ID: 964550334

View in Genome Browser
Species Human (GRCh38)
Location 3:157878137-157878159
Sequence CTGTGCACAAGTAGCAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964550334_964550338 0 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550338 3:157878160-157878182 ATGTGCCCAGCTAGGAGAGGAGG No data
964550334_964550345 18 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550345 3:157878178-157878200 GGAGGGGACATCATGGGAAATGG No data
964550334_964550344 12 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550344 3:157878172-157878194 AGGAGAGGAGGGGACATCATGGG No data
964550334_964550340 2 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550340 3:157878162-157878184 GTGCCCAGCTAGGAGAGGAGGGG No data
964550334_964550346 21 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550346 3:157878181-157878203 GGGGACATCATGGGAAATGGTGG No data
964550334_964550337 -3 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550337 3:157878157-157878179 CAGATGTGCCCAGCTAGGAGAGG No data
964550334_964550343 11 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550343 3:157878171-157878193 TAGGAGAGGAGGGGACATCATGG No data
964550334_964550336 -8 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550336 3:157878152-157878174 GTGCACAGATGTGCCCAGCTAGG No data
964550334_964550339 1 Left 964550334 3:157878137-157878159 CCCTGCTTGCTACTTGTGCACAG No data
Right 964550339 3:157878161-157878183 TGTGCCCAGCTAGGAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964550334 Original CRISPR CTGTGCACAAGTAGCAAGCA GGG (reversed) Intergenic
No off target data available for this crispr