ID: 964551601

View in Genome Browser
Species Human (GRCh38)
Location 3:157890880-157890902
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1336
Summary {0: 4, 1: 13, 2: 57, 3: 288, 4: 974}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964551596_964551601 -5 Left 964551596 3:157890862-157890884 CCCTCCAGGCAGGGGAAACAGCC No data
Right 964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG 0: 4
1: 13
2: 57
3: 288
4: 974
964551597_964551601 -6 Left 964551597 3:157890863-157890885 CCTCCAGGCAGGGGAAACAGCCT No data
Right 964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG 0: 4
1: 13
2: 57
3: 288
4: 974
964551598_964551601 -9 Left 964551598 3:157890866-157890888 CCAGGCAGGGGAAACAGCCTGAG No data
Right 964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG 0: 4
1: 13
2: 57
3: 288
4: 974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900616111 1:3566410-3566432 CAGCCAGCGCTAAGGCAGGGTGG + Intronic
901226066 1:7613703-7613725 CAGCCTGAGGAGAGCGATGGCGG + Intronic
901304333 1:8221738-8221760 ATGGCTGAGCAGAGGCATGGAGG + Intergenic
901752135 1:11416826-11416848 CAGCATGGGCAAAGGCTTGGAGG - Intergenic
901954046 1:12771177-12771199 GACCCTGAGCAAGGGCCTGGGGG + Intergenic
902113043 1:14099004-14099026 GAGCCTGGGCTAAGGCTTGGTGG + Intergenic
902156643 1:14492972-14492994 CAGCCAGGGCAAAGGCACTGAGG - Intergenic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902449636 1:16488701-16488723 AGGCATGAGCAAAGGCATGGAGG - Intergenic
902504846 1:16932641-16932663 AGGCATGAGCAAAGGCATGGAGG + Intronic
902639408 1:17756975-17756997 CAGGCCGGGCACAGGCATGGTGG + Intronic
902794567 1:18792860-18792882 CGGCATGTGCAAAGGCATGGAGG + Intergenic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902957212 1:19933916-19933938 CAGCCTGTGCAAAGGCCCTGTGG + Intergenic
902979586 1:20113409-20113431 CACCCTGAGCCAATGCCTGGAGG + Exonic
903070669 1:20725650-20725672 CGGCATGAGCGAAGGCCTGGAGG + Intronic
903135712 1:21308111-21308133 CAGCATGAGCAGAGGTCTGGAGG - Intronic
903281934 1:22255039-22255061 CACGGTGAGCAAAGGCAGGGAGG + Intergenic
903300268 1:22373885-22373907 GAGCATGAGCAAATGCTTGGAGG - Intergenic
903302287 1:22387903-22387925 CAGCCTAAACAGAGGCTTGGAGG + Intergenic
903320543 1:22540596-22540618 CAGCCAGTGCAAAGGCCTGGAGG + Intergenic
903328499 1:22585155-22585177 CAGCCTGTGCAAAGGCCCCGAGG + Intronic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903347708 1:22697911-22697933 CAGCCTGAGCTAGGCCCTGGGGG - Intergenic
903352585 1:22726945-22726967 CAGCCTAGGCAAAGGCCTAGAGG + Intronic
903373844 1:22853652-22853674 CTGCCTGAGCAAAGGCCCAGAGG + Intronic
903374626 1:22858160-22858182 CAGCTTGGCCAAAGGCCTGGAGG + Intronic
903381892 1:22902963-22902985 CAACATGAACAAAAGCATGGAGG + Intronic
903438879 1:23372190-23372212 CAGCATGTGCGAAGGCACGGAGG + Intergenic
903453571 1:23471193-23471215 CAGCATGAGCAAAGGTCTGATGG - Intronic
903480103 1:23646845-23646867 GAGCCCGAGCAAAGGCCTAGAGG + Intergenic
903537632 1:24077450-24077472 CAGCAAGGGCAAAGGCAGGGAGG - Intronic
903659078 1:24965917-24965939 CAGCATGAGCGAAGGCCCGGAGG - Intergenic
903764514 1:25725529-25725551 CAGCACGTGCAAGGGCATGGTGG + Intronic
903818795 1:26085045-26085067 CAGCATGTGCAAAGGCCAGGAGG - Intergenic
904065329 1:27745803-27745825 TAGCATTTGCAAAGGCATGGAGG + Intronic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904210393 1:28883414-28883436 CAGCCTGCACAAAGGCTTAGAGG - Intergenic
904257822 1:29267561-29267583 CAGCCAGCACAAAGGCCTGGAGG + Intronic
904263855 1:29306664-29306686 CTGCCTAAGCAAAGGCCTGGGGG + Intronic
904318556 1:29681703-29681725 CGGCATGAACAAAGGCCTGGAGG + Intergenic
904355922 1:29939820-29939842 CAGCATAAGCAAAGGCCTGGAGG - Intergenic
904437965 1:30511588-30511610 CAGCATGAGCGAAGGTGTGGAGG - Intergenic
904438932 1:30517280-30517302 CGGCATGAACAAAGGCCTGGAGG - Intergenic
904460634 1:30677661-30677683 CAGCATGTGCAAAGGCTGGGAGG + Intergenic
904583386 1:31564522-31564544 CAGCAAGAGCAAAGACAAGGAGG - Intergenic
904616197 1:31751184-31751206 CAGCCTGTGCAAGGGCGTGGAGG - Intronic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
904787731 1:32995310-32995332 CAGCTTGTACAAAGGCATGGAGG - Intergenic
904814186 1:33182739-33182761 CAGCCTGTGCAAAAGCATAGAGG + Intergenic
904913109 1:33950081-33950103 GAGCCTGAGCAATGGGGTGGGGG - Intronic
905227245 1:36487251-36487273 CAGCCTGAGCAAAGGCCAGGAGG - Intergenic
905312704 1:37061277-37061299 CAGCAAGGGCAAAGGCCTGGAGG - Intergenic
905328795 1:37177382-37177404 CAGCCTGAGCAAAGGCCCAGAGG + Intergenic
905335123 1:37239761-37239783 CAGCATGAGTAAAGGCCTGGAGG - Intergenic
905501588 1:38443738-38443760 CAGCAAGAGCAAAACCATGGAGG + Intergenic
905510200 1:38513317-38513339 CCGCCTGTGCAAAGGCTTGGAGG - Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905594727 1:39196781-39196803 AAGCCTGTGCAAAGGTATGCTGG - Intronic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
905973374 1:42157321-42157343 CAGCCTGAATAAAGGCACTGAGG - Intergenic
905978264 1:42197213-42197235 AAGCCTGAGGCCAGGCATGGTGG + Intronic
906718192 1:47985937-47985959 CAACATGAGCAAATGCATGGAGG + Intronic
906732908 1:48098579-48098601 CAGTATGAGCAAAGGCGTGCAGG - Intergenic
906815034 1:48870003-48870025 TAGCATAAGCAAAGGCATGGAGG - Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907048365 1:51313667-51313689 CAGGCTGGGCAAAGGCCTGGAGG - Intronic
907074275 1:51564553-51564575 CAGGCAGAGCAAAGCCTTGGAGG - Intergenic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907238770 1:53069281-53069303 CAGCATGTGCAAAGGCCTGGAGG + Intronic
907266843 1:53267042-53267064 CAACCTGAGCAAAGGCTCTGAGG - Intronic
907268664 1:53277625-53277647 CAACTTGAGTAAAGGCTTGGAGG - Intronic
907282449 1:53359938-53359960 CAGCCTGAGCAAAGAGGTAGAGG - Intergenic
907311164 1:53539951-53539973 CCGCATGGGCAAAGGCGTGGAGG - Intronic
907388404 1:54140520-54140542 CAGCATGTGCAAAGGCCTGGAGG - Intronic
907459676 1:54598013-54598035 CAGCAAGAGCAAAGTCTTGGAGG - Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907516412 1:54996088-54996110 CAGCATGTGCAAAGGCACTGAGG - Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907655132 1:56334382-56334404 CAACATGAGCAAAGACGTGGAGG + Intergenic
907718472 1:56950029-56950051 CAGCTTAAGCAAAAGCATGGAGG + Intronic
907768909 1:57440050-57440072 CAGTATGAGCAAAGTAATGGAGG - Intronic
907818949 1:57948011-57948033 TAGCATAAGCACAGGCATGGAGG - Intronic
907831336 1:58066991-58067013 CAGCATGAGCAAAGGCTCTGAGG - Intronic
907927069 1:58964984-58965006 CAGCCTGTGCAAAGTCCCGGGGG + Intergenic
907965245 1:59322588-59322610 TAGCATATGCAAAGGCATGGTGG + Intronic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
908333625 1:63097401-63097423 CAGTATGAGCAAAGACATCGAGG + Intergenic
909153453 1:72039095-72039117 CAGAATGAGTCAAGGCATGGAGG + Intronic
909205266 1:72748557-72748579 CACCATCAACAAAGGCATGGGGG - Intergenic
909397250 1:75183907-75183929 CATTCAGAGTAAAGGCATGGAGG + Intergenic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
909664814 1:78121238-78121260 CAACAGCAGCAAAGGCATGGGGG + Intronic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
910263793 1:85316834-85316856 CCGCAGAAGCAAAGGCATGGAGG - Intergenic
910342590 1:86204566-86204588 CAGCTTGTACAAAGGCATGGAGG + Intergenic
910654507 1:89606040-89606062 CAGCCTGGACAAAGACATAGAGG - Intergenic
911069591 1:93822101-93822123 CAGTGTGGGCAAAGGCATTGAGG + Intronic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
912393603 1:109322223-109322245 CAGCCTGAGGCCAGGCACGGTGG - Intronic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912642888 1:111363987-111364009 CAGCATTAGCAAAAGCCTGGAGG - Intergenic
912720561 1:112016442-112016464 CAACTTGAGGAAAGGCAAGGAGG - Intergenic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912806063 1:112758105-112758127 CAGCCTGAGGGAGGGCAGGGTGG - Intergenic
912976492 1:114335692-114335714 TAGCATGAGCAAAGGCATGAAGG + Intergenic
912978258 1:114348776-114348798 CAGCCTGAGCACAGGAATCCTGG + Intergenic
913277421 1:117152663-117152685 CAGCCTTCTCAAAGGCAGGGTGG + Intronic
914459423 1:147869379-147869401 TAGCCTAAGTAAAGGCATAGAGG + Intergenic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
915169778 1:153969509-153969531 CAGACAGAGCAAAGGGATGAGGG + Intronic
915457292 1:156049332-156049354 CAGGCAGAGCAAAGACTTGGGGG - Intronic
916214198 1:162382057-162382079 GAACCTGGGCAAAGCCATGGGGG + Exonic
916627263 1:166571776-166571798 CAGCATGTGCAAAGGCCTTGAGG + Intergenic
917210312 1:172625245-172625267 CAGTCTCAGGCAAGGCATGGTGG + Intergenic
917474607 1:175358079-175358101 TAGCATGTGCAAATGCATGGAGG + Intronic
917526114 1:175789882-175789904 TGGCCTGAGCAAAGGCTTAGAGG - Intergenic
917640394 1:176978124-176978146 TAGTATGACCAAAGGCATGGAGG + Intronic
918010656 1:180583526-180583548 CAGCATGTGCAAAGTCATGGAGG - Intergenic
918085057 1:181238132-181238154 CAGACTGTGGCAAGGCATGGCGG + Intergenic
918115599 1:181494006-181494028 CAGCAAGTGCAAAGGCACGGAGG - Intronic
918299146 1:183186348-183186370 CAGCCAGAGCGCAGGCATGGCGG - Exonic
918322263 1:183375445-183375467 CAGCCTGGGCAAAGGCATAGGGG - Intronic
919406924 1:197196813-197196835 CAGCATGTGCAAAGGCATTGAGG - Intronic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
919905172 1:202073553-202073575 CAGCCTGCACAGTGGCATGGAGG + Intergenic
919936190 1:202252239-202252261 CAGCTTAAGCCAATGCATGGAGG - Intronic
920092946 1:203467073-203467095 CAGACTGGGCAAAGGCATAGAGG + Intergenic
920558318 1:206920510-206920532 CAGCATGGGCAAAGACATGGTGG + Intronic
920686872 1:208116094-208116116 ATGTATGAGCAAAGGCATGGAGG - Intronic
920797289 1:209152209-209152231 CAACCTGAGACCAGGCATGGTGG + Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
920957816 1:210635202-210635224 CAGCCTGTACAAAGATATGGAGG + Intronic
921216964 1:212946085-212946107 CAGTTTGAGCAAGGACATGGTGG - Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921324095 1:213973511-213973533 CAGCTCGTGCAATGGCATGGGGG - Intergenic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
923291304 1:232548829-232548851 CAGCCTACGCAAAGACATGAAGG + Intronic
924173196 1:241362569-241362591 CAGCCAGTGCAAATGCCTGGAGG - Intergenic
924371338 1:243353582-243353604 CAGCTTGAGCAAAGGAATGGGGG + Intronic
924476169 1:244383692-244383714 CAGCATGTGCAAAGGCCTTGTGG + Intronic
924655193 1:245968351-245968373 CAGCCTAGGCAAAGGCACTGAGG - Intronic
1062838621 10:652418-652440 CAGCCTGAGGGAAGGGGTGGAGG - Exonic
1063357405 10:5413266-5413288 CGGTCTGAGCAAAGGCATTTGGG - Intronic
