179117038 ATGGATCCATTTATGATACATGG - Intergenic
966389838 3:179440618-179440640 ATGGATCCATTTATGATACATGG - Intronic
966511878 3:180773419-180773441 ATGAATTCATGTATGAAAAAGGG - Intronic
966689436 3:182727818-182727840 ATTTATTTATTTTTGAGACAGGG - Intergenic
966692297 3:182754358-182754380 ATTTATTTATTTTTGAGACAAGG + Intergenic
967022000 3:185530859-185530881 ATTTATTTATTTTTGAGACAGGG - Intronic
967242057 3:187449234-187449256 ATGCATTCATTTTTCAGACAAGG + Intergenic
967410696 3:189163955-189163977 ATGCATTTTTTTTTCAAATAAGG + Intronic
967934091 3:194712648-194712670 ATTTATTTATTTTTGAGACAGGG - Intergenic
968194716 3:196696632-196696654 ATTTATTTATTTTTGAGACAAGG + Intronic
968379334 4:76238-76260 ATGTATTTATTTTAGAGACACGG + Intronic
968395854 4:237018-237040 ATGTACTTATTTAAGAGACAGGG + Intergenic
968399693 4:282337-282359 ATGTATTTATTTTAGAGACAGGG - Intronic
968413900 4:411971-411993 ATTCATTTATTAATAAAACTTGG + Intergenic
968668732 4:1836209-1836231 ATTTATTTATTTTTGAAACAGGG - Intronic
968794817 4:2696019-2696041 ATTTATTTATTTTTGAGACAAGG - Intronic
969084415 4:4645108-4645130 ATGTATTTATTTTTGAGACAGGG - Intergenic
969395918 4:6921209-6921231 ATTTATTTATTTTTGAGACAGGG + Intronic
969565558 4:7975209-7975231 ATGAATTTTTTTTTGAGACAGGG - Intronic
969693393 4:8720476-8720498 ATTCATTTATTTTTGAGACAGGG - Intergenic
970237027 4:13969273-13969295 ATTTATTTATTTTTGAGACAAGG + Intergenic
970396214 4:15669524-15669546 AAGCATTTTTTTTTGAGACAAGG - Intronic
970418412 4:15882013-15882035 CTACAGTTGTTTATGAAACACGG + Intergenic
970499176 4:16659695-16659717 ATGTATGTATATATGTAACAAGG + Intronic
970764760 4:19534305-19534327 ATGCATTGAGTTTTGAAGCAGGG - Intergenic
971001819 4:22332151-22332173 ATGTATTTATTCTAGAAACAGGG - Intergenic
971251721 4:24978122-24978144 ATTTATTTATTTTTGAGACAGGG - Intronic
971302263 4:25451368-25451390 ATTTATTTATTTCCGAAACAGGG - Intergenic
972228446 4:37042503-37042525 ATTTATTTATTTCTGAGACAGGG + Intergenic
972437703 4:39049688-39049710 ATTTATTTATTTTTGAGACAAGG - Intronic
972498901 4:39659422-39659444 ATGCATATATTTAATAAATATGG - Intergenic
972596849 4:40537116-40537138 ATTTATTTATTTTTGAGACAGGG + Intronic
972683635 4:41330618-41330640 ATTTATTTATTTTTGAGACAGGG + Intergenic
972840509 4:42924730-42924752 ATGCATTTATTTATGATATTTGG - Intronic
972846050 4:42990822-42990844 ATGCATATATATATGTAAAAAGG - Intronic
972945231 4:44246106-44246128 ATGTATTTATTTCTGTTACATGG + Intronic
972950321 4:44313735-44313757 AAGCATTTATTTATTAAACTAGG - Intronic
973022898 4:45225483-45225505 ATATATTTATTTATTAAAAATGG + Intergenic
973027071 4:45285251-45285273 ATGTATGCATTTATGGAACATGG - Intergenic
973108531 4:46371505-46371527 ATACATTTTTTTATAAAGCAAGG + Intronic
973627765 4:52790160-52790182 ATTTATTTATTTTTGAGACAGGG + Intergenic
973777539 4:54257020-54257042 TTTAATTTGTTTATGAAACAGGG - Intronic
973800224 4:54470480-54470502 ATTTATTTATTTTTGAGACAAGG - Intergenic
973821380 4:54664613-54664635 ATTTATTTATTTATGAGACAGGG + Intronic
973833545 4:54786545-54786567 ATTTATTTATTTTTGAGACAAGG + Intergenic
973931723 4:55799940-55799962 ATTTATTTATTTTTGAGACAGGG - Intergenic
974049692 4:56928903-56928925 ATTGATTTATTTTTGAGACAGGG + Intronic
974093784 4:57339505-57339527 AAGCATTTATTAAGGAAAGATGG - Intergenic
974231575 4:59122560-59122582 ATTTATTTATTTTTGAGACAGGG + Intergenic
974700280 4:65434677-65434699 TTGCATTAATTTATGTAAAAGGG - Intronic
974805513 4:66874860-66874882 ATTTATTTATTTTTGAGACAGGG - Intergenic
974907788 4:68078572-68078594 ACTCATTTATTTGTCAAACATGG - Intronic
975023208 4:69516609-69516631 ATGTATTTATTTATTTAAGACGG + Intronic
975156341 4:71076979-71077001 ATGTATTTTTTTTTGAGACAGGG - Intergenic
975160278 4:71116981-71117003 ATTTATTTATTTTTGAGACAGGG + Intergenic
975263340 4:72331463-72331485 ATGCATCTCTTTCTAAAACACGG + Intronic
975487199 4:74947332-74947354 ATTCATTTATTGAAGAAACCTGG - Intronic
975565545 4:75750489-75750511 ATTTATTTATTTTTGAGACAGGG + Intronic
975582735 4:75921438-75921460 ATTCATTTATTATTTAAACAGGG + Intronic
975659116 4:76670937-76670959 ATTTATTTATTTTTGAAACAGGG - Intronic
975679535 4:76862370-76862392 ATTTATTTATTTTTGAGACAGGG + Intergenic
975797304 4:78020978-78021000 ATGTATTTATTGGTAAAACAGGG + Intergenic
975898715 4:79124220-79124242 ATGCATTTTTTTATAATAGAAGG + Intergenic
976200771 4:82576451-82576473 ATCTATTTATTTATTAATCAGGG + Intergenic
976210309 4:82662057-82662079 ATTTATTTATTTATGAGACAGGG + Intronic
976523974 4:86064910-86064932 ATTTATTTATTTTTGAGACAGGG + Intronic
976573716 4:86643138-86643160 ATTCTTTTATTTATTAGACAGGG - Intronic
976575271 4:86662801-86662823 ATGCATTTGTATATCAGACAGGG + Intronic
976596400 4:86899082-86899104 CTGTATTTATTTTTGAGACAGGG - Intronic
976936558 4:90642846-90642868 ATGTATTTATTTTTGAGACAGGG - Intronic
977142134 4:93386915-93386937 ATGCAAATATGTATAAAACATGG + Intronic
977229349 4:94433319-94433341 ATTTATTTATTTTTGAGACAGGG - Intergenic
977319271 4:95490489-95490511 ATGTATATATCTATGAAATAAGG + Intronic
977672054 4:99706650-99706672 ACTTATTTATTTTTGAAACAGGG + Intergenic
977943395 4:102882183-102882205 ATTTATTTATTTTTGAGACAGGG - Intronic
978103208 4:104868799-104868821 ATGTATATATATATGAGACAAGG + Intergenic
978190505 4:105905479-105905501 ATGCCATCATTTATGAAAAAGGG - Intronic
978411514 4:108431058-108431080 ATTTATTTATTTTTGAGACAGGG - Intergenic
978706231 4:111715119-111715141 ATTTATTTATTTTTGAAACAGGG - Intergenic
978706248 4:111715321-111715343 ATTTATTTATTTTTGAAACAGGG - Intergenic
978869590 4:113558973-113558995 ATTTATTTATTTTTGAGACAGGG - Intronic
979150978 4:117313816-117313838 ATTTATTTATTTTTGAGACAGGG - Intergenic
979402981 4:120273709-120273731 AAGCATTTATTTTTTTAACATGG + Intergenic
979594127 4:122514328-122514350 ATACATATATTTTTGAGACAGGG - Intergenic
979858889 4:125668649-125668671 ATGCATCTATTTAAGAACAAGGG + Intergenic
980173757 4:129320790-129320812 ATTTATTTATTTTTGAGACAGGG + Intergenic
980567206 4:134559391-134559413 ATGCATTTGTTAATTAAATATGG + Intergenic
980678362 4:136121026-136121048 ATATACTAATTTATGAAACATGG + Intergenic
981029782 4:140112808-140112830 ATGCAATTATATATGTAAAATGG - Intronic
981056478 4:140367228-140367250 ATTTATTTATTTATGAGAAATGG - Intronic
981130799 4:141156285-141156307 ATTTATTTATTTCTGAGACAGGG + Intronic
981363823 4:143878138-143878160 ATGTATTTGTTTTTGAGACATGG + Intronic
981374553 4:143998910-143998932 ATGTATTTGTTTTTGAGACAGGG + Intronic
981384878 4:144118219-144118241 ATGTATTTGTTTTTGAGACAGGG + Intronic
981792410 4:148553341-148553363 ATGTATTTATTTTTGGAACAGGG - Intergenic
981799953 4:148644539-148644561 ATTTATTTATTTTTGAGACAGGG + Intergenic
