ID: 964535493

View in Genome Browser
Species Human (GRCh38)
Location 3:157716752-157716774
Sequence CAGAGTTCTACTCAATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964535493_964535499 14 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535499 3:157716789-157716811 TCCTGTATGAAAACCAGGGGAGG No data
964535493_964535503 21 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535503 3:157716796-157716818 TGAAAACCAGGGGAGGGGCAAGG No data
964535493_964535501 15 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535501 3:157716790-157716812 CCTGTATGAAAACCAGGGGAGGG No data
964535493_964535498 11 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535498 3:157716786-157716808 TGGTCCTGTATGAAAACCAGGGG No data
964535493_964535496 9 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535496 3:157716784-157716806 GATGGTCCTGTATGAAAACCAGG No data
964535493_964535502 16 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535502 3:157716791-157716813 CTGTATGAAAACCAGGGGAGGGG No data
964535493_964535495 -9 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535495 3:157716766-157716788 AGAACTCTGTGGATGACTGATGG No data
964535493_964535497 10 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535497 3:157716785-157716807 ATGGTCCTGTATGAAAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964535493 Original CRISPR CAGAGTTCTACTCAATTTCC AGG (reversed) Intergenic
No off target data available for this crispr