ID: 964535503

View in Genome Browser
Species Human (GRCh38)
Location 3:157716796-157716818
Sequence TGAAAACCAGGGGAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964535492_964535503 22 Left 964535492 3:157716751-157716773 CCCTGGAAATTGAGTAGAACTCT No data
Right 964535503 3:157716796-157716818 TGAAAACCAGGGGAGGGGCAAGG No data
964535491_964535503 23 Left 964535491 3:157716750-157716772 CCCCTGGAAATTGAGTAGAACTC No data
Right 964535503 3:157716796-157716818 TGAAAACCAGGGGAGGGGCAAGG No data
964535490_964535503 24 Left 964535490 3:157716749-157716771 CCCCCTGGAAATTGAGTAGAACT No data
Right 964535503 3:157716796-157716818 TGAAAACCAGGGGAGGGGCAAGG No data
964535493_964535503 21 Left 964535493 3:157716752-157716774 CCTGGAAATTGAGTAGAACTCTG No data
Right 964535503 3:157716796-157716818 TGAAAACCAGGGGAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964535503 Original CRISPR TGAAAACCAGGGGAGGGGCA AGG Intergenic
No off target data available for this crispr