981981126 4:150792513-150792535 ATTTATTTATTTTTGAGACAGGG + Intronic
982038616 4:151372558-151372580 ATGCATATTATTATGAAAGAAGG + Intergenic
982272776 4:153608111-153608133 TTGCTTTTATTTTTGAGACAGGG - Intronic
982394760 4:154904041-154904063 ATTTATTTATTTTTGAGACAAGG - Intergenic
982485600 4:155961845-155961867 ATATATATATTTATGAGACAGGG + Intergenic
982515548 4:156343940-156343962 ATGCATTTTTTCATGCAAAAAGG - Intergenic
982623721 4:157737589-157737611 ATTTATTTATTTTTGAGACAGGG - Intergenic
982740888 4:159055701-159055723 ATTTATTTATTTTTGAGACAGGG - Intergenic
982741616 4:159062675-159062697 TTGCATTTTTTTTTGAAACAGGG + Intergenic
982881664 4:160726718-160726740 TTGCATTTAGTTTTGAAACATGG - Intergenic
983182591 4:164666551-164666573 ATTATTTTTTTTATGAAACAGGG - Intergenic
983304168 4:165964928-165964950 ATTTATTTATTTTTGAGACACGG - Intronic
983746835 4:171211472-171211494 ATTTATTTATTTTTGAGACAGGG - Intergenic
983806887 4:172005129-172005151 ATTTATTTATTTTTGAGACAGGG + Intronic
983823389 4:172225747-172225769 ATTTATTTATTTTTGAAACTGGG - Intronic
983911204 4:173241635-173241657 ATACCTTTGTTTTTGAAACAGGG + Intronic
983922852 4:173365881-173365903 ATGCATTGATTCAGGCAACATGG - Intergenic
984551507 4:181165240-181165262 ATGGATATATTTTTGAGACAGGG - Intergenic
984752198 4:183288926-183288948 ATGTATTTATTTATTACACTAGG + Intronic
984974785 4:185220868-185220890 ATTTATTTATTTTTGAGACAGGG + Intronic
985131437 4:186742100-186742122 ATTCATTTATTTTTGAGACAGGG + Intergenic
985181994 4:187274695-187274717 ATGCAATTATTTTAGAATCATGG - Intergenic
985276272 4:188240869-188240891 ATTTATTTATTTATAAGACAGGG - Intergenic
985328822 4:188803856-188803878 ATGTATTTATTTTTGAGACAGGG + Intergenic
985611151 5:890184-890206 TTTAATTTATTTTTGAAACATGG - Intronic
985955544 5:3262902-3262924 CTGCATTTAATTAGTAAACATGG - Intergenic
986070981 5:4282326-4282348 ATTTATTTATTTTTGAGACAAGG - Intergenic
986127673 5:4898614-4898636 TTACATTTATTTAGGAACCATGG - Intergenic
986408008 5:7446521-7446543 ATGTATTTATTTCAGAGACAAGG - Intronic
986586000 5:9319195-9319217 ATTTATTTATTTTTGAGACAGGG - Intronic
986588486 5:9344425-9344447 ATGGATTAATTTATCAAAAATGG + Intronic
986699466 5:10391902-10391924 ATGTTTTTTTCTATGAAACAGGG + Intronic
986807378 5:11321035-11321057 CTGCATTTATTTGAGAAAAAAGG - Intronic
987350350 5:17016573-17016595 ATTTATTTATTTTTGAGACAGGG + Intergenic
987379798 5:17275020-17275042 ATGTATTTATTTTTGAGACAGGG - Intronic
987454863 5:18130792-18130814 ATTTATTTATTTATGAAACAGGG - Intergenic
987622213 5:20349118-20349140 ATTCCTTTAGTTATGGAACAAGG - Intronic
988225725 5:28409499-28409521 ATTTATTTATTTTTGAGACAGGG + Intergenic
988385410 5:30557958-30557980 ATTTATTTATTTTTGAGACAGGG - Intergenic
988468563 5:31514636-31514658 ATTTATTTATTTTTGAGACAGGG - Intronic
988487465 5:31678620-31678642 ATTTATTTATTTATGAGACAGGG + Intronic
988588837 5:32531284-32531306 ATTTATTTATTTTTGAGACAAGG + Intergenic
988679626 5:33472197-33472219 ATTTATTTATTTTTCAAACAGGG - Intergenic
988888491 5:35586679-35586701 AAGCATTTATTGATGAATAAAGG - Intergenic
989207426 5:38824969-38824991 AGGCATTAATTTATCAAACTTGG - Intergenic
989225122 5:39018332-39018354 ATGGCTATATTTATGAAATATGG + Intronic
989316725 5:40089241-40089263 TTGTATTTATGTATAAAACAAGG + Intergenic
989365949 5:40655568-40655590 ATTCATTTATTTATCAGCCATGG - Intergenic
989395035 5:40945855-40945877 ATGTATTTTTTTTTGAGACAGGG - Intronic
990398710 5:55413376-55413398 ATGTATGTATGTATGAGACAGGG - Intronic
990403429 5:55463772-55463794 ATTTATTTATTTATGGGACAGGG - Intronic
990431062 5:55736245-55736267 ATTTATTTATTTTTGAGACAAGG - Intronic
990517222 5:56541624-56541646 ATGCATTTTTTTAAGAGACAGGG - Intronic
990613539 5:57483869-57483891 CTGTATTTCTATATGAAACATGG - Intergenic
990887812 5:60614982-60615004 ATTTATTTATTTTTGAGACAGGG - Intronic
990915965 5:60906164-60906186 ATTTATTTATTTATGAGACCAGG + Intronic
990948810 5:61276434-61276456 ATTTATTTATTTTTGAGACAGGG + Intergenic
991719791 5:69484647-69484669 ATTTATTTATTTTTGAGACAAGG - Intergenic
991919677 5:71642994-71643016 ATTTATCTATTTATGAGACAGGG - Intronic
991998646 5:72413721-72413743 ATTTCTTTATTTATGACACAAGG + Intergenic
992116436 5:73542786-73542808 ATTTATTTATTTTTGACACAAGG + Intergenic
992319158 5:75593447-75593469 AACCAATTATTTATAAAACATGG - Intronic
992319192 5:75593834-75593856 ATTTATTTATTTATGAGACAGGG - Intronic
992418047 5:76571881-76571903 ATGCATTTATTTGTGTAAGTGGG + Intronic
992451155 5:76877244-76877266 ATGCTTTTATTTATAAAATTGGG - Intronic
992598569 5:78371740-78371762 AAGCATTTATTTTTTAAAAAAGG - Intronic
992803663 5:80316062-80316084 ATTAATTTATTTTTGAGACAGGG + Intergenic
992819748 5:80484593-80484615 ATTTATTTATTTATGAGACAGGG + Intergenic
992830329 5:80587583-80587605 AGGCTTTTTTTTTTGAAACAGGG - Intergenic
992835561 5:80637603-80637625 ATTCATTTATTTTTGAGACAGGG - Intronic
992871908 5:81014924-81014946 ATGTATTTATTTTTGAGACAGGG + Intronic
993039567 5:82797508-82797530 ATTCATTTTTTGAAGAAACAGGG - Intergenic
993156206 5:84227795-84227817 CTGCATTAATTTTTGAATCATGG - Intronic
993167094 5:84370790-84370812 ATGCATTGACTTGTGAATCATGG - Intronic
993260041 5:85646303-85646325 ATTTGTTTATTTATGAGACAGGG - Intergenic
993388722 5:87291522-87291544 ATTTATTTATTTAGGAGACAGGG - Intronic
993716170 5:91277664-91277686 ATTCACTTATTTAGAAAACAAGG - Intergenic
993722023 5:91331052-91331074 ATTTATTTATTTATGAGACAGGG + Intergenic
993831663 5:92767605-92767627 ATACATTTATTTATGAAAAAAGG - Intergenic
993932495 5:93956914-93956936 ATTCATTTTTTTAAGAAATAAGG + Intronic
994084064 5:95739555-95739577 ATGTATATATTTTTGAGACAGGG + Intronic
994177300 5:96724814-96724836 ATTTATTTATTTTTGAGACAGGG - Intronic
994181711 5:96774626-96774648 ATGCCTTGATTAATGAAACATGG - Exonic
994186933 5:96825034-96825056 ATTTATTTATTTTTGAGACAGGG - Intronic
994425858 5:99586439-99586461 ATTCATTCATTTGTGAGACAGGG + Intergenic
994458188 5:100041303-100041325 ATACATATATTAATGAAAAAGGG + Intergenic
994468634 5:100172317-100172339 ATGCATTCATTTTTTAACCATGG + Intergenic
994563784 5:101413659-101413681 ATGCACCTATTCATGAATCAGGG + Intergenic
994569538 5:101497851-101497873 AGGTATTTATTTTAGAAACAGGG + Intergenic
994703606 5:103170211-103170233 ATGAATTTATTTAAGTTACAAGG - Intronic
994807368 5:104466897-104466919 ATGCATTCATTGATTAAAGATGG - Intergenic
995139618 5:108720792-108720814 TTGCATTTCTTTCTGAAGCATGG + Intergenic
995362545 5:111314130-111314152 ATGCATTTATTTAATATATAAGG + Intronic
995726354 5:115184784-115184806 AAACATTTATTTATGAAAATAGG + Intergenic
996034678 5:118745377-118745399 ATTTATTTATTTTTGATACAGGG - Intergenic