1063391496 10:5652646-5652668 CAGCCTGAGCAAATTGATGATGG - Intronic
1064233078 10:13547089-13547111 CAGTATGTGCAAAGGAATGGAGG + Intergenic
1065487267 10:26247533-26247555 AAGCCTTAGCAGAGGCATGGGGG + Intronic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1065564602 10:26996159-26996181 CACCCTCAGCCCAGGCATGGTGG + Intronic
1065902805 10:30223567-30223589 CAGCCCACGCAAAGGCTTGGTGG - Intergenic
1066419017 10:35247109-35247131 CAGCAGGGGCAGAGGCATGGAGG + Intronic
1066696229 10:38080326-38080348 CAGCTTGGCCACAGGCATGGTGG + Intergenic
1066996299 10:42567191-42567213 CAGCTTGGCCACAGGCATGGTGG - Intergenic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1067822341 10:49540966-49540988 CAGCCTGAGCTAAGGCAGCTGGG - Intergenic
1068570401 10:58621616-58621638 CAGCCTGGGGCAGGGCATGGTGG + Intronic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1069416450 10:68204942-68204964 CAGCCTGCACAAAGGCGTGGTGG - Intronic
1069563792 10:69450168-69450190 CAGGCTGAGAAAAGGCCAGGTGG + Intergenic
1069615945 10:69806261-69806283 CGGCCTGTGCAATGGCCTGGGGG + Intronic
1069736251 10:70656630-70656652 CAGCCTGTGCAAAGGCCTGGGGG + Intergenic
1069748953 10:70733659-70733681 CAGCAGGAGCGAAGGCTTGGAGG + Intronic
1069840289 10:71335506-71335528 GAACTTGAGCAAAGGCGTGGAGG + Intronic
1069925904 10:71850887-71850909 CAGCCTGAGGGAAGGCCTCGGGG + Intronic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070310066 10:75266496-75266518 CAGCATGAGCAAAGACCTGAAGG - Intergenic
1070310942 10:75273354-75273376 CAGCTTGAGCAAAGGCCAGGAGG - Intergenic
1070341785 10:75504684-75504706 CAGCATGTGCAAAGGCCTTGTGG + Intronic
1070487160 10:76942243-76942265 AAGCCTGAGGCCAGGCATGGTGG - Intronic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070553840 10:77513214-77513236 CAGCTAGTGCAAAGGCCTGGTGG - Intronic
1070627759 10:78063316-78063338 CAGCAAGAACAAAGGCGTGGAGG + Intergenic
1070661093 10:78305782-78305804 CAGCTTGGGCAAAGGCATGGAGG - Intergenic
1070796284 10:79218788-79218810 CAGCCTGTGCAAAGGTGTTGAGG + Intronic
1070808594 10:79285903-79285925 CAGCCTGAGAAGAGGCACAGAGG + Intronic
1070836718 10:79452021-79452043 CAGCAAGTGCAAAGGCATGGAGG - Intergenic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1071497140 10:86176432-86176454 CAGCATGTGCAAAGGCACTGAGG + Intronic
1071508992 10:86249650-86249672 CTGCCTGGGCAAAGGCATAGAGG - Intronic
1071528559 10:86372490-86372512 CAGCGAGAGGAAAGGTATGGAGG + Intergenic
1071807365 10:89138447-89138469 CAGCCTGAGCACAAGCACAGAGG + Intergenic
1072343250 10:94476808-94476830 TAACATGAGCAAAGGCATGGAGG - Intronic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1072628693 10:97131092-97131114 CAGGCCGAGCAAGGGCATTGTGG + Intronic
1072705172 10:97675793-97675815 CAACCTGAGCACAGGCTTGAGGG - Exonic
1072783675 10:98266720-98266742 CAGTGAGAGCAAAGGCTTGGAGG - Intronic
1073547447 10:104362946-104362968 CAACATGTACAAAGGCATGGAGG - Intronic
1073961249 10:108931624-108931646 GAGCTTAAGCAAAGCCATGGCGG - Intergenic
1074082329 10:110177667-110177689 CAGCAAATGCAAAGGCATGGAGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074425654 10:113348974-113348996 GATCCTGTGCAAAGGCACGGAGG + Intergenic
1074448459 10:113539504-113539526 CAACATGAGCAAAGGCTTGGAGG - Intergenic
1074608778 10:115001242-115001264 CTGCCTGAGCAAGTGCAAGGAGG - Intergenic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1075122326 10:119673087-119673109 CAGCATGGGCAAAGGCACAGGGG - Intronic
1075200761 10:120402016-120402038 CAGCATGTGCAAAGGCACTGGGG - Intergenic
1075549544 10:123382080-123382102 CAGCCTATGCAAAGGCACTGAGG - Intergenic
1075745227 10:124722927-124722949 CAGCATGAGCAGAGGTCTGGAGG - Intronic
1075904762 10:126071581-126071603 CAGCCTGGAGAAAGGAATGGGGG - Exonic
1076006037 10:126948834-126948856 CAACCTCAGGAAAGGCATAGGGG - Intronic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077112712 11:869001-869023 CATCATGAGCCAAGGCCTGGTGG - Exonic
1077180339 11:1209443-1209465 GAGCCTGAGGAAGGGCATGGAGG - Intergenic
1077323331 11:1952281-1952303 CAGCCTCAGCTACTGCATGGGGG + Intronic
1077395893 11:2321048-2321070 GAGCCTGAGCCAAGCCATGGTGG - Intergenic
1077988116 11:7375852-7375874 AACCCTGAGCAACAGCATGGAGG - Intronic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078532682 11:12149155-12149177 CAGCATCAGCAAAGGCATGTGGG + Intronic
1078545572 11:12244730-12244752 TAGCCTGTGCAAAGGCAGGCAGG + Intronic
1078657155 11:13252349-13252371 TAGCTTGAGCAAAAGCATGGAGG + Intergenic
1078966592 11:16351647-16351669 CAGGCAGAGCAAAGGCTAGGAGG - Intronic
1079010820 11:16826665-16826687 TAGCCTGTGCAAAGGCCTGCAGG - Intronic
1079034268 11:17008713-17008735 CAGCCTTGGCACAGGCAAGGTGG + Intronic
1079058184 11:17225503-17225525 CAGCCTGAGGCTGGGCATGGTGG - Intronic
1079122727 11:17696831-17696853 CAGCAGGTGCAAAGGCCTGGGGG - Intergenic
1079132428 11:17755149-17755171 CAGCCAGTGCAAGAGCATGGAGG + Intronic
1079184547 11:18224650-18224672 AAGACTGAGGAAAGGAATGGGGG + Intronic
1079290155 11:19180813-19180835 CAGCATTAGCAAAGACATGATGG + Intergenic
1079306722 11:19329871-19329893 CAGCCTGTGCAAAGGCCTTGAGG + Intergenic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079419269 11:20270907-20270929 TAGCGTGAGCAAAGGCTTAGGGG - Intergenic
1079613708 11:22464798-22464820 CAGCATGGGCAAAGTCATAGTGG + Intergenic
1079629930 11:22661667-22661689 TAGCATGAGGAAAGGCATGGAGG + Intronic
1079947120 11:26758004-26758026 CACCATGAACAAAGGCTTGGAGG + Intergenic
1079970400 11:27029642-27029664 CAGCATGGGAACAGGCATGGTGG - Intergenic
1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG + Intergenic
1080573182 11:33575720-33575742 CAGCATGAGCGAAAGAATGGAGG + Intronic
1080634333 11:34110305-34110327 CAGCATGAGCAAAGAAAAGGAGG - Intronic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1080764083 11:35279518-35279540 CAGCCTGCACAAAGGCACTGAGG - Intronic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1080805686 11:35651136-35651158 CAGCAAGTGCAAAGACATGGAGG + Intergenic
1080850963 11:36069741-36069763 CCGCCTGTGTAAAGGCCTGGAGG - Intronic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081541590 11:44038522-44038544 CAGCATGTGCAAAGGCCCGGGGG + Intergenic
1081545850 11:44071109-44071131 CACCTTGAGCAAAGGCAAGGAGG + Intronic
1081586352 11:44386676-44386698 CAGCACGGGCAAAGGCTTGGAGG - Intergenic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1081686469 11:45046764-45046786 CAGCCTGACCAAAGGCTCAGAGG + Intergenic
1081871946 11:46387008-46387030 TAGCCACAGCAAAGGCCTGGAGG + Intergenic
1082798066 11:57392847-57392869 CAGCTTGAGCAAAGGTGTGGAGG + Intronic
1082902769 11:58273761-58273783 CAGTCTGTGCAAAGGTCTGGTGG - Intergenic
1083161722 11:60858545-60858567 CAGCACGTGCCAAGGCATGGAGG - Intergenic
1083211475 11:61190007-61190029 CAGCCTGAGCAAACTCATCCAGG - Intergenic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1083380160 11:62260887-62260909 CAGCCTGGGCAAGGGCATGCAGG + Intergenic
1083538966 11:63498383-63498405 CAGCCAGCGCTCAGGCATGGAGG - Intergenic
1083594597 11:63912899-63912921 CAGCCTGCGCCAAGCCCTGGAGG - Exonic
1083768585 11:64854015-64854037 CAGCCACAGCAAAGGCCGGGGGG + Exonic
1084122434 11:67077512-67077534 CAGTCTGAGCGAAGGCTAGGAGG - Intergenic
1084208849 11:67611674-67611696 CAGCCTGAGATAAAGCAAGGTGG + Intronic
1084419173 11:69051799-69051821 CAGCCTGAGTAAAGGGTTGGAGG + Intronic
1084440014 11:69167445-69167467 CGGTGTGAGCAAAGGCCTGGAGG + Intergenic
1084541758 11:69791317-69791339 CAGCATGGGCAAAGGCCTAGAGG + Intergenic
1084676628 11:70639255-70639277 CACCCTGAGCAAAGGCCTGATGG - Intronic
1084736388 11:71108339-71108361 AGGCCTGAGCTCAGGCATGGTGG - Intronic
1084804844 11:71571640-71571662 CAGCCTCAGAGAAGCCATGGGGG + Intergenic
1084805610 11:71576883-71576905 CAGCCTCAGAGAAGCCATGGGGG - Intergenic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085125911 11:74002224-74002246 CAAGAGGAGCAAAGGCATGGAGG - Intronic
1085154172 11:74278252-74278274 CAGCATAAGCACAGACATGGAGG + Intronic
1085282124 11:75338009-75338031 CGGCTTGAGCAAAGGCACAGAGG + Intronic
1085306432 11:75488587-75488609 CAACCTGAGTGAAGGCATGGAGG - Intronic
1085324897 11:75598996-75599018 CAGCAAGGGTAAAGGCATGGAGG + Intronic
1085345528 11:75765977-75765999 CAGCATGGACAAAGGCCTGGAGG - Intronic
1085348061 11:75780840-75780862 GTGCCTGTGCAAGGGCATGGAGG + Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085394207 11:76198509-76198531 AAGCTTGGGCAAAGGCATGGTGG - Intronic
1085404404 11:76253361-76253383 CAGCATAAGCAAAGACATGGAGG + Intergenic
1085410028 11:76285406-76285428 CAGCATGAGGAAAGGCAAGATGG - Intergenic
1085465784 11:76722357-76722379 CAGCTTGTGCAAAGGCGTGGAGG - Intergenic
1085717148 11:78882358-78882380 CAGCATGGGCAAAAGCATGGTGG - Intronic
1085719255 11:78898524-78898546 CAGTCTGAGCAGAGGCCTAGCGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086171661 11:83843227-83843249 CAGCCTGGGCAAAGACAAGGAGG - Intronic
1086405177 11:86493422-86493444 CACCCTGTGCTAAGGCAGGGTGG - Intronic
1087072179 11:94091823-94091845 CAACCTGTGTAAAGGCCTGGAGG + Intronic
1087230296 11:95653784-95653806 CAGCATGTGTAAAGGCTTGGAGG + Intergenic
1087847880 11:102993804-102993826 CAGCATAAGTAAAGGCAAGGAGG - Intergenic
1088182562 11:107128776-107128798 CAGCATGAACCAAGACATGGAGG - Intergenic
1088789242 11:113209936-113209958 CAGCCTGGGCACAGGCACAGAGG + Intronic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1088977705 11:114830474-114830496 CAGCAAGAGCAAAGACAAGGAGG + Intergenic
1089133751 11:116232998-116233020 CAGCATGTGCAAAGGTATGGAGG - Intergenic
1089171321 11:116513645-116513667 CAGCATGAGCATGGGCGTGGAGG - Intergenic
1089618819 11:119710677-119710699 CAGGAACAGCAAAGGCATGGTGG + Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089622719 11:119730793-119730815 CAGCACGAGCAAAGGAATGAAGG + Intergenic
1089735600 11:120548414-120548436 TGGCCCCAGCAAAGGCATGGTGG + Intronic
1089770100 11:120796624-120796646 CAGCATTGGCAAAGGCATGGAGG + Intronic
1089784990 11:120901342-120901364 CAGCATGTGCCAAGGCAGGGAGG - Intronic
1089918658 11:122185388-122185410 CAGCCTGTGCAAAGGCCCAGTGG - Intergenic
1090246353 11:125218521-125218543 TAGGCTGAGCAAAAGCACGGAGG + Intronic
1090249465 11:125241294-125241316 CAGCATGTGCAAAGGCACCGAGG - Intronic
1090276949 11:125426988-125427010 CAGCACGTGCGAAGGCATGGAGG + Intronic
1090422815 11:126587277-126587299 CAGCGTGTGCAAAGGCTGGGAGG + Intronic
1090919233 11:131193523-131193545 GAGCCTGAGAAAAGGCACGGAGG - Intergenic
1202806319 11_KI270721v1_random:7476-7498 CAGCCTCAGCTACTGCATGGGGG + Intergenic
