ID: 964535498

View in Genome Browser
Species Human (GRCh38)
Location 3:157716786-157716808
Sequence TGGTCCTGTATGAAAACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964535493_964535498 11 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535498 3:157716786-157716808 TGGTCCTGTATGAAAACCAGGGG No data
964535491_964535498 13 Left 964535491 3:157716750-157716772 CCCCTGGAAATTGAGTAGAACTC No data
Right 964535498 3:157716786-157716808 TGGTCCTGTATGAAAACCAGGGG No data
964535490_964535498 14 Left 964535490 3:157716749-157716771 CCCCCTGGAAATTGAGTAGAACT No data
Right 964535498 3:157716786-157716808 TGGTCCTGTATGAAAACCAGGGG No data
964535492_964535498 12 Left 964535492 3:157716751-157716773 CCCTGGAAATTGAGTAGAACTCT No data
Right 964535498 3:157716786-157716808 TGGTCCTGTATGAAAACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964535498 Original CRISPR TGGTCCTGTATGAAAACCAG GGG Intergenic
No off target data available for this crispr