996106784 5:119514135-119514157 ATGCAATGATTTTTGAAAAACGG + Intronic
996268753 5:121577126-121577148 ATGCATTTACTAATAAACCAAGG + Intergenic
996592919 5:125168119-125168141 ATTCAAATATTTATGAAAAATGG + Intergenic
996815460 5:127568791-127568813 TTCCTTTTTTTTATGAAACAAGG - Intergenic
996822827 5:127649577-127649599 ATGCCTTTATTTTTAAAGCATGG + Intronic
996888970 5:128394790-128394812 ATACATATATTTTTGAGACAGGG + Intronic
996891921 5:128430841-128430863 ATTTATTTATTTTTGAGACAGGG - Intronic
996986270 5:129568813-129568835 ATTTATTTATTTAAGAGACAAGG - Intronic
997266536 5:132498073-132498095 AGGCATGCATTTAGGAAACATGG - Intergenic
997301815 5:132812019-132812041 ATTTATTTATTTATGAGACAGGG + Intergenic
997437649 5:133886504-133886526 ATGTATGTATATATAAAACAAGG - Intergenic
997906651 5:137823617-137823639 ATTTATTTATTTTTGAGACAGGG - Intergenic
997972481 5:138414948-138414970 ATTTATTTATTTTTGAGACAAGG - Intronic
998075526 5:139233097-139233119 ATTTATTTACTTATGAGACAGGG - Intronic
998131333 5:139652646-139652668 ATACATGGATTTATGAATCAGGG + Intronic
998141831 5:139704242-139704264 ATTTATTTATTTGTGAGACAGGG + Intergenic
998296670 5:140976542-140976564 ATTTATTTATTTATGAGATAGGG - Intronic
998425205 5:142020836-142020858 ATTTATTTATTTTTGAGACAGGG + Intergenic
998436754 5:142116715-142116737 ATTTATTTATTTTTGAGACAGGG + Intronic
998839176 5:146235023-146235045 ATTTATTTATTTTTGAGACAGGG - Intronic
998971823 5:147600812-147600834 ATGCATGTATTCATGAGACATGG + Intronic
999210246 5:149882041-149882063 ATTTATTTATTTTTGAGACAGGG - Intronic
999407866 5:151323226-151323248 ATCTATTTATTTTTGAGACAGGG - Intronic
999453813 5:151698298-151698320 ATCTATTTATTTTTGAGACAGGG - Intergenic
999472422 5:151867102-151867124 ATGTATTTATTTTTGAGACAGGG - Intronic
999725936 5:154437777-154437799 ATTCTTTTTTTTATGAGACAGGG - Intergenic
999831075 5:155320848-155320870 ATTTATTTATTTTTGAGACAGGG + Intergenic
999989991 5:157040892-157040914 ATTTATTTATTTTTGAGACAGGG - Intronic
1000202417 5:159024709-159024731 ATGTATTTATTTTTTAAAGAAGG - Intronic
1000268757 5:159663050-159663072 ATTTATTTATTTTTGATACAGGG + Intergenic
1000292103 5:159879987-159880009 ATTTATTTATTTTTGAGACAGGG - Intergenic
1000910410 5:167014841-167014863 ATGCATTTATTTAGGGCAAAAGG - Intergenic
1000966968 5:167668945-167668967 ATTTATTTATTTTTGAGACAAGG - Intronic
1001580107 5:172792426-172792448 ATTTATTTATTTATTAGACAGGG + Intergenic
1001644504 5:173270076-173270098 ATTTATTTATTTTTGAGACAGGG + Intergenic
1001759639 5:174196653-174196675 ATTTATTTATTTTTGAGACAGGG - Intronic
1001853796 5:174993123-174993145 ATGCATTTCTTCATGCAACATGG - Intergenic
1001935816 5:175703994-175704016 ATGTATTTATTTTTAAAATATGG - Intergenic
1002014704 5:176311240-176311262 ATTTATTTATTTTTGAGACAGGG + Intronic
1002052961 5:176582025-176582047 ATTTATTTATTTTTGAGACAGGG + Intronic
1002459243 5:179364664-179364686 ATCTATTTATTTCTGAGACAGGG + Intergenic
1002938632 6:1696948-1696970 AAGCATTTGTTTTTGAAAGATGG + Intronic
1003517644 6:6830937-6830959 ATTTATTTATTTTTGAGACAGGG - Intergenic
1003519960 6:6850070-6850092 ATTTATTTATTTTTGAGACAGGG + Intergenic
1003522368 6:6869044-6869066 ATGCCTTTATTTGTGAAAAGGGG - Intergenic
1003526230 6:6899930-6899952 AAGTATTTTTTTTTGAAACAGGG - Intergenic
1003870919 6:10402609-10402631 TCGCATATATTTGTGAAACAGGG - Exonic
1004113063 6:12739544-12739566 ATTTATTTATTTTTGAGACAGGG + Intronic
1004509040 6:16269788-16269810 ATTTATTTATTTTTGAGACAGGG - Intronic
1004536784 6:16510729-16510751 ATTTATTTATTTATGAGACAGGG - Intronic
1004591025 6:17052003-17052025 ATTTATTTATTTTTGAGACAAGG + Intergenic
1004733035 6:18376998-18377020 ATACATATATATATAAAACAAGG - Intergenic
1004991462 6:21143025-21143047 ATGCATTTTTCTCTGTAACAAGG - Intronic
1005091758 6:22063851-22063873 ATTTATTTATTTCTGAGACAGGG - Intergenic
1005372185 6:25145088-25145110 ATTTATTTATTTAAGATACAGGG - Intergenic
1005380803 6:25232275-25232297 TTGTATTAATTTATGAGACACGG - Intergenic
1005414892 6:25589493-25589515 ATTTATTTATTTTTGAGACAGGG + Intronic
1005516906 6:26563789-26563811 ATTTATTTATTTATGACACAGGG + Intergenic
1005571974 6:27153973-27153995 ATTCATTTATTTTTGAGATAGGG - Intergenic
1006481248 6:34296260-34296282 ATTTATTTATTTTTGAGACATGG - Intronic
1006552680 6:34838134-34838156 ATGCAATTATTTATCTTACAAGG + Intronic
1006644181 6:35504940-35504962 ATTCATTTATTTTTGAGGCAGGG + Intronic
1006692086 6:35897519-35897541 ATTCATTCATTTATGAGACAGGG + Intronic
1006775768 6:36591365-36591387 ATTTATTTATTTATAAGACACGG + Intergenic
1006812575 6:36829488-36829510 ATTTATTTATTTTTGAGACAGGG - Intronic
1006936449 6:37722089-37722111 ATTTATTTATTTTTGAGACAGGG + Intergenic
1006938015 6:37732001-37732023 ACCCATTTATCTGTGAAACAGGG - Intergenic
1007018066 6:38489462-38489484 ATTTATTTATTTTTGAGACAGGG - Intronic
1007103254 6:39265813-39265835 ATTTATTTATTTTTGAGACAGGG + Intergenic
1007480546 6:42146842-42146864 ATTTATTTATTTTTGAGACAGGG - Intergenic
1007551846 6:42735899-42735921 ATTTATTTATTTTTGAGACAGGG - Intergenic
1007601408 6:43084135-43084157 ATTTATTTATTTTTGAGACAGGG + Intronic
1007638963 6:43320892-43320914 ATTTATTTTTTTAAGAAACAGGG - Intronic
1007792903 6:44323264-44323286 ATTTATTTATTTTTGAGACAAGG + Intronic
1007862932 6:44933211-44933233 ATACATTTATTTATCATACCTGG + Intronic
1008142237 6:47845207-47845229 ATGCATTAAATTCTGAAAGATGG - Intergenic
1008186428 6:48397021-48397043 ATACATTTATTTTGAAAACATGG - Intergenic
1008398763 6:51039511-51039533 ATTTATTTATTTTTGAGACAGGG + Intergenic
1008674908 6:53808843-53808865 ATTTATTTGTTTTTGAAACAGGG - Intronic
1009372998 6:62931651-62931673 ATTTATTTATTTTTGACACAGGG + Intergenic
1009406032 6:63313827-63313849 ATTTATTTATTTTTGAGACAGGG - Intronic
1009631269 6:66203580-66203602 ATTTATTTATTTTTGAGACAAGG + Intergenic
1009711189 6:67323514-67323536 ATGCACATATTTTTCAAACACGG - Intergenic
1009790009 6:68390295-68390317 ATAGTTTTATTTTTGAAACAGGG + Intergenic
1010047804 6:71467573-71467595 TTGCATGTATTTATGAAGAAGGG - Intergenic
1010122930 6:72400214-72400236 ATGTATTTATTTCTTTAACATGG + Intronic
1010161574 6:72862632-72862654 ATTTATTTATTTTTGAGACAGGG + Intronic
1010510854 6:76717425-76717447 ATGCAGATGTTTGTGAAACAGGG - Intergenic
1010626869 6:78147948-78147970 CTGCATATATTTTTGAATCAGGG - Intergenic
1010752350 6:79629949-79629971 TTGCATTTATATAGGAAATACGG + Intergenic
1010915377 6:81610721-81610743 ATTTATTTATTTTTGAGACAAGG - Intronic
1010930259 6:81792981-81793003 ATGCATTGAATTGTGACACATGG - Intergenic
1011494391 6:87924286-87924308 ATTTATTTATTTTTGAGACAGGG - Intergenic
