ID: 964532426

View in Genome Browser
Species Human (GRCh38)
Location 3:157682830-157682852
Sequence TGGGAAGAAGGTCCTACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964532426_964532431 -1 Left 964532426 3:157682830-157682852 CCAAAGGTAGGACCTTCTTCCCA No data
Right 964532431 3:157682852-157682874 ATGTGGTCTAACCAATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964532426 Original CRISPR TGGGAAGAAGGTCCTACCTT TGG (reversed) Intergenic
No off target data available for this crispr