1091778510 12:3199844-3199866 CCACGTGTGCAAAGGCATGGAGG + Intronic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1091863266 12:3806063-3806085 AGGCATAAGCAAAGGCATGGGGG + Intronic
1092004462 12:5057437-5057459 CAGCTTGAGCGAAGGCACAGAGG + Intergenic
1092042612 12:5397759-5397781 CAGCCTCTGCAAAGGCCTTGGGG - Intergenic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092065622 12:5587817-5587839 CAGCCTGAGGAGGTGCATGGGGG - Intronic
1092070073 12:5624950-5624972 CAGCCTGGGCAAAGTCTTGATGG + Intronic
1092288342 12:7143005-7143027 GAGCCTGGGCAAAGGCATGAAGG + Exonic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1092905493 12:13097182-13097204 GAGCATCAGCAAAGGCTTGGAGG - Intronic
1092974847 12:13734882-13734904 CAGCCTATGCAAATGCATGAAGG + Intronic
1093005765 12:14049081-14049103 TAGCATTTGCAAAGGCATGGAGG + Intergenic
1093351501 12:18108283-18108305 CAGCTTGAGCAAAATCATGAAGG + Intronic
1093655277 12:21687602-21687624 CAGCCTGTGCAGAGCCAAGGGGG + Intronic
1093826118 12:23691144-23691166 CAGCCAGGCCAAAGGCAAGGAGG + Intronic
1094069496 12:26397307-26397329 CAGGATAAGCAAAGTCATGGAGG - Intronic
1094156001 12:27337498-27337520 CAGCCTGAGGAAAGGCCTGGAGG - Intronic
1094478186 12:30858726-30858748 AAGCCTGTGCAAACGGATGGAGG + Intergenic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1095874774 12:47068509-47068531 CAGGCTGAGCAAAGACCTGAAGG + Intergenic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096614977 12:52827087-52827109 CAGCCTGTGCAGTGTCATGGAGG - Intronic
1096660254 12:53119670-53119692 CAGTATGGGCAAAGGCCTGGAGG - Intronic
1097046678 12:56191851-56191873 CAGCCTGAGCAGTGGTATGAAGG - Intergenic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1097933330 12:65215190-65215212 GACCCTGAGCAAGGGCATGAAGG - Intronic
1098328628 12:69329219-69329241 CAGCCTGAGAAAAGACATACAGG - Intergenic
1098688083 12:73451102-73451124 AATCCTGAGCAAATGCAAGGAGG + Intergenic
1100242444 12:92723093-92723115 CTACCTGAGCCAAGGCATGGAGG + Intronic
1100330737 12:93579540-93579562 CAGCAGAAGCAAAGGAATGGAGG - Intronic
1100390137 12:94140726-94140748 CAGCCTGCGCCAAGCCCTGGAGG + Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1100790526 12:98125218-98125240 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1101119242 12:101562075-101562097 CAGCCAGGGCAAAGGCAAGCAGG - Intergenic
1101347581 12:103900814-103900836 CTGCATGGGCAAAGGCATGGAGG + Intergenic
1101351579 12:103934610-103934632 CATCCTGAATAAAGGCATGGAGG + Intronic
1101502319 12:105315673-105315695 CTGCATGAGCAAAGGTATGGTGG + Intronic
1101559969 12:105847621-105847643 CTGCCTGAGCCAAGGCACAGAGG + Intergenic
1101575304 12:105991695-105991717 CAGCATGAACAAAGGCCAGGGGG + Intergenic
1101617663 12:106354067-106354089 CAGCGTGAGCAATGGCATGAGGG - Intergenic
1101807410 12:108076425-108076447 CAGCAAGGGCAAAGGTATGGAGG - Intergenic
1101849603 12:108391724-108391746 CAGCATGTGCAAAAGCCTGGAGG + Intergenic
1101876400 12:108599167-108599189 CAGCGTGGGTAAAGGTATGGTGG + Intergenic
1101929949 12:109005808-109005830 CAGCTAGTGCAAAGGCCTGGAGG + Intronic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102031880 12:109744345-109744367 CAGCCGGGGCCAAGGCCTGGGGG - Intronic
1102044486 12:109821340-109821362 CAGCCTAGGCAAAGGCCTGGAGG - Intronic
1102240824 12:111323502-111323524 GAGGCTGAGGACAGGCATGGGGG + Intronic
1102242103 12:111331027-111331049 CAGCCTGAGCAAAGACATAGGGG + Intronic
1102514941 12:113440070-113440092 GAGCCTGAGCAAAGGAAAAGAGG - Intergenic
1102546835 12:113663442-113663464 CAGCCAGAGCAAAGACCTGAAGG - Intergenic
1102744093 12:115234338-115234360 CAGCAAGAGCAAAGGAATGCAGG + Intergenic
1102814989 12:115858487-115858509 CAGCATAAGCAAAGGCCTGGTGG + Intergenic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1102924056 12:116813380-116813402 CAGCCACTGCAAAGGCCTGGAGG - Intronic
1103257953 12:119559056-119559078 CCATGTGAGCAAAGGCATGGAGG + Intergenic
1103935862 12:124476165-124476187 CAGCCTGTGCAAAGGCCCGGGGG - Intronic
1103937314 12:124483475-124483497 CAGCTCGGGCAAAGGCTTGGAGG - Intronic
1103948607 12:124540339-124540361 CAGCCTGTGCAAAGGCCCAGGGG + Intronic
1103994307 12:124819269-124819291 CAGCCTGTGCAAAGGCCCTGTGG + Intronic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1104599832 12:130145227-130145249 CAGCCTGAGCAAAGGTGGTGGGG - Intergenic
1104876583 12:132039104-132039126 CAAGCTGAGCACAGGCAAGGAGG - Intronic
1105736413 13:23276340-23276362 CTACTTGAGCAAAGGCATAGCGG - Intronic
1106070618 13:26407490-26407512 CAGCCTGAGGCCGGGCATGGTGG + Intergenic
1106167955 13:27265743-27265765 CAGCATGCGCAAAATCATGGAGG - Intergenic
1106931538 13:34670966-34670988 CAGCCTCAGCCCAGGCATGGAGG + Intergenic
1107305606 13:39015007-39015029 CAGTATGAGCAAATGTATGGGGG - Intronic
1107408339 13:40136177-40136199 CAGCGAGAGCAAAGGCCAGGTGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107942577 13:45387868-45387890 CAGTCACAGCGAAGGCATGGTGG + Intergenic
1108379016 13:49839294-49839316 CAGCTTGAGCAAAGGCTGAGAGG - Intergenic
1108747735 13:53412078-53412100 CAGCTTGAGCAAAGGCATCTAGG + Intergenic
1109174053 13:59133427-59133449 CATCCTTTGCAAAGGCAGGGAGG - Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1110196996 13:72801017-72801039 CAGCCAATGCAAAGGCAGGGGGG + Intronic
1110356590 13:74574573-74574595 CAGCATGAACAAAGGCACTGAGG - Intergenic
1110575871 13:77054214-77054236 TGGCCTGTGCAATGGCATGGGGG + Intronic
1110726383 13:78829553-78829575 CATCCTGTGCAAAGGCCTGGTGG + Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112312337 13:98330114-98330136 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
1112373524 13:98816786-98816808 CAGCCCAAGCAAAGGCAAGAGGG + Intronic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1113520742 13:110938789-110938811 AAGTATGAGCAAAGCCATGGTGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1115267078 14:31511802-31511824 CACAGTGAGCAAAGGCATGGAGG + Intronic
1115763091 14:36595199-36595221 GAGTCTGAGCACAGGCATAGGGG + Intergenic
1116985664 14:51216789-51216811 CAGCCTTAGCAAAGGTATAAAGG - Intergenic
1117008602 14:51447508-51447530 CAGTCTGAGCAAAGGCCTAGAGG - Intergenic
1117211584 14:53506495-53506517 CAGGATGAGCAAAGCCTTGGAGG - Intergenic
1117376311 14:55121316-55121338 CAGCCTGATCAAAGCCAATGAGG - Intergenic
1117836771 14:59815929-59815951 CACCCTGAGCAAAGGCATGAAGG - Intronic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1118886584 14:69872259-69872281 CAGCATATGCAAAGGCATTGAGG - Intronic
1119197548 14:72728400-72728422 CAGCGGGACCAATGGCATGGAGG + Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1119954747 14:78784866-78784888 CAGCCTGAGCAAAGTCACAGGGG + Intronic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1120204682 14:81574863-81574885 CAGCCTCAGCGGAGGCTTGGGGG + Intergenic
1121002229 14:90460080-90460102 CAGCCTGAGTAAAGGTTTAGAGG + Intergenic
1121008778 14:90507670-90507692 TAGCCTGAGCAGAGGCACTGAGG - Intergenic
1121233002 14:92372154-92372176 CAGCCTGCTCAAATGCAGGGAGG + Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121339600 14:93097383-93097405 CAGCCTGAGGAAAGCCAAGAAGG + Intronic
1121409309 14:93738217-93738239 CAGCCTGTGCCAAGGGAGGGAGG - Intronic
1121425838 14:93851328-93851350 CAGCCTGGACAAAGGCTTAGAGG + Intergenic
1121598088 14:95181125-95181147 CAGCCAGTGCAAAGGCACTGAGG - Intergenic
1121630986 14:95421823-95421845 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1121911822 14:97798644-97798666 CAGCCTTGGCAAAGGTTTGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122234751 14:100325297-100325319 CAGCCTGGGCAAAGGCCAGGAGG - Intronic
1122245199 14:100397722-100397744 CAGAGTGTGCAAAGGCAGGGAGG + Intronic
1122281296 14:100623990-100624012 CAGCTGGAGCAAAAGCATGGAGG - Intergenic
1122321709 14:100859496-100859518 CAGCCTCAGGGAGGGCATGGGGG - Intergenic
1122353330 14:101109980-101110002 CGGCTTGAGCAAAGACTTGGAGG + Intergenic
1122403421 14:101481291-101481313 CAGCCTGGGCAAGGGCCTGAGGG - Intergenic
1122466689 14:101938553-101938575 CAGCGTGTGCAAAGGCACTGGGG - Intergenic
1122576531 14:102746607-102746629 CAGGCTGAGCCAGGGCTTGGAGG + Intergenic
1122626387 14:103087411-103087433 CTGCCCGAGCACAGGCGTGGGGG + Intergenic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1123937845 15:25202612-25202634 CAGCCTGACCCTGGGCATGGAGG - Intergenic
1124351145 15:28956367-28956389 CTGCATGAGGAAAGGCGTGGAGG + Intronic
1124376847 15:29133938-29133960 CAGCCTGTGCAAAGGCTCAGAGG - Intronic
1124965972 15:34433984-34434006 CAGCAGGTGCAAAGGCCTGGAGG + Intronic
1124982592 15:34580083-34580105 CAGCAGGTGCAAAGGCCTGGAGG + Intronic
1125195759 15:37044201-37044223 CAGCTTGAGGAAAGGAATAGAGG - Intronic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1126023845 15:44427342-44427364 CAGGATGAGCAAGGGCCTGGGGG - Exonic
1126142811 15:45451484-45451506 CAGCCTGAGCCAGGGCCAGGAGG + Intergenic
1126176164 15:45737783-45737805 CAGCCTTATTAAGGGCATGGTGG + Intergenic
1126194440 15:45916728-45916750 CAGCCTGAGATGAGGCAAGGAGG - Intergenic
1126715007 15:51506348-51506370 CAGGCTGGGCATGGGCATGGTGG - Intronic
1126793645 15:52242873-52242895 CAGCATGAGTAAAGGCATGGAGG + Intronic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127254254 15:57275440-57275462 GAGTCTGAGCCCAGGCATGGTGG - Intronic
1127671452 15:61198929-61198951 GAGCCTCAGCAAAGGCAGGAAGG - Intronic
1127961732 15:63895338-63895360 CAGCTTGAGCAAAGACACAGAGG - Intergenic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128095064 15:64947745-64947767 CACCCTGTGCAGAGGCCTGGAGG - Intronic
1128156391 15:65394447-65394469 CAGCCTGAGCAATGGGCAGGTGG - Exonic
1128243302 15:66116095-66116117 CCCCATCAGCAAAGGCATGGAGG - Intronic
1128311774 15:66635418-66635440 TATCCTGAGCAAAGGTTTGGGGG - Intronic
1128325910 15:66724032-66724054 CAGCTTGTGCAAAAGCAAGGAGG + Intronic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128360116 15:66956090-66956112 CAGCATGGGCAAAGGCCCGGGGG - Intergenic
1128369147 15:67026868-67026890 TGGCATGAGCAAAGGCATAGAGG - Intergenic
1128463366 15:67888276-67888298 CAGAATGAGCAAAAGCCTGGAGG + Intergenic
1128477860 15:68012772-68012794 CAGCATAAGCAAAGTCACGGAGG + Intergenic
1128484569 15:68072004-68072026 CAGCATGAGCAAAGGTAATGAGG + Intronic
1128560077 15:68658930-68658952 CAGCCGGGGCAAAGGCGTGTAGG - Intronic
1128573726 15:68755070-68755092 CTTCCTGAGCAAAGGCGTTGCGG + Intergenic
1128699431 15:69793619-69793641 CAGAGTGAGCAAAGGCACAGAGG - Intergenic
1129191962 15:73942505-73942527 CAGCATGAACAAAGACCTGGAGG - Intronic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1129247835 15:74290643-74290665 CCCCATGTGCAAAGGCATGGAGG + Intronic