1011675137 6:89725575-89725597 ATGCTTTTGTTTTTGAGACAGGG + Intronic
1011685916 6:89823404-89823426 ATGTATATATTTTAGAAACAGGG + Intergenic
1011698943 6:89937534-89937556 ATTCATTTTTTTTTGAGACAGGG + Intronic
1011710822 6:90052424-90052446 ATCTATTTATTTTTGAGACAGGG + Intronic
1012090502 6:94888635-94888657 TAGTATTTATTTATGACACAGGG + Intergenic
1012188691 6:96253944-96253966 ATGATTTTTTTTATGAGACAGGG - Intergenic
1012293626 6:97491615-97491637 TTGCATTTTTTTTTGTAACATGG + Intergenic
1012384710 6:98666416-98666438 ATGAATTAATTTATTAAAAAAGG - Intergenic
1012454671 6:99391103-99391125 ATTTATTTATTTATGAGACAGGG + Intronic
1012496180 6:99836035-99836057 ATTTATTTATTTTTGAGACAAGG + Intergenic
1012751614 6:103170419-103170441 ATGAATGCATTAATGAAACAAGG - Intergenic
1013039819 6:106422336-106422358 ATTTATTTATTTTTGAGACATGG + Intergenic
1013194776 6:107835352-107835374 ATTTATTTATTTTTGAGACAGGG - Intergenic
1013202258 6:107910447-107910469 ATTTATTTATTTTTGAGACAAGG - Intronic
1013212648 6:108000694-108000716 ATTTATTTATTTAAGAGACAGGG - Intergenic
1013364618 6:109427388-109427410 ATTTATTTATTTTTGAGACAGGG + Intronic
1013442636 6:110186475-110186497 ATTTATTTATTTATGAGACAGGG - Intronic
1013471402 6:110469539-110469561 ATTTATTTATTTTTGAGACAGGG - Intronic
1013509279 6:110829837-110829859 ATTTATTTATTTTTGAGACAGGG - Intronic
1013527512 6:110988194-110988216 ATTTATTTATTTTTGAGACAGGG - Intronic
1013884987 6:114952589-114952611 ATGAAATTATGTATGAAACTAGG - Intergenic
1014014125 6:116510287-116510309 ATGTATTTATTTATGAGACAGGG + Intronic
1014240284 6:119009851-119009873 ATTCATTTATTTAATAAATATGG - Intronic
1014451280 6:121584530-121584552 ATTTATTTATTTTTGAGACAGGG - Intergenic
1014683798 6:124469401-124469423 ATGCATATATTAATGGACCATGG + Intronic
1014743894 6:125177029-125177051 ATTTATTTATTTATGAGACAAGG - Intronic
1014842573 6:126237672-126237694 ATTTATTTATTTATGAGACCCGG - Intergenic
1014867881 6:126554286-126554308 ATACATATATATATGTAACAGGG - Intergenic
1014973243 6:127845388-127845410 AAGCATTTATTGAAGAAAAATGG + Intronic
1015117679 6:129667359-129667381 AAGCATTTATTAAAGATACAGGG - Intronic
1015137937 6:129894883-129894905 ATGCATTTATTTATTTGAGATGG - Intergenic
1015237541 6:130988107-130988129 ATTTATTTATTTTTGAGACAGGG - Intronic
1015645007 6:135377485-135377507 ATTTATTTATTTATGATACAGGG + Intronic
1015651060 6:135460174-135460196 ATTTATTTATTTTTGAGACAGGG - Intronic
1015988075 6:138906079-138906101 ATGCATGTTTTTCTGAACCAGGG - Intronic
1016189319 6:141242629-141242651 ATAAATTTTTTTATAAAACAAGG + Intergenic
1016522219 6:144959048-144959070 ATGAATTTATTTAGGAAACATGG - Intergenic
1016704532 6:147091352-147091374 ATTTATTTATTTAAGAGACACGG + Intergenic
1016728811 6:147406391-147406413 ATTTATTTATTTTTGAGACAGGG - Intergenic
1016754688 6:147671433-147671455 ATGCATGTATTTTTGATATACGG + Intronic
1016822602 6:148360734-148360756 CTGCAGTTATTTATGGAGCATGG + Intronic
1016848912 6:148596663-148596685 TTGCATTTATCAATGAATCATGG + Intergenic
1016859629 6:148704874-148704896 ATTTATTTATTTTAGAAACAGGG - Intergenic
1016975341 6:149802120-149802142 ATTTATTTATTTTTGAGACAGGG - Intronic
1017189663 6:151639032-151639054 ATTTATTTATTTTTGAGACAGGG + Intergenic
1017249443 6:152263395-152263417 ATTTATTTATTTTTGAGACAGGG + Intronic
1017640299 6:156487323-156487345 ATTTATTTATTTTTGAGACAGGG + Intergenic
1017736003 6:157364488-157364510 ATTTATTTATTTCTGAGACAGGG - Intergenic
1017854459 6:158338142-158338164 ATTTATTTATTTTTGAGACAGGG + Intronic
1017928399 6:158930510-158930532 ATTTATTTATTTTTGAGACAGGG + Intergenic
1017987198 6:159454642-159454664 AGGTATTTATTTAGGAATCAGGG - Intergenic
1017993962 6:159514833-159514855 ATCCCTTATTTTATGAAACAAGG + Intergenic
1018046644 6:159971071-159971093 ATTTATTTATTTTTGAGACAGGG - Intronic
1018205359 6:161432099-161432121 TTACAGTTATTTATGAAGCAAGG - Intronic
1018228486 6:161654000-161654022 ATGCATTTTTTTTTTAAAGATGG + Intronic
1018356023 6:163018313-163018335 ATATATTTACTTATGAAACTAGG - Intronic
1018674900 6:166211244-166211266 ATGCATATATATATGAAAAGAGG + Intergenic
1018718358 6:166553123-166553145 TTGTTTTTATTTTTGAAACAGGG + Intronic
1018870855 6:167781084-167781106 ATTAATTTATTTTTGAGACAGGG - Intergenic
1019020116 6:168911279-168911301 ATTTATTTATTTCTGAGACAAGG - Intergenic
1019222727 6:170487028-170487050 ATTCATTTGTTTTTGAGACAGGG - Intergenic
1019585365 7:1799183-1799205 ATGGGTTTATTTTTGAGACAGGG - Intergenic
1019757137 7:2779339-2779361 ATTTATTTATTTATGAGACAGGG - Intronic
1019906459 7:4068726-4068748 ATTTATTTATTTATGAGACAGGG + Intronic
1020120392 7:5500056-5500078 ATTTATTTATTTTTGAGACAGGG - Intronic
1020177168 7:5891537-5891559 ATTAATTTATTTTTGAGACAGGG - Intergenic
1020222131 7:6247654-6247676 ATTTATTTATTTTTGAGACAGGG + Intronic
1020225884 7:6279633-6279655 ATTTATTTATTTTTGAAACAGGG + Intergenic
1020389977 7:7647612-7647634 ATACATTTCTTTAAGAGACAGGG + Intronic
1020401195 7:7779649-7779671 ATTTATTTATTTTTGAGACAGGG + Intronic
1020440147 7:8208848-8208870 AAGCATTAAGTGATGAAACATGG + Intronic
1020481095 7:8662138-8662160 TTGCATATATTTTTGAGACATGG + Intronic
1020554192 7:9650412-9650434 ATTTATTTATTTTTGAGACAGGG + Intergenic
1020741584 7:12026282-12026304 ACGCATTTATTTATCCAAAAGGG + Intergenic
1020743001 7:12045812-12045834 ATGCTATTATTTATGAAGGAAGG - Intergenic
1020747320 7:12093744-12093766 ATGTATATATGTATGAAAAAGGG - Intergenic
1020890082 7:13867843-13867865 ATTTATTTATTTATTAGACAAGG - Intergenic
1021016173 7:15537674-15537696 ATTCATTGAATTATTAAACAGGG - Intronic
1021120769 7:16793055-16793077 ATGCTTTTTTTTTTGAGACAAGG + Intronic
1021208872 7:17819251-17819273 ATCCATTCATTTATGGAACAGGG + Intronic
1021449528 7:20770255-20770277 ATTCATTTATTTTTTAAAAAAGG + Intronic
1021548061 7:21838738-21838760 ATTTATTTATTTTTGAGACAGGG + Intronic
1021668957 7:23015625-23015647 ATTTATTTATTTTTGAGACAAGG + Intergenic
1021705372 7:23362758-23362780 ATTTATTTATTTATGAGACAGGG + Intronic
1021760259 7:23896624-23896646 ATGTATTTATTTTAGAGACAGGG - Intergenic
1021796381 7:24258486-24258508 ATTTATTTATTTTTGAGACAAGG - Intergenic
1022314270 7:29229968-29229990 ATTTATTTATTTTTGAGACAGGG - Intronic
1022374303 7:29799336-29799358 ATGTATTTATTTTTGAGACAAGG + Intergenic
1022403024 7:30059112-30059134 ATGCTTTTGTTTTTGAGACAGGG - Intronic
1022458031 7:30576324-30576346 AAAGAGTTATTTATGAAACAAGG - Intergenic
1022563758 7:31376020-31376042 ATGTATTTATTTATGACACAAGG - Intergenic
1022705351 7:32796865-32796887 ATGCAGTTAATTTTGAAAAACGG - Intergenic
1022760860 7:33349437-33349459 ATTTATTTATTTTTGAGACAGGG + Intronic