1129252294 15:74315722-74315744 CTGCGTGAGCAAAGGCACAGAGG + Intronic
1129283638 15:74506105-74506127 CTGCCGGTGCAAAGGCAGGGTGG - Intergenic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129355221 15:74986356-74986378 CCGCATGAGCAAAAGCAAGGAGG + Intronic
1129452286 15:75657849-75657871 CAGCATGGGCAAAGTTATGGAGG + Exonic
1129685711 15:77685064-77685086 CAGCTTGAGCAAGGGCCTGGAGG + Intronic
1129705829 15:77793512-77793534 CAGCCTGAGCAAAGGTGCAGTGG - Intronic
1129713873 15:77835941-77835963 CTGTGTGAGCAAAGGCTTGGAGG - Intergenic
1129888604 15:79056155-79056177 CAGCATGTGCAAAGGCCAGGAGG + Intronic
1129969796 15:79768224-79768246 TAGCATGTGCAAAGGCCTGGAGG - Intergenic
1130373638 15:83308857-83308879 CTTGCTGAGCAAAGGCACGGAGG - Intergenic
1130821635 15:87502227-87502249 CAGCCTGTGCAAAGGCATGGGGG - Intergenic
1130864242 15:87918475-87918497 TAGCATGAGCAAAGTCATGGAGG - Intronic
1130919967 15:88335606-88335628 CAGCATGAACAGAGGCTTGGAGG + Intergenic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1131640121 15:94283409-94283431 CAGCCTGTGCAAAGCCAAGGGGG - Intronic
1132046173 15:98564493-98564515 CAGCCTGAGCTGAGGCATCAGGG + Intergenic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1132878073 16:2149024-2149046 CGGCCTGAGCCAAGGGTTGGGGG + Intronic
1132918580 16:2369402-2369424 CAACATGAGCAAAGCCAAGGTGG - Intergenic
1132991200 16:2795712-2795734 CAGCCTCCCCAAAGGCTTGGAGG + Intergenic
1133410935 16:5568269-5568291 CAGCTTGGGCAAAGGCAAGGAGG - Intergenic
1133444967 16:5852210-5852232 CAGCATGGGCAAAGGCTAGGAGG - Intergenic
1133568980 16:7023083-7023105 CAGCCAGTGCAAAGGCACTGAGG + Intronic
1133631474 16:7626129-7626151 AAGCCTCTGCAAAGGCATGGAGG + Intronic
1133770057 16:8862677-8862699 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1133867599 16:9658583-9658605 CAGCTTGCACAAAGGCCTGGTGG + Intergenic
1133873782 16:9714027-9714049 CAGACTGAGCAAGGGGGTGGAGG - Intergenic
1134019727 16:10913125-10913147 CAGCCGGTGCAAAGGCCTGGAGG - Intronic
1134067736 16:11240057-11240079 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
1134084769 16:11348854-11348876 CAGCCTGTGCAAAGGCTTGAAGG + Intronic
1134397366 16:13877343-13877365 CAGCCTGAGAAAGGACAGGGTGG + Intergenic
1134818606 16:17227325-17227347 CTGCATGTGCAAAGGTATGGTGG + Intronic
1135231659 16:20714185-20714207 CAGCAAGAGCAAAGATATGGAGG + Intronic
1135340196 16:21638778-21638800 CAGCATGTGCAAAAGCATGAAGG + Intronic
1135775867 16:25257446-25257468 CAGGCTGAGGAAAGGCTGGGCGG + Exonic
1135825213 16:25721168-25721190 CAGTGTGTGCAAAGGCTTGGAGG + Intronic
1136003219 16:27311949-27311971 CAGCATGAGCAAATACCTGGAGG - Intergenic
1136006861 16:27336736-27336758 CAGAGAGAGAAAAGGCATGGAGG + Intronic
1136045072 16:27609018-27609040 CAGCATGAACAAAGGTTTGGGGG - Intronic
1136069274 16:27778365-27778387 CAGCCTGGGCAAAGGCTGAGAGG + Intronic
1136096992 16:27963754-27963776 CAGCATGTGCAAAGCCATGGTGG - Intronic
1136289753 16:29264495-29264517 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1137066476 16:35850578-35850600 CAGCCTGACCAAAGCCACAGTGG - Intergenic
1137558275 16:49486816-49486838 CACCATGAGCAAAGGCATGGAGG + Intergenic
1137626199 16:49910332-49910354 CCCACTGAGCAAAGGCCTGGTGG + Intergenic
1137720176 16:50623095-50623117 CTGCAGGAGCAAAGGCCTGGAGG + Intronic
1137753065 16:50880741-50880763 CAGCCTGAGCAAGGGCCCTGGGG + Intergenic
1137797710 16:51236212-51236234 CAGCAAGTGCAAAGGCCTGGAGG - Intergenic
1137972675 16:53001332-53001354 GATCCTGAGCCAAGGAATGGAGG + Intergenic
1138168733 16:54829314-54829336 CAACCTCTGCAAAGGAATGGGGG - Intergenic
1138224080 16:55277663-55277685 GAGCATGAGCAAAGGCCTGGAGG + Intergenic
1138482011 16:57309705-57309727 CATCATGAGCAAAGGCCTAGGGG + Intergenic
1138532651 16:57643221-57643243 CAGTGTGTGCAAAGGCTTGGAGG + Intronic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1139234378 16:65319065-65319087 GAGCCTGAATAAAGGCCTGGAGG + Intergenic
1139320680 16:66111360-66111382 CACACTCAGCAAAGCCATGGAGG + Intergenic
1139332939 16:66207935-66207957 CAGCCAGTACAAAGGCACGGGGG - Intergenic
1139384254 16:66554369-66554391 CCACCTGAGTAAAGGCATGGAGG + Intronic
1139435645 16:66935131-66935153 CCGCTTGAGCAAAGGCAGGAAGG - Exonic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1139456890 16:67087021-67087043 CAGTGTATGCAAAGGCATGGAGG + Intronic
1139514462 16:67445132-67445154 CAGCATGTGCAAAGGCCTGGAGG + Intronic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1139837457 16:69850650-69850672 CAGCATGAGTGAAGGCAAGGAGG + Intronic
1139946925 16:70647993-70648015 CAGTGTGAGCAAAGGTTTGGCGG + Intronic
1140663362 16:77208593-77208615 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1140888186 16:79262552-79262574 CAGCACACGCAAAGGCATGGAGG + Intergenic
1141481641 16:84310343-84310365 CAGCACGGGCAAAGGCCTGGAGG + Intronic
1141685792 16:85569185-85569207 CAGCCTGGCCAAAGGTGTGGAGG - Intergenic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1141768198 16:86072439-86072461 CAGCCGGTGCAAACGCTTGGAGG - Intergenic
1141847098 16:86618300-86618322 TAGCTTGAACAAAGGCATGGAGG - Intergenic
1142095634 16:88237971-88237993 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1142212699 16:88816051-88816073 CACCGTGAGCAGAGCCATGGGGG - Intronic
1142264797 16:89058714-89058736 CAGCCTGAGACGAGGCCTGGAGG + Intergenic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143014773 17:3885814-3885836 CAGCCAGGGCAAAGGCATGGAGG - Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143186173 17:5011827-5011849 CAGCCTGGACAGAAGCATGGAGG - Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1143375751 17:6466131-6466153 CGGTGTGAGCAAAGGCCTGGAGG - Intronic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1143720659 17:8806811-8806833 CAGCTTGAAGAATGGCATGGGGG - Intronic
1143777710 17:9210192-9210214 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1143846537 17:9776438-9776460 CAGCCTGAGCAAATTCATATAGG + Intronic
1144348276 17:14369480-14369502 GAGCCTGAGGAAAGGAATGGGGG + Intergenic
1144771546 17:17762313-17762335 CAGCATGTGCAAAGGCCTGGGGG + Intronic
1144840358 17:18182329-18182351 CAGCCTGGGCAAAGGCCAGGAGG + Intergenic
1144851965 17:18248388-18248410 CAGTATGAGCAAAGGTCTGGAGG - Intronic
1144890102 17:18489559-18489581 CAGCATATGCAAAAGCATGGTGG - Intronic
1145064234 17:19751162-19751184 CAGCATGTGCAAAGGCCTTGTGG - Intergenic
1145142114 17:20454758-20454780 CAGCATATGCAAAAGCATGGTGG + Intronic
1145261253 17:21356027-21356049 CAGCCTGGGCAAAAGCCTGGAGG + Intergenic
1145284539 17:21495557-21495579 CATCCTAAGCAGAGGCAAGGAGG + Intergenic
1145305434 17:21671716-21671738 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1145793794 17:27644143-27644165 CAGCATATGCAAAAGCATGGTGG - Intronic
1145887229 17:28390813-28390835 CAGCATGAGCAAAGGAATAAAGG + Intronic
1146173803 17:30652005-30652027 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146347259 17:32068026-32068048 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146442336 17:32908014-32908036 AAGCCTGAGCAAAGGCCCTGAGG + Intergenic
1146606954 17:34268794-34268816 TAGCCTGAGCAAAGTCATAGGGG + Intergenic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146663170 17:34678703-34678725 TAGCATGAGCAAAGGTATGGGGG - Intergenic
1146679027 17:34793689-34793711 CAGACTGGGCAAAGGCATGGAGG - Intergenic
1146938668 17:36828311-36828333 CAGCATAAGCAAAGGCACAGAGG + Intergenic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147650768 17:42060602-42060624 CAGCCGGAGCAAAGGCATTGAGG - Intronic
1147872355 17:43596533-43596555 CAGCATGAGCAAAGGCTTGGAGG - Intergenic
1147980760 17:44272649-44272671 CAGCCTGAGCCAAGGCAGCAGGG + Intergenic
1147987130 17:44313085-44313107 CAGGCTGAGCCAGGGCAGGGAGG - Exonic
1148773592 17:50080603-50080625 CACCCTGGGGAAAGGCATGGAGG - Intronic
1148874747 17:50680327-50680349 CAGCCTGGGCAAAGGAGTGGAGG + Intronic
1148965054 17:51428029-51428051 GAGCCCGCGCAAAGGCAGGGAGG + Intergenic
1149864935 17:60146148-60146170 CAGAATGAGAAAAGGCATGGAGG - Intergenic
1149866416 17:60153690-60153712 GAGACTGAGCAAAGGCAGAGCGG + Intronic
1150303439 17:64064804-64064826 CAGCCTGAACAAAGGCCCCGGGG + Intronic
1150341603 17:64372788-64372810 CAGCATGAGGCCAGGCATGGTGG - Intronic
1150853619 17:68729585-68729607 CAGGCTGAGGCCAGGCATGGTGG + Intergenic
1151365577 17:73614183-73614205 CAGCCAGGGCAAAGGCCTAGAGG - Intronic
1151528766 17:74690504-74690526 CTGCCTTAGCAAAGTCATGATGG + Intronic
1151553114 17:74833313-74833335 CAGCTAGAACAAAGCCATGGCGG - Intronic
1151676472 17:75601393-75601415 CAGCCTGTGCAGAGGCGTGAAGG + Intergenic
1151756768 17:76079724-76079746 CAGCCTAAGCAGCAGCATGGAGG - Exonic
1151764552 17:76125446-76125468 GGGAGTGAGCAAAGGCATGGAGG - Intergenic
1151851892 17:76695701-76695723 CAGCCCATGTAAAGGCATGGAGG + Intronic
1151893143 17:76963033-76963055 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1151907007 17:77055173-77055195 GAGGCTGGGCAAAGGCAGGGAGG - Intergenic
1151973666 17:77471916-77471938 GAGCCTGAGACAAGGCAAGGGGG + Intronic
1152294843 17:79460953-79460975 CACACAGAGCAAAGGCATGGAGG - Intronic
1152301193 17:79495922-79495944 CAGCCTGAGCAGTGGCAGCGTGG + Intronic
1152327722 17:79651222-79651244 AACCCTGAGCCAAGGCTTGGGGG - Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1153227770 18:2910966-2910988 CACTCTGAGCAGAGGCCTGGAGG - Intronic
1155304060 18:24462134-24462156 AAGAATGAGCAAAGGCATGCTGG + Intronic
1155394820 18:25376464-25376486 CAGCCTTAGCCATGGCAAGGGGG - Intergenic
1156016377 18:32551631-32551653 TAGACTGTGCAAAGGCCTGGAGG - Intergenic
1156486786 18:37471494-37471516 CAGCAGGGGCAAAGGCAAGGAGG - Intronic
1156556922 18:38078300-38078322 CAGCCTCAGCTAAAGCTTGGAGG - Intergenic
1156817121 18:41324984-41325006 CAGCCTACCCAAAGGCTTGGAGG + Intergenic
1157824072 18:50796645-50796667 CAGACTGAGCAAAGGTGAGGGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158852508 18:61509444-61509466 CAGCCAGTGCAAAGGCTTTGAGG + Intronic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159484519 18:69037634-69037656 GAACATGAGCAAAGGCATGAGGG + Intronic
1159572120 18:70127638-70127660 CAGCCTGAACAATGGAATGGAGG + Exonic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1160692018 19:464532-464554 CAGCTTGGGCAAAGTCCTGGAGG - Intronic
1160752038 19:738913-738935 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1160872736 19:1284543-1284565 CAGCCTGAACAAAGGTCAGGTGG + Intergenic
1160916822 19:1500737-1500759 CAGCCTGTGCAAAGGCCTTGAGG + Intergenic
1161073559 19:2274187-2274209 CAACTTGGGCAAAGGCGTGGAGG + Intronic
1161258915 19:3324807-3324829 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161345426 19:3766791-3766813 CAGCCTGTGCAAAGGCCCCGGGG + Intronic
1161346553 19:3771305-3771327 CAGTGTGTGCAAAGACATGGAGG - Intronic
1161483279 19:4521481-4521503 CAGCCTCAGCAAAGGCCCGGAGG + Intergenic
1161492569 19:4570299-4570321 CAGCCTGAGCCAAGGTCTGCAGG - Intergenic
1161501337 19:4617731-4617753 CAGCATGGGCAAAGGCCGGGTGG - Intergenic
1161502605 19:4624964-4624986 CAGCTTCAGCAAAGGCTTGGGGG - Intergenic
1161506350 19:4645931-4645953 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1161522252 19:4731111-4731133 CAGCCTGTGCAAAGGCCCTGCGG - Intergenic
1161533840 19:4806583-4806605 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161618738 19:5287154-5287176 CAGCAGAAGCAAAGGCTTGGAGG - Intronic
1161635308 19:5384970-5384992 CAGCCAGAGCAAAGGCCCTGCGG - Intergenic
1161650343 19:5480478-5480500 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161658828 19:5533442-5533464 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161662883 19:5558040-5558062 CAGCATGTGCAAAGGCCTGGAGG + Intergenic
1161664236 19:5565220-5565242 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1161795982 19:6387105-6387127 CAGCCTGCGGAAAGCCAAGGGGG + Intronic
1161931747 19:7345234-7345256 CTGCCAGGGCAAAGGCTTGGAGG - Intergenic
1162061944 19:8101475-8101497 CAGCAGGAGCCAAGGCCTGGAGG - Intronic
1162156367 19:8680856-8680878 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1162400655 19:10444631-10444653 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162444962 19:10717290-10717312 CAGCATTTGCAAAGGCGTGGAGG + Intergenic
1162449805 19:10747949-10747971 CAGCCTGGGCAAAGGCCCTGGGG + Intronic
1162548995 19:11348117-11348139 CAGCATGTGCAAAAGCTTGGAGG - Intronic
1162554839 19:11380441-11380463 CAGCATGGGCAAAAGCTTGGGGG + Intronic
1162829986 19:13278359-13278381 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1162830097 19:13278984-13279006 CAGCCTGGTCAAAGGCCTGGTGG + Intronic
1162850981 19:13430950-13430972 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162932138 19:13962586-13962608 CAGCCTCAGCCAGGGCAGGGAGG - Exonic
1162988613 19:14288035-14288057 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1163348980 19:16763474-16763496 CAGCATGGGCAAAGGTCTGGAGG - Intronic
1163448178 19:17359955-17359977 CAGCCAGGCCAAAGGCCTGGAGG - Intronic
1163481665 19:17560140-17560162 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163506072 19:17707030-17707052 CAGCGTGTGCAAAGGCCTGCGGG - Intergenic
1163528480 19:17835588-17835610 CAGCCTAGGCAAAGGCCTGCAGG - Intronic
1163531282 19:17850453-17850475 CAGCCCAGGCAAAGGCCTGGAGG + Intergenic
1163550773 19:17965514-17965536 CAGCAAGTGCAAAGGCCTGGAGG + Intronic
1163581912 19:18144341-18144363 CTGCATGAGCAAAGGCCAGGAGG + Intronic
1163705026 19:18807556-18807578 CAGCGTGTGTAAAGGCTTGGAGG + Intergenic
1163770179 19:19186274-19186296 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1164513607 19:28916315-28916337 TAGCCTGATCAGAGGCAAGGGGG - Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1165282198 19:34807096-34807118 CAGCATGTGCAAAGGTTTGGAGG - Intergenic
1165300090 19:34963359-34963381 CAGCGTGCGCAAAAGCTTGGGGG - Intronic
1165323891 19:35102872-35102894 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1165566980 19:36738865-36738887 GAGGCTGAGAAAAGTCATGGGGG + Intronic
1165807274 19:38588156-38588178 CAGCCTGTGCAAAGGATTTGAGG + Intronic
1166117086 19:40662871-40662893 CTGCCTTAGCAAAGTCTTGGAGG + Intergenic
1166217291 19:41343940-41343962 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1166314277 19:41980081-41980103 CAGCCTGTGCAAAGGCCCAGAGG - Intronic
1166388894 19:42397831-42397853 CAGCGTGACCAAAGACAGGGAGG + Intergenic
1166537880 19:43586628-43586650 CACTCCGAGCAAAGGCATGGGGG + Exonic
1166671265 19:44710791-44710813 CAGACTGAGAAAAGTCTTGGGGG - Intergenic
1166673179 19:44723679-44723701 CAGCCTGTGCGAAGGCCTGAAGG + Intergenic
1166709932 19:44930350-44930372 CAGCCTGGGCATACGCAGGGAGG + Intergenic
1166742308 19:45121898-45121920 CAGCCTGGGGAAGGGCTTGGAGG + Intronic
1166860886 19:45810516-45810538 CAGCCTGTGCCAAGGCCTGGAGG - Intronic
1167004461 19:46766649-46766671 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167170410 19:47827374-47827396 CAGCAGGTGCAAAGGCTTGGAGG - Intronic
1167562226 19:50232784-50232806 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167615822 19:50532518-50532540 GAGCCTGTGCAAAGGCAGAGAGG - Intronic
1167786800 19:51644007-51644029 GATCCTGAGCAATGGCATGTCGG - Exonic
1167923218 19:52801450-52801472 CAACATGATCAAAGGCATGCTGG - Exonic
1167928301 19:52841899-52841921 CAACATGATCAAAGGCATGCTGG - Exonic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925202695 2:1981737-1981759 CAGCTTGAGAGAGGGCATGGAGG + Intronic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926295207 2:11564080-11564102 CAGCATGTGCAAAGGCTTAGTGG + Intronic
926352790 2:12012084-12012106 CAACATGAGCAAAGGTACGGAGG - Intergenic
926547558 2:14260634-14260656 CAGCTTGAGGAAAGGGATGAGGG + Intergenic
926553957 2:14334792-14334814 GAGCTTGAGCAAAGGCCTGGAGG + Intergenic
926630133 2:15128619-15128641 CAGGGTGTGCAATGGCATGGAGG + Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927212023 2:20644938-20644960 CATCCTAAGCAAAGGCACGGAGG - Intronic
927460553 2:23294804-23294826 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
927848642 2:26485182-26485204 CAGCAGATGCAAAGGCATGGAGG - Intronic
927895920 2:26781821-26781843 CAGCCAGAGGCCAGGCATGGTGG + Intronic
928259779 2:29756138-29756160 CTGCATGTGCAAAGGCCTGGAGG - Intronic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
928970455 2:37022462-37022484 TAGCCTGAGCCCAGGCATGGTGG - Intronic
929579778 2:43074520-43074542 TAGCCTAAGCAAAGGCAGAGAGG + Intergenic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929929079 2:46238237-46238259 CAGCCTGAGCAAAGGTGCAGAGG - Intergenic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930343112 2:50142834-50142856 CAGACTGAGCAAAAGCAAGAAGG + Intronic
930575040 2:53136298-53136320 CAGCATAAGCAAAAGCTTGGAGG + Intergenic
930606353 2:53497225-53497247 CAGCCTGGGCAAAGGCTGGGAGG - Intergenic
930625956 2:53697879-53697901 AAGTCTGAGCAAAGCCATAGGGG - Intronic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
931273053 2:60719595-60719617 CAGCCTGAACAAAGGCACAGAGG + Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931384588 2:61786626-61786648 CCATCTGAGCAAAGGCATGGAGG + Intergenic
931493900 2:62781628-62781650 CAGCTTGAGCAGAGGTCTGGAGG + Intronic
932195516 2:69779868-69779890 CACCCTGAGCAAAGGTACAGAGG - Intronic
932235661 2:70119248-70119270 CAGCCAGTGCAAAGGCCTTGAGG + Intergenic
932527696 2:72489037-72489059 GAGCCAGAGCAAAGGCCTGAAGG - Intronic
932838571 2:75060471-75060493 GAGCAAGTGCAAAGGCATGGGGG + Intronic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933609831 2:84422335-84422357 CAGCCTGTGCAAAGTCAGGGAGG - Intergenic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934091318 2:88553109-88553131 CAGCCCATGCAAAGGCATGGAGG - Intergenic
934173671 2:89560473-89560495 CAGCCTGAGAAGATGCTTGGCGG + Intergenic
934283985 2:91634822-91634844 CAGCCTGAGAAGATGCTTGGCGG + Intergenic
935277310 2:101486065-101486087 CAGCTTGTGCAAAGGCACTGAGG - Intergenic
935688337 2:105706893-105706915 CAGCCTGGGCAAAGGCACTGGGG - Intergenic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
936444672 2:112586218-112586240 AAGGCTGAGCACAGGCCTGGCGG - Exonic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937124365 2:119464012-119464034 CAGCCTCAGCAGGGGCTTGGGGG + Intronic
937317960 2:120943940-120943962 CCGCCTGAGCCAAGGTGTGGGGG - Intronic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
937880772 2:126862939-126862961 CAGCCAGAGTGCAGGCATGGAGG - Intergenic
938080472 2:128367391-128367413 AAGGCTGAGCAAAGGCAGTGGGG + Intergenic
938109678 2:128555477-128555499 CACCTTGTGCAAAGGCATGGAGG - Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
938782952 2:134601970-134601992 CAGCTTGAACAAAGGCTTGGAGG + Intronic
938902436 2:135809322-135809344 CAGGCTGATCAATGGCTTGGTGG - Exonic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939400223 2:141683256-141683278 CAGCCTGTTCAAAGAAATGGAGG - Intronic
939414890 2:141882963-141882985 CAGTCTCACCAAAGGCATTGCGG + Intronic
939609599 2:144294279-144294301 CAGCATGTGCAAAGGCCTTGTGG - Intronic
940003591 2:148991251-148991273 CAGCACCAGCAAGGGCATGGAGG - Intronic
941544098 2:166823829-166823851 TAACCTGAGAAAAGACATGGAGG + Intergenic
942120775 2:172774464-172774486 AAGCTTGAGTAAAGGCATGGGGG - Intronic
942132417 2:172893263-172893285 ATGCCTGGGCAAAGGCAGGGAGG + Intronic
942143024 2:172996996-172997018 CAGCCCTAGCAAACGAATGGTGG - Intronic
942887535 2:180945297-180945319 AAGACTGGGCAAATGCATGGAGG - Intergenic
943376517 2:187084300-187084322 CAGCTTAAGCAAAGGCAAAGAGG + Intergenic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
944590236 2:201210089-201210111 TAGCATGAACAAAAGCATGGGGG + Intronic
944657447 2:201890306-201890328 CAGCATGAGCAAAGATATGAAGG - Intronic
945143760 2:206715061-206715083 CAGACTGGGCAAAGGCATGGAGG + Intronic
945186401 2:207144190-207144212 TAGACTGAGCAAAGGCTGGGTGG + Intronic
945221184 2:207485781-207485803 CAACATGAGCAAAGGGTTGGGGG + Intergenic
946104336 2:217355993-217356015 CAGCCTGAGCTAAGGCACTGTGG + Intronic
946166781 2:217869336-217869358 CAGCCTCTGAAAAGGCAGGGAGG + Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946238752 2:218341382-218341404 CAGCTTGAACAAAGGCCTAGAGG + Intronic
946239781 2:218346440-218346462 CAGCATGAGCGAAGGCACAGAGG - Exonic
946528717 2:220548476-220548498 CAGCCTGAGCCAAGGCCTGGAGG + Intergenic
946827127 2:223690482-223690504 CAGCATGAACAAAGACATGGGGG - Intergenic
947748545 2:232521615-232521637 TGGCCTGTGCAAAGGCAGGGAGG + Intronic
947907446 2:233775670-233775692 CAGCCACAGCAATGGGATGGTGG - Exonic
948131320 2:235602582-235602604 CACACTGAGCAAAGGCTTGAAGG - Intronic
948217820 2:236244899-236244921 CAGACTGACCCAAGGCCTGGAGG + Intronic
948329929 2:237156736-237156758 CAGTCTGAGCAACGTCCTGGGGG - Intergenic
948463623 2:238141987-238142009 CAGCTTGTGCACAGGCAAGGAGG + Intronic
948589398 2:239039516-239039538 CAGCCTGTGCAAAGGCCTGGAGG + Intergenic
948628322 2:239284337-239284359 CAGAGTGAGCCAACGCATGGGGG + Intronic