1023181327 7:37486696-37486718 ATTTATTTATTTTTGAGACAAGG + Intergenic
1023429333 7:40073494-40073516 ATTTATTTATTTTTGAGACAAGG - Intronic
1023490916 7:40740712-40740734 ATGCATTTATTCATAATAAAAGG - Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1023809221 7:43898736-43898758 ATTTATTTATTTTTGAGACAGGG - Intronic
1023810822 7:43910220-43910242 ATTCATTTATTTATGAGACACGG + Intronic
1023813670 7:43931707-43931729 ATTTATTTATTTTTGAGACAGGG + Intronic
1024155148 7:46614559-46614581 ATAGGTTTATTTATGGAACACGG + Intergenic
1024180317 7:46886381-46886403 ATTTATTTATTTTTGAGACAAGG - Intergenic
1024320508 7:48062472-48062494 ATTTATTTATTTATGAGACAGGG - Intergenic
1024359109 7:48449160-48449182 AAACAATTATTTATTAAACATGG - Intronic
1024546879 7:50529746-50529768 TTGCATTTGTTTATAAAATAGGG + Intronic
1024586673 7:50848385-50848407 ATGCATTTGTTTATTATTCATGG - Intergenic
1024707526 7:51976662-51976684 ATTTATTTATTTTTGAGACAGGG - Intergenic
1024904279 7:54358948-54358970 ATTTATTTATTTTTGAGACAGGG + Intergenic
1025016989 7:55447619-55447641 ATGCATATGTATATGAAATATGG - Intronic
1025072199 7:55910031-55910053 ATGTATTTTTTTAAGAGACAGGG + Intronic
1025278996 7:57613369-57613391 TTAAATTTATTTTTGAAACATGG + Intergenic
1025305735 7:57852131-57852153 TTAAATTTATTTTTGAAACATGG - Intergenic
1025685113 7:63709970-63709992 ATGTATTTATTACTGAAACAAGG - Intergenic
1025821883 7:64970402-64970424 TTGCATTTTTTTATTATACATGG - Intergenic
1025871668 7:65440181-65440203 ATTTATTTATTTTTGAGACAAGG + Intergenic
1025969699 7:66310825-66310847 ATTTATTTATTTATGAGACAGGG + Intronic
1025970041 7:66314504-66314526 ATTTATTTATTTTTGAGACAGGG - Intronic
1026056566 7:66989537-66989559 ATTTATTTATTTTTGAGACAGGG - Intronic
1026277164 7:68890113-68890135 ATTTATTTATTTATGAGACAGGG + Intergenic
1026324499 7:69297119-69297141 ATTTATTTATTTTGGAAACAGGG - Intergenic
1026417172 7:70194399-70194421 ATTTATTTATTTTTGAGACAGGG - Intronic
1026450197 7:70522203-70522225 ATGCATTCTTTTTAGAAACAGGG - Intronic
1026530479 7:71193103-71193125 ATTTATTTATTTTTGAGACAGGG + Intronic
1026530592 7:71194050-71194072 ATTTATTTATTTTTGAGACAGGG + Intronic
1026530862 7:71196143-71196165 ATTTATTTATTTTTGAGACAGGG + Intronic
1026628673 7:72018841-72018863 ATTTATTTATTTTTGAGACAGGG + Intronic
1026797536 7:73376060-73376082 ATTTATTTATTTTTGAGACAGGG + Intergenic
1026816035 7:73512959-73512981 ATGTATTTATTTTTGACACAGGG + Intronic
1026860556 7:73784980-73785002 ATTTATTTATTTTTGAGACAGGG + Intergenic
1026982909 7:74537103-74537125 ATGTTTGTATTTTTGAAACAAGG - Intronic
1027209908 7:76137528-76137550 ATTTATTTATTTTTGAGACAGGG - Intergenic
1027217418 7:76192963-76192985 ATTTATTTATTTTTGAGACAGGG + Intergenic
1027237826 7:76308468-76308490 ATTTATTTATTTTTGAGACAAGG - Intergenic
1027404174 7:77842207-77842229 ATTTATTTATTTTTGAGACAGGG + Intronic
1027500536 7:78944741-78944763 ACTTATTTATTTATGAGACAGGG + Intronic
1027570736 7:79863253-79863275 ATGCATATATATATAAAATAGGG - Intergenic
1027585026 7:80046601-80046623 ATTCATTTATTTTAGAGACAGGG + Intergenic
1027643207 7:80763850-80763872 ATCAATTTCTTTATAAAACAAGG + Intronic
1027817894 7:83001411-83001433 ATGTATTCAGTTATGTAACATGG - Intronic
1027988542 7:85327617-85327639 ATTCATCTATTAATCAAACATGG + Intergenic
1027997807 7:85447966-85447988 ATGTATTTATTTTTGAGACAGGG + Intergenic
1028149986 7:87360973-87360995 ATTTATTTATTTTTGAGACAGGG + Intronic
1028269143 7:88766303-88766325 ATTTATTTATTTTTGAGACAAGG - Intronic
1028392963 7:90336614-90336636 ATTTATTTATTTTTGAGACAAGG + Intronic
1028396429 7:90373845-90373867 ATTCATTTATTTTAGAGACAGGG + Intronic
1028517582 7:91695770-91695792 ATTTATTTATTTATGAGACAGGG + Intronic
1028897234 7:96055672-96055694 ATGCACTAAATTGTGAAACAAGG + Intronic
1028927692 7:96377332-96377354 ATTTATTTATTTAAGACACACGG + Intergenic
1029081659 7:97979448-97979470 ATTAATTTATTTTTGAGACAGGG + Intergenic
1029087436 7:98022364-98022386 ATTTATTTATTTTTGAGACAAGG - Intergenic
1029139038 7:98396779-98396801 ATTTATTTATTTTTGAGACAGGG - Intronic
1029292416 7:99512295-99512317 ATGCAGTTACTTAATAAACATGG - Intronic
1029347626 7:99990124-99990146 ATTTATTTATTTTTGAGACACGG - Intergenic
1029462599 7:100705159-100705181 ATGCATTTATTTTTGAGACAGGG - Intergenic
1029480671 7:100810735-100810757 ATTTATTTATTTTAGAAACAAGG - Intronic
1029608004 7:101610656-101610678 ATTTATTTATTTTTGAGACAGGG - Intergenic
1029608085 7:101611544-101611566 ATTTATTTATTTTTGAGACAGGG - Intergenic
1029619936 7:101684054-101684076 ATTTATTTATTTTTGAGACAGGG - Intergenic
1029624338 7:101710407-101710429 ATGCAATTATTTATTAAGTATGG - Intergenic
1029635511 7:101781061-101781083 ATTTATTTATTTTTGAGACAGGG - Intergenic
1029659771 7:101952372-101952394 ATTTATTTATTACTGAAACAGGG - Intronic
1029664490 7:101986348-101986370 ATGTATTTATTTAGAATACAAGG + Intronic
1029676234 7:102070960-102070982 ATTTATTTATTTTTGAGACAGGG + Intronic
1029892934 7:103950463-103950485 ATGCATTTAGTTATCCAAAAAGG + Intronic
1030056852 7:105590777-105590799 ATTTATTTATTTAAGAGACAAGG + Intronic
1030479537 7:110084584-110084606 GTGCAATTATTTATGAACTATGG + Intergenic
1030498130 7:110325657-110325679 ATTCATTTCTTTATTACACATGG - Intergenic
1030601234 7:111595451-111595473 ATACATTTATTCATCAAACTTGG + Intergenic
1030625432 7:111841169-111841191 ATTTATTTATTTATGAGACAGGG + Intronic
1030669808 7:112323647-112323669 GAACATTTATTTAAGAAACATGG - Intronic
1030957790 7:115876972-115876994 ATTAATTTATTTTTGACACAGGG + Intergenic
1030959419 7:115897191-115897213 ATGCCTATATTTAGGAAGCAAGG - Intergenic
1031002093 7:116427566-116427588 ATCTATTTATAAATGAAACATGG - Intronic
1031037054 7:116799214-116799236 ATTTATTTATTTTTGAGACAGGG + Intergenic
1031219647 7:118949180-118949202 ATGTATTTATTTATGAGTCAGGG + Intergenic
1031244604 7:119293070-119293092 ATTTATTTATTTTTGAGACAGGG - Intergenic
1031558509 7:123208512-123208534 ATGCATTAATTTAGAAAACTTGG + Intergenic
1031736608 7:125370879-125370901 ATTTATTTATTTCTGAGACAGGG - Intergenic
1031826585 7:126573375-126573397 TAGCATTTTTTAATGAAACAGGG + Intronic
1031883149 7:127219446-127219468 ATTCTTTTATTTTTGAGACAGGG + Intronic
1031891776 7:127302850-127302872 ATGTATTTATTTTAGAGACAGGG + Intergenic
1031903881 7:127439949-127439971 ATTTATTTATTTTTGAGACAGGG + Intergenic
1032100442 7:128972110-128972132 TTTCATTTGTTTTTGAAACAGGG - Intronic
1032126120 7:129194091-129194113 ATGTATGTATTTTTGAGACAGGG - Intronic
1032608040 7:133379152-133379174 ATGCATTTTTCTTTGAAAAATGG + Intronic
1033081786 7:138305755-138305777 ATATATATATTTTTGAAACAGGG - Intergenic
1033187054 7:139237301-139237323 ATTTATTTATTTTGGAAACAGGG + Intronic