1168792696 20:590571-590593 CATCCTGGGCAAAGGCTTGGTGG + Intergenic
1168837768 20:889053-889075 CAGCATGTGCAAAGGCCCGGAGG - Intronic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1168961880 20:1875649-1875671 CTGCATGAGCAAAGGTAAGGAGG - Intergenic
1168973764 20:1948910-1948932 CAGCCAGGGCAAAGGCTGGGAGG + Intergenic
1168978251 20:1983912-1983934 CAGCATGTGCAAAGGCCTGGGGG - Intronic
1169303960 20:4471959-4471981 CAGCCCATGCAAAGGCCTGGAGG - Intergenic
1169802413 20:9523699-9523721 CACCAAGAGCAAAGGCATGAGGG + Intronic
1170117503 20:12876148-12876170 TGCCCTGAGCAAAGGCATGTGGG - Intergenic
1170370926 20:15647310-15647332 CAGCCTGGGCAAAAGCACAGGGG + Intronic
1170556780 20:17521338-17521360 CAGCATGAAGAAATGCATGGTGG + Intronic
1171290543 20:23980620-23980642 CGGCGTGGGCAAAGGCCTGGGGG + Intergenic
1171969106 20:31552280-31552302 CAGCTTCAGCAAAGGGCTGGAGG + Intronic
1172012607 20:31854667-31854689 GAGCTTGAGCAAAGTCCTGGAGG + Intronic
1172095172 20:32456965-32456987 CAGCCTAGGCACAGGCACGGTGG + Intronic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172407728 20:34702066-34702088 CAGCTTGAGCAAAAGGGTGGAGG + Intronic
1172416354 20:34771712-34771734 CCGCATGAGCAAAGGCCTTGGGG - Intronic
1172490454 20:35332431-35332453 CAGCCTGCAGGAAGGCATGGTGG + Intronic
1172633477 20:36394044-36394066 CAGCATGTGCAAAGGCCTTGAGG - Intronic
1172634150 20:36398369-36398391 CAGCATGGGCAAAGGCATGGAGG + Intronic
1172754320 20:37272736-37272758 CAGCCTGAGCAAAGGCTTGGAGG + Intergenic
1172774078 20:37397200-37397222 CAGCCAGAGCAAAGGCTCTGAGG - Intronic
1172776036 20:37407596-37407618 CAGCCTGGGCAAAGGCATGGAGG - Intergenic
1172776364 20:37409512-37409534 CAGCCTGTGCACAGGCAGGTGGG - Intergenic
1172783765 20:37452392-37452414 CAGCTTGAGCAAAGGCCAGAAGG - Intergenic
1172804801 20:37604141-37604163 CAGCATGTACAAAGGCCTGGAGG - Intergenic
1172805555 20:37609278-37609300 CAGCCTAAGCAAAGTCAGAGAGG - Intergenic
1172808235 20:37628648-37628670 CAGCATGTGCAAATGCAAGGAGG - Intergenic
1172847012 20:37935526-37935548 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1172892896 20:38279532-38279554 CAGCATGAGCAGAGGTTTGGAGG + Intronic
1172972355 20:38882874-38882896 CAGTGTGTGCAAAGGCCTGGAGG + Intronic
1173176388 20:40767891-40767913 TGGCCAGAGCAAAGGCCTGGGGG - Intergenic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173462503 20:43254560-43254582 CAGCATGGTCAAAGGCAAGGAGG - Intergenic
1173471221 20:43325015-43325037 CAGCATGGGCGAAGGCATGGAGG - Intergenic
1173591909 20:44231433-44231455 CAGCCTCCCCAAAGGCAGGGAGG - Intergenic
1173620205 20:44430553-44430575 CAGCCTGAGCCAAGGCCTAGTGG + Exonic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173791447 20:45830387-45830409 CAGCATGTGCAAAGGCTTGAAGG - Intronic
1173805916 20:45925308-45925330 CAGCGTGTGCCAAGGCCTGGAGG - Intergenic
1173919434 20:46732895-46732917 CAGCAAGAGCAAAGGCCCGGAGG + Intronic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1173946485 20:46954997-46955019 CAGGCTGAGAAAAGGCCTGCAGG - Intronic
1173972651 20:47164455-47164477 GAGCTTGAGGAAAGGCCTGGGGG + Intronic
1173997698 20:47352151-47352173 CAGCCTGGGGGAAGGCAAGGAGG + Intronic
1174061406 20:47835556-47835578 CAGCATGTGCAAAGGCCTGGGGG - Intergenic
1174070120 20:47893767-47893789 CAGCATGTGCAAAGGCCTGGGGG + Intergenic
1174101203 20:48127410-48127432 CAGCATGTGCAAAGGCCTAGCGG - Intergenic
1174150154 20:48480708-48480730 CAGCGTGTGCAAAGGACTGGGGG - Intergenic
1174156273 20:48517458-48517480 CAGCATGTGCAAAGGCCTGGGGG - Intergenic
1174205541 20:48835600-48835622 CAGCAGGTGCAAAGGCTTGGAGG + Intergenic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1174299655 20:49572273-49572295 CAGCATGAGCAAAGGTGTGGAGG - Intergenic
1174398960 20:50265519-50265541 GAGCTGGAGCAAAGGCCTGGAGG + Intergenic
1174479433 20:50820458-50820480 CAGCCTGTGCAAAGGCGGGGAGG + Intronic
1174846794 20:53950289-53950311 CAGCCCTGGCAAAGGCACGGGGG - Intronic
1175829625 20:61955027-61955049 CAGCCTGGGAAAAGGCATACAGG - Intronic
1178482042 21:32987885-32987907 CAGCCTGAGCTAAGATAGGGAGG - Intergenic
1178507746 21:33176685-33176707 ATGTCTGAGCAAAGACATGGGGG - Intergenic
1180150894 21:45947187-45947209 CCATCTGAGCACAGGCATGGTGG - Intergenic
1180955673 22:19740153-19740175 CAGCCACAGCAGAGGCCTGGAGG - Intergenic
1180978768 22:19868829-19868851 CAGCATGGGCAAAGGCACAGAGG + Intergenic
1181046219 22:20215570-20215592 CAACATTAGCAAAGGCCTGGAGG - Intergenic
1181311917 22:21949540-21949562 CAGCATCAGGAATGGCATGGAGG + Intronic
1181409856 22:22711218-22711240 CTCCCAGAGCAAAGGCAGGGAGG - Intergenic
1181646310 22:24233264-24233286 CAGGCTGGACAAAGGCCTGGAGG - Intronic
1181648093 22:24244593-24244615 CAGCGTGGGCAAAGGCCTGGGGG + Exonic
1181761995 22:25065074-25065096 CTGCCTGAGCATAGGCAGGGAGG + Intronic
1181911271 22:26240181-26240203 CAGCATGAGCAAAGGTGTGGGGG - Intronic
1181957310 22:26597301-26597323 CACCATGAACAAAGGCATAGAGG - Intergenic
1181984629 22:26791287-26791309 CAGCATAGGGAAAGGCATGGAGG - Intergenic
1181991586 22:26841103-26841125 CAGCCTGGGCAAAGGCCCGGAGG + Intergenic
1181998989 22:26904655-26904677 CAGCATGTGCAAAGGCCTGGTGG + Intergenic
1182097563 22:27636413-27636435 CAGCAGGTGCAAAGGCTTGGTGG + Intergenic
1182127304 22:27825383-27825405 CAGCATGTGCAAAGGCCTGGAGG - Intergenic
1182135941 22:27903180-27903202 CAGCCAGAGGCCAGGCATGGTGG + Intronic
1182189977 22:28449259-28449281 CAGCATGAGCCAAATCATGGAGG + Intronic
1182455253 22:30446338-30446360 TGGCCTGAGCAAAGGCAGGGAGG - Intergenic
1182459631 22:30474575-30474597 TGGCATGGGCAAAGGCATGGAGG + Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182642609 22:31780558-31780580 CAGCATGTGCGAAGACATGGTGG - Intronic
1182693697 22:32181589-32181611 TAGCATGAGCAAAGGTATAGAGG - Intergenic
1182700860 22:32237044-32237066 CAGCATGAGGAAATGGATGGTGG - Intronic
1183016549 22:34992980-34993002 CATCCTGAGTAAAGGTGTGGGGG - Intergenic
1183020450 22:35022341-35022363 GCGTCTGAGCAAAGGCCTGGAGG + Intergenic
1183334868 22:37240843-37240865 CAGCTTGAGCAAAGGCCCTGGGG + Intronic
1183448675 22:37877999-37878021 CAGCTTGGCCACAGGCATGGTGG - Exonic
1183647470 22:39134799-39134821 CAGCATGAGCAAAGGTGTGGCGG - Intronic
1183717969 22:39545250-39545272 CAGCATGTGCAGAGGCCTGGAGG + Intergenic
1183733298 22:39630076-39630098 CAGCCTGGACAAAGGCCTAGAGG - Intronic
1183735114 22:39640739-39640761 CAGCATGTGCCAAGGCCTGGAGG + Intronic
1183789607 22:40055378-40055400 CAGCCTGTGTAGAGGCATGGGGG + Intronic
1183796362 22:40121745-40121767 AAGCCTTAGCAAAGGGTTGGGGG - Intronic
1183951434 22:41355154-41355176 CAGCCTGTACAAACGCAGGGAGG + Intronic
1184123574 22:42470813-42470835 CAGCCTAATCAAAGGTATAGAGG - Intergenic
1184149751 22:42631161-42631183 CAGCAGGAGTGAAGGCATGGAGG - Intronic
1184275850 22:43409358-43409380 CAGCCTGTGCAAAGGCTCAGAGG - Intergenic
1184419144 22:44369463-44369485 CAGCAAGGGCAAAGGCCTGGAGG - Intergenic
1185256123 22:49833050-49833072 CAGCCCAAGAAAAGGCAAGGAGG + Intergenic
949951896 3:9236149-9236171 CAGCATGTGCAAAGGTATGGGGG - Intronic
949986415 3:9544783-9544805 CAGGATGATCACAGGCATGGAGG - Intronic
950076240 3:10189292-10189314 CAGCATGTACAAAGGCCTGGGGG + Intronic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
950175332 3:10869545-10869567 GAGACTGAGAAAAGGCAAGGAGG + Intronic
950186969 3:10951360-10951382 CAGCCTAAGCCAAGGCCTGTTGG + Intergenic
950216594 3:11164156-11164178 TGGCCTGAGCCAAGGCATAGAGG + Intronic
950280854 3:11706775-11706797 CAGTCTGAGAAAAGGCACAGGGG + Intronic
950306224 3:11917058-11917080 CAGCCAGTGCAAAGACCTGGAGG + Intergenic
950315232 3:11996141-11996163 GAGCCTGGGCAAAGGTGTGGAGG + Intergenic
950387547 3:12672096-12672118 CAGTATGGGCAAAGGCATAGAGG + Intergenic
950395203 3:12728726-12728748 CAGCATGGGCAAAGGCGTGGAGG - Intergenic
950537570 3:13588522-13588544 CTGCCAGAGCAAAGCCAAGGTGG - Intronic
950635203 3:14309174-14309196 CAGCAAGAGCAAAGACAGGGAGG + Intergenic
950659840 3:14460507-14460529 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
950723736 3:14902385-14902407 TGGCCTGGGCAAAGACATGGAGG + Intronic
950900783 3:16495621-16495643 CAGCAAGAGCAAAGGCATGGAGG + Intronic
950929820 3:16777319-16777341 GAGCTTGTGCAAAGGCATTGGGG - Intergenic
951234757 3:20221152-20221174 CAGCCAGAGCAAAGGCCTGAAGG - Intergenic
951566394 3:24016471-24016493 CAGCCTTAGGCAGGGCATGGTGG - Intergenic
952855772 3:37769654-37769676 CAGCATGTGCAAAAGCATAGAGG - Intronic
953386662 3:42510185-42510207 CAGCGTGTGCACAGGCATGGAGG - Intronic
953426654 3:42800473-42800495 CAGCTTGTGCAAAGGCTTAGAGG - Intronic
953606708 3:44417318-44417340 CAGCTTGAGCAAAGCTATGGAGG - Intergenic
953697421 3:45170903-45170925 CCACCTGAGCAAAGGCCTGGGGG - Intergenic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954176324 3:48848309-48848331 CAACAAGAGCAAAGGCCTGGTGG + Intergenic
954217342 3:49131955-49131977 GAGCATGTGCAAAGGCCTGGAGG + Intronic
954385703 3:50242764-50242786 CAGTCTGAGCAAAGGCCTAAAGG + Intronic
954443123 3:50532609-50532631 CGGAGTGAGCAAAGGCTTGGAGG + Intergenic
954608961 3:51934232-51934254 CAGCATGGGGAGAGGCATGGAGG - Intronic
954687265 3:52377667-52377689 CAGCAAGGGCAAAGGCCTGGAGG - Intronic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
954794728 3:53155730-53155752 CAACCTGAGCAGAGGCTTGGTGG + Intergenic
954799568 3:53179380-53179402 CAGCAGGAACAAAGGCCTGGAGG + Intronic
955056602 3:55460812-55460834 CAGCTTGAGCAAAGGCCAAGAGG - Intergenic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
955978923 3:64505244-64505266 CAGCCTTTGCAAGTGCATGGTGG - Intergenic
956048500 3:65222119-65222141 CAGCAGGAGTAAAGGCATGTCGG + Intergenic
956078977 3:65537215-65537237 TAGCTTGAGCAAAGGCATGTTGG - Intronic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
956176966 3:66482090-66482112 CAGCCTGGGCACAGGCAGGCTGG + Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956726150 3:72158102-72158124 CAGCTCGTGCAAAGGCCTGGTGG + Intergenic
956904300 3:73749995-73750017 CAGCTGGAGCAAAGGCCTGAGGG + Intergenic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
958784011 3:98577115-98577137 CAGCCTGAGAAAAGGCCAGAGGG + Intronic
958867470 3:99517811-99517833 AAGACTAAGCCAAGGCATGGTGG - Intergenic
959024955 3:101230597-101230619 GAGCATGAGCAAAGTCAGGGAGG - Intronic
959432603 3:106273230-106273252 CAGGCTGAGCATAGCCCTGGAGG + Intergenic
959542784 3:107559012-107559034 TAGCCTGAGAAAAGGCATAGTGG + Intronic
959571843 3:107893210-107893232 CTGGCTAAGCCAAGGCATGGAGG + Intergenic
959585313 3:108020242-108020264 CAGCCTGAACAAACACATGGGGG + Intergenic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