1033284748 7:140031364-140031386 ATTTATTTATTTATGAGACAGGG - Intronic
1033636875 7:143220021-143220043 ATTTATTTATTTTTGAGACACGG + Intergenic
1033788241 7:144759927-144759949 ATTTATTTATTTTTGAGACACGG - Intronic
1033851204 7:145497749-145497771 ATGCATCTAATTAAGAAAGAAGG - Intergenic
1033938007 7:146612647-146612669 AAGCATTTATTTTTAAAACTTGG + Intronic
1034140262 7:148808887-148808909 ATCCATTTATATATTATACAAGG - Intronic
1034218446 7:149425611-149425633 ATTTATTTATTTTTGAGACAGGG - Intergenic
1034511599 7:151539846-151539868 ATGTATTGATTTTTGAAACAGGG + Intergenic
1034552036 7:151827243-151827265 ATTCATTTATTTTTGAGACAGGG + Intronic
1034986600 7:155519512-155519534 ATTTATTTATTTTTGAGACAGGG - Intronic
1035211706 7:157333480-157333502 ATGTATTTATTTTTGAGACAGGG + Intergenic
1035761320 8:2070972-2070994 ATTTATTTATTTTTGAGACAGGG + Intronic
1035896020 8:3403321-3403343 ATGCATTTACTTCTGAAAGTTGG + Intronic
1036000706 8:4600422-4600444 TTGAATTTATTTCTGAAATAAGG - Intronic
1036131849 8:6122587-6122609 ATGCATTTGTTAAAAAAACAAGG + Intergenic
1036524219 8:9519917-9519939 ATTTATTTATTTTTGACACAGGG - Intergenic
1036624335 8:10454235-10454257 ATTTATTTATTTTTGAGACAAGG + Intergenic
1036720691 8:11172355-11172377 ATTTATTTATTTTTGAGACAGGG - Intronic
1036735541 8:11312049-11312071 ATTTATTTATTTAGGAGACAGGG + Intronic
1036755739 8:11469871-11469893 ATTTATTTATTTTTGAGACAGGG - Intronic
1037085622 8:14845948-14845970 ATGCATTTCTTGATGATAAACGG + Intronic
1037252479 8:16912798-16912820 ATTAATTTATTTTTGAGACAGGG - Intergenic
1037964991 8:23127391-23127413 ATGTATTTATTTTTGAGACAGGG + Intergenic
1038207686 8:25482859-25482881 ATTTATTTATTTTTGAGACAAGG - Intronic
1038247717 8:25874690-25874712 ATTTATTTATTTAAGAAACAAGG + Intronic
1038314400 8:26471183-26471205 ATTTATTTATTTTTGAGACAGGG + Intronic
1038381842 8:27102816-27102838 ATTTATTTATTTTTGAGACAAGG - Intergenic
1038448522 8:27622214-27622236 ATTTATTTATTTTTGAGACAGGG + Intergenic
1038622405 8:29156519-29156541 ATTTATTTATTTTTGAGACAGGG + Intronic
1038628696 8:29219736-29219758 ATTTATTTATTTTGGAAACAGGG - Intronic
1038713431 8:29970658-29970680 ATTTATTTATTTTTGAGACAGGG - Intergenic
1038775699 8:30528659-30528681 ATGACTATATTTATGTAACAGGG - Intronic
1038782716 8:30582016-30582038 ATTTATTTATTTTTGAGACAGGG + Intronic
1039508536 8:38070429-38070451 ATTTATTTATTTTTGAGACAGGG - Intergenic
1039609469 8:38907856-38907878 ATGTATGTATTTTTGAGACAGGG + Intronic
1039634238 8:39145736-39145758 ATTTATTTATTTTTGAGACAGGG + Intronic
1039957545 8:42218819-42218841 ATTTATTTATTTAAGAGACAGGG - Intergenic
1040022371 8:42752327-42752349 ATTTATTTATTTTTGAGACAGGG + Intergenic
1040024479 8:42769403-42769425 ATTTATTTATTTTTGAGACAGGG - Intronic
1040024521 8:42769698-42769720 ATTTATTTATTTTTGAGACAGGG - Intronic
1040646655 8:49404733-49404755 TTGCATTGATGTATGAAACCTGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040869166 8:52082416-52082438 ATTTATTTATTTTTGAGACAGGG - Intergenic
1040904593 8:52453273-52453295 ATTTATTTATTTTTGAGACAGGG - Intronic
1041051965 8:53942987-53943009 ATTTATTTATTTCTGAGACAAGG - Intronic
1041635737 8:60141046-60141068 ATGAGTTTATTTATGAAAGATGG - Intergenic
1041683410 8:60617736-60617758 ATTTATTTATTTTTGAGACAGGG - Intronic
1041768961 8:61452371-61452393 AAGCATTTATTTATAAAACCAGG - Intronic
1041806509 8:61855398-61855420 ATGTTATTATTTTTGAAACAGGG + Intergenic
1041856915 8:62467770-62467792 ATTTATTTATTTTTGAGACAAGG + Intronic
1041998707 8:64095217-64095239 GTGCTTATATTTCTGAAACAAGG + Intergenic
1042309142 8:67363165-67363187 ATGCTATTATTTATGCAAAATGG + Intergenic
1042584471 8:70319529-70319551 ATTTATTTATTTTTGAGACAGGG - Intronic
1042618291 8:70674160-70674182 ATGCTTTTTTTTAAGAGACAAGG - Intronic
1042827010 8:72989959-72989981 ATTTATTTATTTTTGAGACAGGG + Intergenic
1042844613 8:73157918-73157940 ATTTATTTATTTCTGAGACAGGG + Intergenic
1042999915 8:74745367-74745389 AAGCATTGATTTATTAAATATGG + Intronic
1043028288 8:75099244-75099266 ATACATGTATTAATTAAACATGG + Intergenic
1043093953 8:75941411-75941433 ATGAATTTATTTTTGAGGCAGGG + Intergenic
1043099449 8:76022624-76022646 ATTAATTTAATTTTGAAACATGG + Intergenic
1043145907 8:76654225-76654247 AAGCATTTATTTTTGAGCCATGG - Intergenic
1043158384 8:76815506-76815528 ATTTATTTATTTTTGAGACAAGG + Intronic
1043229306 8:77780745-77780767 ATCTATTGATTTATGAAGCATGG + Intergenic
1043334468 8:79157312-79157334 ATTTATTTATTTTTGAGACAAGG - Intergenic
1043437056 8:80245110-80245132 ATCTATTTATTTTTGAGACAGGG - Intergenic
1043925972 8:86037440-86037462 ATTTATTTATTTTTGAGACAGGG - Intronic
1043954727 8:86347014-86347036 ATTTATTTATTTTTGAGACAGGG + Intronic
1044012077 8:87006526-87006548 AAGCTTTTATTTATGAAGGAAGG + Intronic
1044096712 8:88075222-88075244 ATACATTTAATGATGAAAGAGGG - Intronic
1044515647 8:93135315-93135337 ACTCATTTATTTATGGTACAAGG - Intronic
1044677454 8:94743627-94743649 ATTCATTTATTTTTGAGACAGGG - Intronic
1044724215 8:95179701-95179723 AAGAAATTATTTTTGAAACATGG - Intergenic
1044954641 8:97467132-97467154 ATTTATTTATTTGTGAGACAGGG - Intergenic
1044970428 8:97614595-97614617 ATTTATTTATTTTTGAGACAAGG - Intergenic
1045060278 8:98404842-98404864 ATTGATTTATTTTTGAGACAAGG - Intronic
1045079690 8:98612006-98612028 ATGTATTTATTTATTTAGCAAGG - Intronic
1045106748 8:98900081-98900103 ATTTATTTATTTTTGAGACAGGG + Intronic
1045130356 8:99144991-99145013 ATGCATGTATTTGTGAAAAGAGG + Intronic
1045144037 8:99318824-99318846 ATGAATTTCTTTATGAGAGAAGG + Intronic
1045490185 8:102662310-102662332 ATTGATTTATTTTTGAGACAGGG - Intergenic
1045517925 8:102876999-102877021 ATTTATTTATTTTTGAGACAGGG - Intronic
1045878780 8:107014051-107014073 ATTTATTTATTTTTGAAACAGGG - Intergenic
1046107908 8:109689336-109689358 ATTAATTTATTTTTGAGACAAGG + Intronic
1046234493 8:111404615-111404637 TTGAATTTATTTTAGAAACAAGG + Intergenic
1046244358 8:111539256-111539278 AGACATTTGTTTATGTAACAAGG + Intergenic
1046303297 8:112327013-112327035 ATTTATTTATTTTTGAGACAGGG - Intronic
1046434988 8:114175847-114175869 ATGCCTTTCTTAATGAAATATGG - Intergenic
1046435318 8:114179861-114179883 ATGCATTCATTTATAAAAACAGG - Intergenic
1046461515 8:114543037-114543059 GTGTATGTATTTATGAGACAGGG - Intergenic
1046545034 8:115639068-115639090 ATTTATTTATTTCTGAAACAGGG + Intronic
1046627401 8:116589754-116589776 ATTTATTTATTTTTGAGACAAGG - Intergenic
1046642155 8:116743749-116743771 ATGTATGTATTTTTGAGACAGGG - Intronic
1046648195 8:116808463-116808485 ATGTATTTATTTTTGAGATAGGG - Intronic
1046738268 8:117800910-117800932 ATCCCTGTTTTTATGAAACATGG + Intronic