960306207 3:116064236-116064258 CAGTCTGAGGCCAGGCATGGTGG + Intronic
960916834 3:122703386-122703408 CAGCATGAACATAGGCATGGTGG - Intronic
961009713 3:123427461-123427483 CAGCAGGAGCGAAGGCATGGTGG - Intronic
961107532 3:124254902-124254924 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
961111169 3:124284365-124284387 TAGCTTAAGCAAAGGCCTGGAGG - Intronic
961184581 3:124903419-124903441 AAGCATGAGCAAAGGAATGGAGG + Intergenic
961235884 3:125366753-125366775 TAGCGTAAGCAAAGGCTTGGAGG - Intronic
961808204 3:129504312-129504334 CACCCAAAGCAAAGGCCTGGGGG - Exonic
961809065 3:129511040-129511062 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
962236868 3:133714128-133714150 CAGCAAGCACAAAGGCATGGGGG + Intergenic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
962565022 3:136649114-136649136 TAGTATAAGCAAAGGCATGGAGG - Intronic
962580701 3:136795359-136795381 CAGCTTGAGCAAAGGCCGAGAGG + Intergenic
962701090 3:138000375-138000397 CAGCATGGGCAAAGCCATGAGGG + Intronic
962759235 3:138493403-138493425 AAGCCAGCGCAAATGCATGGAGG - Intergenic
962851307 3:139310149-139310171 TAGCATGGGCAAAGGCATGGAGG + Intronic
962887728 3:139642892-139642914 CAGCAGGATCAAAGGCATGGAGG - Intronic
963016300 3:140827564-140827586 CAGCATGAGTAAAGGCCTAGAGG + Intergenic
963281500 3:143388974-143388996 CGGCATGGGCAAAGGCATAGGGG + Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
965355176 3:167664668-167664690 CAGTCTGTGCTAAGGCCTGGAGG + Intergenic
965532421 3:169786294-169786316 CCGCTTGAGTAAAGGTATGGTGG + Intronic
966683482 3:182668475-182668497 CAGTATAAGCAAAGGCGTGGAGG - Intergenic
966799171 3:183746339-183746361 CAGCCTGAGGCCAGGCTTGGTGG - Intronic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
967307660 3:188074813-188074835 CAGCCTGGGCAACGGCGGGGTGG + Intergenic
967889991 3:194358129-194358151 CAGCCTGTGCAAAGGCCCCGTGG - Exonic
967893359 3:194378893-194378915 AGGGCTGAGCAAAGGCCTGGAGG + Intergenic
967922791 3:194625259-194625281 CAGCATGGGCAAAGGCTAGGAGG - Intronic
967990984 3:195130660-195130682 CAGCCTGAGCAAAGCACTGGAGG + Intronic
968016388 3:195337978-195338000 CAGCCAGTGCAAAGGCATTGAGG - Intronic
968657622 4:1785500-1785522 CAGTCTGAGCCCAGGCCTGGCGG + Intergenic
969052391 4:4382513-4382535 CAGCATTTGCAAAGGCCTGGAGG + Intronic
969172473 4:5375276-5375298 CAGGCTGTGTACAGGCATGGTGG - Intronic
969192459 4:5533324-5533346 CAGCAAGTGCAAAGGCCTGGAGG + Intergenic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969278240 4:6151442-6151464 CAGCTTGGGCAGAGGCATGGAGG - Intronic
969320546 4:6409839-6409861 AAGTCTGGGCAAAGGCTTGGAGG - Intronic
969325472 4:6441520-6441542 CAGCCTGAACAGAGGCGAGGTGG - Intronic
969397156 4:6929533-6929555 CAGCTTGTGCAAAGTCATGGGGG + Intronic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
969515717 4:7647127-7647149 CAGCTTGCGCAAAGGCCTGGAGG + Intronic
969523678 4:7693361-7693383 CAGCCTTGGCAAAGGGGTGGTGG - Intronic
969585252 4:8087818-8087840 CAGCCAGTGCAAAGACTTGGCGG + Intronic
969662245 4:8537077-8537099 CAGCCTGAGCAAAGGCTGAGAGG + Intergenic
969707824 4:8821373-8821395 CACCTTGAGCAAAGGCCTGGAGG + Intergenic
969827526 4:9769302-9769324 CAGCCTGAGGAGATGCTTGGTGG + Intergenic
970174729 4:13327952-13327974 CATCCTGTGCAAAGGCTCGGAGG + Intergenic
970207424 4:13669070-13669092 CCACCTGAGCCTAGGCATGGAGG + Intergenic
970308247 4:14754959-14754981 CAGATTGTGCAAAGGTATGGAGG - Intergenic
970423279 4:15924546-15924568 TAGCCTGGGCAAAGGCTTGGAGG - Intergenic
970464149 4:16306356-16306378 GAGCCTCAGGAAAGGCATGAAGG - Intergenic
970465024 4:16313875-16313897 GAGCCTGAACAAAGACATAGAGG + Intergenic
970491529 4:16580116-16580138 CATGCTGTGCAAAGGCATGGAGG + Intronic
970702755 4:18762341-18762363 AAGACTGAGCAAAAACATGGAGG - Intergenic
971511933 4:27437127-27437149 TAGGATGAGCAAAGGCATGAAGG + Intergenic
972267772 4:37479629-37479651 CAGCATGTGCAAAGGCTCGGTGG + Intronic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972323235 4:37991916-37991938 CTGCATGAGCAAAGGTATGGAGG + Intronic
972629689 4:40832631-40832653 TGGCCTGAGCACAGGCAGGGAGG - Intronic
972688971 4:41378109-41378131 GAACATGAGCAGAGGCATGGAGG + Intronic
973258585 4:48137905-48137927 CAGCTTGAGCAAAGGTAAGGAGG - Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
973855397 4:55006067-55006089 CAGCCTGAGCAAAGGCCCTGAGG + Intergenic
975630367 4:76395578-76395600 TGGCCTGGGCAAAGGCATGCAGG + Intronic
975695778 4:77011479-77011501 CAGCGTGAGCAAAGACACAGAGG + Intronic
975877972 4:78867016-78867038 CAGCCTGAGCAATGGCATGGTGG + Intronic
976060423 4:81121982-81122004 CATCCTGTGCAAAAGCATGTGGG + Intronic
976370727 4:84285779-84285801 GAGGCTGAGCCAAGGCAGGGTGG + Intergenic
976575750 4:86669030-86669052 CGGCCAAAGCAAAGGCATGTGGG - Intronic
977152074 4:93525305-93525327 GGGCCTGAGCAAAGGCATGAAGG + Intronic
977312343 4:95403287-95403309 CAGCCTGAGCAAACTCATGTTGG + Intronic
977927496 4:102717717-102717739 CAGCATGTGCAAAGGTCTGGAGG + Intronic
978128764 4:105168393-105168415 CAGCAAGTGCAAAGGCCTGGAGG - Intronic
978636269 4:110810906-110810928 GAGCCTGAACACAGACATGGTGG - Intergenic
980861789 4:138507785-138507807 CAGAAAGAGCAAAGGCATGAGGG + Intergenic
980932224 4:139192895-139192917 TATCCTGAGCAAAGGCATATGGG - Intergenic
981228836 4:142329024-142329046 CAGCGCATGCAAAGGCATGGAGG - Intronic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
981934733 4:150227546-150227568 CAGTCTGAGCAAAGGCCCAGAGG + Intronic
982178770 4:152730879-152730901 CAGCATGTGCAAAGGCCTAGAGG + Intronic
982217123 4:153092049-153092071 CAGCCTAAGCCAAGGAATGCTGG - Intergenic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
984875942 4:184367488-184367510 TAGCATGAGCAAAGGCTTGAAGG + Intergenic
984887011 4:184458038-184458060 CAGCAAGAGCAAAGACATGAAGG - Intronic
985065560 4:186117577-186117599 CAGTGTGAGCAAAGCCGTGGAGG + Intronic
985614567 5:911668-911690 CAGCGAGAGCAAAGGCTGGGGGG + Intronic
985647865 5:1093574-1093596 CAACCTGAGCCAGGGCGTGGTGG - Exonic
985971140 5:3379492-3379514 CAGCCCGAGCAAACTCATTGTGG - Intergenic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
986575797 5:9211570-9211592 CAGCCTGAGCACAGCTAGGGTGG - Intronic
986640744 5:9869341-9869363 AAGGAAGAGCAAAGGCATGGTGG + Intergenic
986658514 5:10038504-10038526 AAGCCTGAGCAAATGCAAGGAGG - Intergenic
988511315 5:31867034-31867056 CAGGCAGAGTCAAGGCATGGAGG - Intronic
989359045 5:40578632-40578654 CAGCCTACGCAAAGCCGTGGAGG + Intergenic
989444808 5:41514925-41514947 GTGCATGAGCAAAGTCATGGTGG - Intergenic
990625386 5:57604924-57604946 TAGCAAGAACAAAGGCATGGAGG + Intergenic
991627718 5:68621654-68621676 CAGCATGAGCAAAGATATGGAGG - Intergenic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992986894 5:82239593-82239615 CAGCATGTGCAAAGGCCTGTAGG + Intronic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
994059236 5:95455786-95455808 CAGCCTGAGCAAAGGCCTGGAGG + Intergenic
994665255 5:102697132-102697154 CAGCAAAAGCAAAAGCATGGAGG - Intergenic
995373920 5:111452161-111452183 CAGGGAGAGCAAAGTCATGGAGG + Intronic
995454840 5:112340076-112340098 CAGCATGAGAAAAGTCACGGAGG + Intronic
995921783 5:117323092-117323114 GAGCCTGGACAAAGGCATGAAGG + Intergenic
996602231 5:125277653-125277675 GAGTAAGAGCAAAGGCATGGAGG - Intergenic
997196866 5:131986106-131986128 CAGCCTGGGCACAGGCACAGAGG + Intronic
997256069 5:132429088-132429110 TGGCCTGTGCAAAGGCCTGGAGG + Intronic
997353761 5:133249124-133249146 CTGCATTAGCAAAGGCCTGGAGG - Intronic
997392577 5:133529010-133529032 CAGCCGGAGCAAGAGCATGGAGG - Intronic
997623120 5:135313411-135313433 CAACTGGAGCAAAGGCATGCAGG - Intronic
997698617 5:135880766-135880788 CAGCCTGAGCAAAGACCTAGGGG - Intronic
998477187 5:142431925-142431947 CAGCATGTGCACAGGCCTGGAGG + Intergenic
998522739 5:142815661-142815683 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
998609661 5:143674315-143674337 CAGCATATGCAAAGGCTTGGAGG - Intergenic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
998847775 5:146327558-146327580 CAGCTTTAGCAAAGGGAAGGAGG - Intronic
998980729 5:147699061-147699083 TAGCATGAGCAAAGGCCTGGGGG - Intronic
999274917 5:150323905-150323927 CTGCCTGAGTGAAGGCCTGGGGG - Intronic
999448066 5:151657250-151657272 CAGCGAGTGCAAAGGCCTGGAGG + Intergenic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1000371518 5:160541043-160541065 AAACATGAGCAAAGGCATGATGG + Intergenic
1000601849 5:163284605-163284627 CAGCATGAGGAAACACATGGAGG - Intergenic
1000706844 5:164523176-164523198 CAGTAGGAACAAAGGCATGGAGG + Intergenic
1000843281 5:166248384-166248406 CAGCATGTGGAAAGGTATGGAGG - Intergenic
1000965923 5:167656445-167656467 GACAGTGAGCAAAGGCATGGTGG + Intronic
1001288202 5:170438708-170438730 CAGGCTGTGCAATGGCTTGGGGG - Intronic
1001315325 5:170637590-170637612 CAGCCTGAGCAAAGGCCTTGAGG - Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001518943 5:172377110-172377132 CAGCCAGAGCAGAGGAGTGGGGG + Intronic
1001573118 5:172743834-172743856 CAGCATATGCAAAGGTATGGAGG + Intergenic
1001583478 5:172816671-172816693 CCACATGAGCAAAGACATGGAGG + Intergenic
1001597532 5:172907652-172907674 CAGCATGTGCAAAGGCCTGGAGG - Intronic
1001713438 5:173795663-173795685 CTACCTGAGCAAACGTATGGAGG + Intergenic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1001815726 5:174667852-174667874 CAGCATGAGGAAAGGCATTCAGG + Intergenic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1001951280 5:175818256-175818278 CACCATGGGCAAAGGCATAGAGG + Intronic
1002045569 5:176539920-176539942 TAGCCTGAGCAAAGGCAGGAAGG - Intergenic
1002056725 5:176602155-176602177 CAGGCAGCGCCAAGGCATGGAGG - Intronic
1002062156 5:176631563-176631585 CAGCATGGGCAAAGGCACTGTGG + Intronic
1002064268 5:176644256-176644278 CAGTGTAAGCAAAGGCTTGGAGG + Intronic
1002575776 5:180172880-180172902 GAGCATGGGCAAAGGCATGGAGG - Intronic
1002605775 5:180381891-180381913 CGGCCTAAGCAAAGCCATGGGGG - Intergenic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1002943217 6:1735639-1735661 GGGCATGAGAAAAGGCATGGAGG - Intronic
1003518981 6:6841664-6841686 CAGCCTGAGAAGCGGCTTGGAGG - Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1004861931 6:19813202-19813224 CAGCCTGAGTAAAGACAGGAGGG - Intergenic
1004938665 6:20532804-20532826 CAGCCAGAGCAAAAGCAAGGAGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005275684 6:24215227-24215249 CAGCATATGCAAAGGCTTGGAGG + Intronic