1046818925 8:118615565-118615587 GTGCATTTAATTATGAGAAAGGG - Intronic
1046958497 8:120085693-120085715 ATTTATTTATTTTTGAGACAGGG + Intronic
1047031789 8:120889974-120889996 ATTTATTCATTTATGTAACATGG + Intergenic
1047033041 8:120904372-120904394 ATCCAATTATTTATTAAATATGG - Intergenic
1047074287 8:121382316-121382338 ATTTATTTATTTTTGAGACAGGG - Intergenic
1047074715 8:121387970-121387992 ATGCATTTTTCTATGAATCCTGG + Intergenic
1047153012 8:122285649-122285671 ATGCATTTCTTTTTGAAACAGGG + Intergenic
1047193181 8:122697087-122697109 ATCTATTTATTTTTGAGACAGGG - Intergenic
1047411051 8:124624920-124624942 GAACATTTATCTATGAAACAAGG - Intronic
1047517211 8:125565541-125565563 ATTTATTTATTTTTGAGACAGGG + Intergenic
1047547585 8:125834341-125834363 ATTTATTTATTTATGAGACAGGG + Intergenic
1047589442 8:126311581-126311603 ATTTATTTATTTTTGAGACAAGG - Intergenic
1047768952 8:128015094-128015116 ATTTATTTATTTTTGAGACAGGG + Intergenic
1047979120 8:130161806-130161828 ATATATTTATTTTTGAGACAGGG + Intronic
1048257862 8:132918942-132918964 ATGTATTAATGTATGTAACAGGG + Intronic
1048541970 8:135350206-135350228 AAGCATATATTAATGGAACATGG + Intergenic
1048930404 8:139310707-139310729 ATGGATTTATTTATGCCACTGGG + Intergenic
1049295572 8:141833121-141833143 ATTTATTTATTTATGAGACAGGG - Intergenic
1049495260 8:142927556-142927578 ATTTATTTATTTTTGAGACAGGG - Intergenic
1049545271 8:143227881-143227903 ATTTATCTATTTATGAAACAGGG + Intergenic
1049936002 9:502839-502861 ATTTATTTATTTTTGAGACAGGG + Intronic
1050108083 9:2186503-2186525 ATTTATTTATTTTTGAGACAGGG + Intronic
1050380359 9:5021631-5021653 ATGTATTCATTTTTGAGACAGGG + Intronic
1050743172 9:8846014-8846036 ATGCACTTAATTCTGACACATGG - Intronic
1050747343 9:8891726-8891748 ATGCATTTACTCATGACAAAGGG - Intronic
1050960848 9:11728391-11728413 ATTTATTTATTTTTGAGACAGGG - Intergenic
1051235852 9:14997940-14997962 ATACATTTTTTTTTGAGACAAGG - Intergenic
1051360739 9:16279338-16279360 ATGCATTTGTTTCAGAAAGAGGG + Intergenic
1052309475 9:27050061-27050083 ATTTATTTATTTATGAGACAGGG + Intronic
1052732442 9:32305349-32305371 ATGCCTTCATTTATGAAATTGGG - Intergenic
1052749776 9:32477948-32477970 ATACATATAGTTATAAAACAGGG + Intronic
1052792008 9:32884164-32884186 TTGAATTACTTTATGAAACAAGG + Intergenic
1052868667 9:33482346-33482368 ATTCATTTATTTCTGAGACAGGG - Intergenic
1053232840 9:36425686-36425708 TTTCATTTTTTTTTGAAACAGGG - Intronic
1053378682 9:37630386-37630408 ATTTATTTATTTATGAGACAGGG + Intronic
1053531402 9:38885441-38885463 ATGCATTTTTCTACAAAACAGGG + Intergenic
1053625074 9:39861445-39861467 ATGTATTAAATTATGAAACAGGG + Intergenic
1053879796 9:42581783-42581805 ATGTATTAAATTATGAAACAGGG - Intergenic
1053892868 9:42712537-42712559 ATGTATTAAATTATGAAACAGGG + Intergenic
1054203626 9:62109870-62109892 ATGCATTTTTCTACAAAACAGGG + Intergenic
1054218823 9:62389253-62389275 ATGTATTAAATTATGAAACAGGG - Intergenic
1054231895 9:62519916-62519938 ATGTATTAAATTATGAAACAGGG + Intergenic
1054634736 9:67478494-67478516 ATGCATTTTTCTACAAAACAGGG - Intergenic
1054840105 9:69729311-69729333 ATTTATTTATTTTTGAGACAGGG - Intronic
1054844867 9:69783990-69784012 ATTTATTTATTTATTAGACAAGG + Intergenic
1055009122 9:71544267-71544289 ATTTATTTATTTTTGAAACAGGG - Intergenic
1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG + Intergenic
1055216395 9:73868351-73868373 ATTTATTTATTTCTGAGACAAGG - Intergenic
1055263972 9:74474676-74474698 ATTTATTTATTTTTGAGACAGGG - Intergenic
1055481647 9:76714399-76714421 ATTTATTTATTTTTGAGACAGGG + Intronic
1055526034 9:77134947-77134969 ATTTATTTATTTATGAGACAAGG + Intergenic
1055739950 9:79377015-79377037 ATTTATTTATTTTTGAGACAGGG - Intergenic
1055747112 9:79460503-79460525 ATGGATTTCTTTGTGAAATAAGG + Intergenic
1056368715 9:85932829-85932851 ATTTATTTATTTATGAGGCAGGG + Intergenic
1056628276 9:88272152-88272174 ATTAATTTATTTTTGAGACAGGG - Intergenic
1056797010 9:89665420-89665442 ATTTATTTATTTTTGAGACAGGG + Intergenic
1057025278 9:91730465-91730487 ATTTATTTATTTTTGAGACAGGG + Intronic
1057373951 9:94501210-94501232 AAGCATTTATTCATGAAAAATGG - Intergenic
1057858744 9:98623420-98623442 ATTTATTTATTTTTGAGACAGGG - Intronic
1057938548 9:99260617-99260639 ATGTATTTATTTTTGAGGCAGGG + Intergenic
1058280730 9:103110209-103110231 ATGTATTAATTAATGAAATATGG + Intergenic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1058509561 9:105702686-105702708 ATTTATTTATTTTTGATACAGGG + Intronic
1058658325 9:107246108-107246130 ATTTATTTATTTTTGAGACAAGG + Intergenic
1058736358 9:107897806-107897828 ATTTATTTATTTTTGAGACAGGG + Intergenic
1058839797 9:108895220-108895242 ATTTATTTATTTTTGAGACAAGG - Intronic
1058931389 9:109722763-109722785 GTTTATTTATTTATGAGACAGGG - Intronic
1059143337 9:111875005-111875027 ATTTATTTATTTTTGAGACAGGG + Intergenic
1059183928 9:112247257-112247279 ATTTATTTATTATTGAAACAGGG - Intronic
1059381149 9:113927004-113927026 ATTTATTTATTTTTGAGACAGGG - Intronic
1059443018 9:114321282-114321304 ATTTATTTATTTTTGAGACAGGG + Intergenic
1059610938 9:115893511-115893533 ATTCATTTTTTTATTAAACTAGG - Intergenic
1060139183 9:121191342-121191364 ATGCATATATTTTAGAGACAGGG + Intronic
1060146282 9:121255248-121255270 ATTTATTTATTTTTGAGACAGGG + Intronic
1060302112 9:122380456-122380478 ATTTATTTATTTTTGAGACAGGG - Intronic
1060360601 9:122952727-122952749 ATGCTTTTACTTTTGAGACAGGG - Intronic
1060509935 9:124224396-124224418 ATTTATTTATTTTTGAGACAGGG + Intergenic
1060627021 9:125122898-125122920 ATTTATTTATTTTTGAGACAGGG - Intronic
1060697533 9:125722175-125722197 ATTTATTTATTTTTGAGACAGGG + Intergenic
1060697707 9:125723468-125723490 ATTTATTTATTTCTGAGACAGGG - Intergenic
1060983378 9:127806497-127806519 ATTTATTTATTTTTGAGACAGGG - Intronic
1061074865 9:128334930-128334952 ATTTATTTATTTTTGAGACAGGG + Intergenic
1061082026 9:128376977-128376999 ATCTATTTATTTTTGAGACAAGG - Intronic
1061353025 9:130081196-130081218 ATGTATTTATTTCGGAGACAGGG - Intronic
1061471289 9:130828093-130828115 ATTTATTTATTTTTGATACATGG + Intronic
1061641626 9:131962241-131962263 ATGTATTTATTTTTGAGACGGGG + Intronic
1061705275 9:132448454-132448476 CTCCATTTCTTTATAAAACAGGG + Intronic
1061991370 9:134160698-134160720 ATTCTTTTATTTTTGAGACAGGG + Intergenic
1185857364 X:3548251-3548273 ATTTATTTATTTTTGAGACAGGG - Intergenic
1185937955 X:4280307-4280329 ATGCATCTACCTATGCAACAAGG + Intergenic
1185967202 X:4620028-4620050 ATTCATTTATTTTTGAGATAGGG - Intergenic
1185970005 X:4652306-4652328 ATTTATTTATTTTTGAGACAGGG + Intergenic
1185971197 X:4666470-4666492 ATTTATTTATTTTTGAGACAGGG - Intergenic
1186057627 X:5666904-5666926 ATTTATTTATTTTTGAGACAGGG + Intergenic
1186178267 X:6947765-6947787 ATTTATTTATTTTTGAGACAGGG - Intergenic
1186227405 X:7414629-7414651 ATGCTTGTATAAATGAAACATGG + Intergenic
1186376386 X:9006318-9006340 AATCTTTTATTTATGAGACAAGG - Intergenic
1186387032 X:9120492-9120514 ATGCATTTATTATTGTTACATGG - Intronic
1186397666 X:9226075-9226097 ATTTATTTATTTTTGAGACAGGG + Intergenic
1186459547 X:9737314-9737336 ATTTATTTATTTTTGAGACAGGG - Intronic
1186486768 X:9939645-9939667 ATTTATTTATTTTTGAGACAGGG + Intronic
1186575166 X:10757970-10757992 ATTTATTTATTTTTGAGACAGGG + Intronic
1186599130 X:11017877-11017899 AGGCATTTATTTCTTAAGCAGGG + Intergenic
1186688677 X:11952027-11952049 ATTTATTTATTTTTGAAACAGGG - Intergenic
1187061530 X:15791479-15791501 ATTTATTTATTTTTGAGACAGGG + Intronic
1187069253 X:15871870-15871892 ATTTACTTATTTATGAGACAGGG + Intergenic
1187331094 X:18340400-18340422 ATGTATTAATTTTTGAGACAGGG - Intronic
1187543731 X:20226162-20226184 ATTTATTTATTTTGGAAACAGGG - Intronic
1187945890 X:24426168-24426190 ATGTGTTTATTTTTGAAACATGG - Intergenic
1187959170 X:24551792-24551814 ATTCATTCATTTTTGAGACAGGG - Intergenic
1188100480 X:26076517-26076539 ATTCACATATTTTTGAAACAAGG - Intergenic
1188179049 X:27031471-27031493 ATTTATTTATTTTTGAGACAAGG + Intergenic
1188228098 X:27626671-27626693 ATGTATTTATTCATGTTACATGG - Intronic
1188237066 X:27743737-27743759 ATTTATTTATTTTTGAGACAGGG + Intronic
1188359412 X:29234059-29234081 CTGCATTTATTTATGGAGCTTGG - Intronic
1188625808 X:32283748-32283770 ATCCATTTATATATTATACATGG + Intronic
1188675420 X:32934210-32934232 ATGCATCTCTTTTAGAAACAAGG + Intronic
1188685307 X:33062479-33062501 ATCTATTTATTTTTGAAAGATGG + Intronic
1188942556 X:36258685-36258707 AGTCTTTTATTTATGCAACATGG - Intronic
1189090544 X:38078024-38078046 ATTCATTTTTTTTTGAGACAAGG - Intronic
1189431913 X:40954543-40954565 ATTTATTTATTTTTGAGACAAGG - Intergenic
1189508500 X:41637612-41637634 ATTCATTTATTTTTGAGACAGGG - Intronic
1189755293 X:44265276-44265298 ATTTATTTATTTTTGAGACAGGG + Intronic
1189760583 X:44317781-44317803 ATGTATTTATTTTTGAGACAGGG - Intronic
1189926264 X:45958812-45958834 AGTCATTTATTGATGAAAGAAGG - Intergenic
1190710613 X:53066091-53066113 ATTTATTTATTTTGGAAACAGGG - Intronic
1190715987 X:53104044-53104066 ATTTATTTATTTTTGAGACAGGG + Intergenic
1190828062 X:54035794-54035816 ATTCATTTATTTTTGAGACAGGG - Intronic
1192121442 X:68459901-68459923 ATTTATTTATTTTTGAAGCAGGG - Intergenic
1192242267 X:69342088-69342110 ATTTATTTATTTTTGAGACAGGG + Intergenic
1192443038 X:71189203-71189225 ATTTATTTATTTTTGAGACAGGG + Intergenic
1192775915 X:74244035-74244057 ATTTATTTATTTTTGAGACAGGG - Intergenic
1192827188 X:74709575-74709597 ATGTATTTATTTTAGAGACAAGG + Intergenic
1193141104 X:78028027-78028049 ATTTATTTATTTTTGAGACAGGG + Intronic
1193168291 X:78306517-78306539 AAGTCTTTATTTATAAAACAGGG - Intronic
1193200342 X:78682513-78682535 ATTTATTTATTTTTGAGACAGGG + Intergenic
1193392284 X:80942880-80942902 ATGTATTTATTGAAGAAACTAGG + Intergenic
1193488562 X:82118640-82118662 ATTTATTTATTTTTGAGACAGGG + Intergenic
1193774601 X:85626615-85626637 ATGCATTTATTTTAGGATCAAGG - Intergenic
1193958145 X:87888396-87888418 ATTTATTTATTTTTGAGACAGGG + Intergenic
1194163963 X:90490488-90490510 ATGGATTTTTTTGTGAGACAAGG + Intergenic
1194166110 X:90519182-90519204 ATCCAGTCATTTGTGAAACATGG + Intergenic
1194522940 X:94941475-94941497 ATTTATTTATTTTTGAGACAGGG + Intergenic
1194550241 X:95289306-95289328 ATGCATTTAACCATGAAACTGGG + Intergenic
1194552021 X:95312471-95312493 GCTCATTTTTTTATGAAACAGGG - Intergenic
1195155083 X:102115120-102115142 ATGGATTTTTTTTTGAGACAGGG + Intergenic
1195393430 X:104386591-104386613 GTCCATATATTTTTGAAACAAGG + Intergenic
1195433112 X:104811638-104811660 ATGCAGTTATTTTAGAAATAAGG + Intronic
1195556197 X:106227802-106227824 ATGCACATATTCATGAAATAAGG + Intergenic
1195584946 X:106554007-106554029 ATGCATTTTTTTCTGATACATGG - Intergenic
1195624132 X:106990261-106990283 ATTTATTTATTTTTGAGACAAGG + Intronic
1195922225 X:109995115-109995137 ATTTATTTATTTATCAGACAGGG - Intergenic
1196123134 X:112071299-112071321 ATTTATTTATTTTTGAGACAGGG - Intronic
1196210720 X:112993035-112993057 ATTTATTTATTTTTGAGACAGGG + Intergenic
1196246903 X:113411051-113411073 ATGTATTTATTTATTTACCATGG + Intergenic
1196330238 X:114464244-114464266 ATTTCTTTATCTATGAAACAGGG - Intergenic
1196720142 X:118846368-118846390 ATTCATTCATTCATGAGACAAGG + Intergenic
1196792979 X:119481030-119481052 ATTTATTTATTTTTGAGACAGGG - Intergenic
1196853057 X:119957078-119957100 ATTTATTTATTTATGAGACAAGG + Intergenic
1196871461 X:120116396-120116418 AGGCATATATGTATGCAACATGG + Intergenic
1197189968 X:123635875-123635897 GTACATTTATTCATGAAAAAAGG + Intronic
1197254377 X:124247175-124247197 ATTTATTTATTTTTGAGACATGG + Intronic
1197320685 X:125025949-125025971 ATGCCTTTATTCATTAAAGATGG + Intergenic
1197338680 X:125239436-125239458 ATTCATTTATTTATTAGAAATGG - Intergenic
1197559211 X:127996959-127996981 GTGCATTTCTATATGTAACAGGG + Intergenic
1197690784 X:129499042-129499064 ATGCTTTTTTTTTTGAGACACGG + Intronic
1197755523 X:129991421-129991443 ATTTATTTATTTTTGAGACAGGG + Intronic
1197861258 X:130973208-130973230 GTGCATTTATTCAAGAAAAATGG - Intergenic
1198000521 X:132430776-132430798 ATTTATTTATTTTAGAAACAGGG + Intronic
1198035111 X:132794398-132794420 ATTTATTTATTTTTGAAATAGGG + Intronic
1198068875 X:133128184-133128206 ATTTATTTATTTATGAGACAGGG - Intergenic
1198149242 X:133892054-133892076 ATGCATTTGTTTATCTAACACGG - Intronic
1198219635 X:134587572-134587594 AGGCTTTTTTTTTTGAAACAGGG - Intronic
1198528827 X:137528992-137529014 ATTTATTTACTTTTGAAACAGGG - Intergenic
1198894418 X:141436654-141436676 AAGCATATATTAATTAAACATGG - Intergenic
1199396271 X:147342347-147342369 GTTCATATATTTATGCAACATGG + Intergenic
1199784793 X:151095544-151095566 CTGCATTTTTTTTTGAGACAGGG + Intergenic
1200148101 X:153937187-153937209 ATTTATTTATTTTTGAGACAGGG - Intronic
1200240720 X:154491841-154491863 ATTTATTTATTTTTGAGACAGGG + Intergenic
1200510224 Y:4068297-4068319 ATGGATTTTTTTGTGAGACAAGG + Intergenic
1200512380 Y:4096947-4096969 ATCCAGTCATTTGTGAAACATGG + Intergenic
1200783887 Y:7241633-7241655 ATTTATTTATTTTTGAGACAGGG - Intergenic
1200785881 Y:7259911-7259933 ATTTATTTATTTTTGAGACAGGG - Intergenic
1201372028 Y:13276239-13276261 ATTCATTCATTTTTGATACAGGG - Intronic
1201645822 Y:16230530-16230552 ATTAATTTATTTTTGAGACATGG + Intergenic
1201656991 Y:16354786-16354808 ATTAATTTATTTTTGAGACATGG - Intergenic
1202094015 Y:21225947-21225969 ATGCATTTATATATGAATAAAGG - Intergenic