1006502721 6:34468600-34468622 CAGCCTGTGCAAAGGCCTGCAGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006678786 6:35782195-35782217 CAGCCAGGGCAAAGGTCTGGGGG + Intronic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1006913523 6:37579424-37579446 CAGCTTGCACAAAGCCATGGGGG + Intergenic
1006975011 6:38091802-38091824 CAGACGGAGCTGAGGCATGGAGG + Intronic
1007081607 6:39109171-39109193 CAGCCTGAGCCAAGGCCTGGAGG + Intronic
1007289564 6:40775179-40775201 CAGCATGTGCAAAGGCAAGCAGG - Intergenic
1007307454 6:40918186-40918208 TAGCATGCTCAAAGGCATGGAGG - Intergenic
1007386032 6:41520779-41520801 CAGCCAGGGCAAAAGCCTGGAGG + Intergenic
1007506286 6:42337726-42337748 TAGCATAAGCAAAGGCATGGAGG + Intronic
1007667861 6:43526499-43526521 CAGCAAGTGCAAAGGCTTGGAGG + Intronic
1007746983 6:44049156-44049178 CAGCATGGACAAAGGCATGGAGG - Intergenic
1007968924 6:46030711-46030733 CAACATGAGCAAAGGCATGGAGG - Intronic
1008071945 6:47106878-47106900 CAGCCAGTGCCAAGGCATGGAGG - Intergenic
1008496031 6:52135420-52135442 CAGCTTGAGCAAAGACATAGTGG - Intergenic
1009850810 6:69195743-69195765 CAGACTGAACAAAGTCCTGGTGG + Intronic
1009878567 6:69537005-69537027 CAGCCTGAGCAAACGAATAGAGG - Intergenic
1010142543 6:72627784-72627806 CAGCATGAGCAAACACATGGTGG - Intronic
1010762123 6:79735420-79735442 CAGCCTATGCAAAGGCACAGAGG - Intergenic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1011706129 6:90003234-90003256 CAGAGTGAGCCAAGGCAGGGTGG - Intronic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1012237757 6:96837793-96837815 CCGCCTGGGCAAAGGCATCGAGG + Intergenic
1013071303 6:106731805-106731827 CAGCACGTGCAAAGGCACGGAGG - Intergenic
1013572723 6:111445860-111445882 CAGTTTAAGCAAAGGTATGGGGG + Intronic
1013584137 6:111563689-111563711 CAGCATGAGCAAATGTCTGGAGG + Intronic
1013994759 6:116295241-116295263 CAGCCTAGGCAAAGGTGTGGAGG + Intronic
1014732006 6:125043263-125043285 CAACTTGGGCAAAGGCCTGGAGG - Intronic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1015633766 6:135255922-135255944 CAGCGTGTGCAAAGCCAGGGAGG - Intergenic
1015946631 6:138508640-138508662 TAGCATGTGCAAAGGCATAGAGG - Intronic
1016097914 6:140060798-140060820 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1016349827 6:143155331-143155353 CAGCATGTGCAAAGACAAGGGGG + Intronic
1016506505 6:144786618-144786640 AAGCCTGAGCAAAGGCACAGAGG - Intronic
1017067133 6:150539542-150539564 TAGCATAAGAAAAGGCATGGAGG - Intergenic
1017221749 6:151973491-151973513 CAGCCTGAGGAATTACATGGCGG - Intronic
1018208883 6:161461206-161461228 CGGCCTGTGCAAAGGTCTGGAGG + Intronic
1018429754 6:163713557-163713579 CAGCCTCACCAAAGAGATGGGGG - Intergenic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1019601240 7:1884803-1884825 CAGCCTGAGCCACAGCAGGGAGG + Intronic
1019698258 7:2459989-2460011 CAGCAGGAGCAAAGGCTTGGAGG + Intergenic
1019921491 7:4166199-4166221 CTGCCTGGGCAAAGGCAGGGAGG + Intronic
1020015503 7:4829179-4829201 CAGCCTGACCCACGGCAAGGAGG - Intronic
1020750550 7:12135534-12135556 CAGCTTGGGCAAAGGTCTGGAGG - Intergenic
1021225138 7:18017917-18017939 CAGCAAGAGCAAAGGCTTTGAGG - Intergenic
1021506314 7:21389400-21389422 CAGCCTGAGGCCGGGCATGGTGG + Intergenic
1021906392 7:25338478-25338500 CAGCCTGAGCAGGGGAATGGGGG + Intergenic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1021962590 7:25887446-25887468 GGGCCTGAGCTCAGGCATGGAGG - Intergenic
1022449771 7:30504327-30504349 CAGCCGGTGCAAAGGCCAGGAGG + Intronic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022573340 7:31474503-31474525 CCGCCTGTGCAAAGGCATCACGG - Intergenic
1022822937 7:33979246-33979268 CAGCATGAGCAAAGGACTGGAGG - Intronic
1023119933 7:36899050-36899072 CAGCCTGAGTGAAGGCTTGGAGG + Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1025233025 7:57215520-57215542 CAGCATGTGCAAAGGCCTAGCGG + Intergenic
1025283382 7:57644113-57644135 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1026359815 7:69592485-69592507 CAGCATGAGCAAAGGTGTGGGGG + Intergenic
1026390494 7:69896813-69896835 CAGCTTGTGCAAAGGCCTTGAGG - Intronic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1026802926 7:73411150-73411172 CAGCCTGGGCTTGGGCATGGAGG - Intergenic
1027698741 7:81442632-81442654 CAGCCTTGGCAAAGGTTTGGAGG - Intergenic
1028584408 7:92438727-92438749 CACCCTGAGCCAAGGCATGAGGG + Intergenic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029251673 7:99241293-99241315 CAGCTTGAGGCCAGGCATGGTGG + Intergenic
1029587764 7:101486404-101486426 CAGCCTCAGCAGAGACATTGAGG + Intronic
1029599641 7:101556134-101556156 TGGCCCGAGCAAAGGCATGGAGG - Intronic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1030017012 7:105232989-105233011 CAGCCTAGGCAAAGGAAAGGAGG + Intronic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030101663 7:105952276-105952298 CAGTTTAGGCAAAGGCATGGAGG + Intronic
1031265319 7:119573013-119573035 CAGCCAGAGCAAAGACAATGGGG + Intergenic
1031454384 7:121961365-121961387 GAGCCTGAGCAAACTCATGGTGG - Intronic
1031915960 7:127563499-127563521 CAGCAAGAGCAAAGCCCTGGAGG + Intergenic
1032233572 7:130099602-130099624 CAGCTTGAGTAAAGGCATTTAGG + Intronic
1032448102 7:132001983-132002005 CAGCATGTGCAAAGGCTTTGAGG + Intergenic
1032666337 7:134040394-134040416 CAGCCAGAATAAAGGCATGGAGG - Intronic
1032684555 7:134219907-134219929 CAGCATGAGAGATGGCATGGTGG - Intronic
1032706388 7:134423963-134423985 CAGCCTGAGCCAAGGCACAGGGG + Intergenic
1032809119 7:135392050-135392072 CCTCCTGAGTAAAGGCATAGAGG - Intronic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1033718123 7:144024387-144024409 CAGCCTGAACAAAGACAAGGAGG - Intergenic
1034625040 7:152485964-152485986 CTGCGTGAGCAAAGGCACAGAGG - Intergenic
1034981992 7:155485035-155485057 CAGCCTGAACAAAGGCCAGCAGG + Intronic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1036147785 8:6270567-6270589 CAGCCTGTGCAAAGGCCGTGAGG + Intergenic
1037109989 8:15154366-15154388 CAGGCTGAGCAAAAGCTGGGTGG - Intronic
1037628283 8:20627942-20627964 CAGTATGAACCAAGGCATGGAGG + Intergenic
1038033310 8:23663497-23663519 GGGCCTAAGCAAAGGCAGGGAGG - Intergenic
1038491797 8:27976953-27976975 CAGCCTGGACTAAGGCAGGGGGG - Intronic
1039483443 8:37892852-37892874 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1039727376 8:40233279-40233301 CAGCCTCCCCAAAGGCTTGGAGG - Intergenic
1039759368 8:40558157-40558179 TTGCCTGAGCCAAGGCAGGGAGG + Intronic
1039870885 8:41544158-41544180 CAGCCTGTGCAAAGGCCCTGAGG + Exonic
1040493874 8:47949099-47949121 CGGCAGGAGCCAAGGCATGGGGG - Intronic
1040584655 8:48727555-48727577 CAGCAAGTGCACAGGCATGGAGG + Intronic
1041373624 8:57190591-57190613 CAGCACAGGCAAAGGCATGGAGG + Intergenic
1041780023 8:61567987-61568009 GAGCAAGAGCAAAGGCTTGGAGG + Intronic
1041988977 8:63962189-63962211 GAATCTGAGCAAAGGCCTGGAGG + Intergenic
1042157107 8:65856186-65856208 TTGCCTGAGAAAAGGCATTGAGG - Intergenic
1042221483 8:66478632-66478654 GAGCCTGAACAAAGCTATGGAGG - Intronic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1044262988 8:90149287-90149309 CAGCCAAAGCCAAGACATGGAGG - Intergenic
1044836752 8:96302867-96302889 CATCCTGAGGCCAGGCATGGTGG - Intronic
1044890311 8:96828229-96828251 CAGCTTGAGGAAAAGCTTGGAGG - Intronic
1045213630 8:100124825-100124847 CAGCATTGGCAAAGGCAAGGAGG + Intronic
1045265385 8:100614363-100614385 CAGACAGAGGAAAGGCATGGGGG + Intronic
1045480537 8:102588079-102588101 CAGCATGAACAAAGACATAGAGG + Intergenic
1045550519 8:103167632-103167654 CAGCATGTGCAAAGGCCTTGAGG + Intronic
1045775506 8:105797742-105797764 CAGCCTGAGCTGAGGTATGAAGG - Intronic
1045901068 8:107280601-107280623 TAGCATAAACAAAGGCATGGAGG + Intronic
1046354152 8:113057018-113057040 CAGCATGTGCAAAGGCCTGGTGG - Intronic
1046794336 8:118354416-118354438 TAGCATGAGCAAAGGCTGGGAGG - Intronic
1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG + Intronic
1047248052 8:123161181-123161203 CTGCCGGTGCAAAGGCCTGGGGG - Intergenic
1047694796 8:127392857-127392879 CAGGATGAGCAAACCCATGGAGG + Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1047853963 8:128889760-128889782 CCACCAGTGCAAAGGCATGGAGG + Intergenic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1048176178 8:132154608-132154630 CAGCCTGTGCAATGGGATGATGG + Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048276692 8:133071394-133071416 AGGCCTGAGGAAAGGGATGGAGG + Intronic
1048332207 8:133478602-133478624 CAGCCTGAGCAGGGACACGGAGG - Intronic
1048509357 8:135048493-135048515 CTGCCTAAGAAAAGGCTTGGAGG - Intergenic
1048856722 8:138692887-138692909 CAACCTGACCATACGCATGGTGG + Intronic
1049224349 8:141442518-141442540 CAGCCTGGGCAAGGGCACAGAGG + Intergenic
1049415213 8:142491919-142491941 CAGCTGGAGCAAGGGCAGGGAGG + Intronic
1049602355 8:143513842-143513864 CAGCCTCAGCAAAGGCTGTGAGG - Intronic
1049701942 8:144019196-144019218 CAGCCTGAGGGCAGGCATGGGGG + Intronic
1049946867 9:605532-605554 CAGCCTGGGCAAAGGTGTAGAGG + Intronic
1050331934 9:4554572-4554594 GAGCCTGTGCAAAGGCCTTGGGG + Intronic
1050340050 9:4627784-4627806 CAGCCTCAGCAAAAGAAAGGTGG + Intronic
1051198416 9:14588835-14588857 CAGCCTGAGAAAAAGCATAAAGG + Intergenic
1051423309 9:16910156-16910178 CAGCCTGAACAAAGACACAGAGG + Intergenic
1052363187 9:27581740-27581762 CAGCCTGGGCAATGGAGTGGGGG + Intergenic
1052610619 9:30768928-30768950 CAGCATGGGCAAAGGCATGGGGG + Intergenic
1052833316 9:33232852-33232874 CAGCATAAGAAAAGGCTTGGAGG + Intronic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053150949 9:35742390-35742412 AAGCATGAGCACAGGCATGGAGG - Intronic
1053198152 9:36136027-36136049 CCGCCTGAGGAAAGGCAGGGAGG + Intergenic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053434033 9:38063438-38063460 CAGCCTGTGCCATGGCCTGGAGG - Intronic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1054703220 9:68435016-68435038 CAGCTTGAGCAAAGGCCTGGAGG - Intronic
1054846594 9:69805296-69805318 CAGCATTAGAAAAGGCAAGGAGG - Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055075739 9:72213314-72213336 CAGCCTGAGAATGGGGATGGGGG + Intronic
1055111342 9:72563087-72563109 CAGCATGAGCAAAGGTGTGGAGG + Intronic
1055130115 9:72765521-72765543 CGGCATGCACAAAGGCATGGAGG + Intronic
1055422217 9:76155884-76155906 CAGCCTGGACAAAGGCAGTGGGG + Intronic
1055493317 9:76828248-76828270 GAGCCTGTGCAAAGGCACTGAGG + Intronic
1055710981 9:79061855-79061877 CAGAATGAGCAAATGCCTGGAGG + Intergenic
1056052375 9:82782737-82782759 CAGCTTGAGCAAAGACCTAGAGG - Intergenic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056474394 9:86939437-86939459 CAGCGTGACCAAAGGCATACAGG - Intergenic
1057561639 9:96132644-96132666 CAACATGAACAAAGGCATGGAGG - Intergenic
1057777820 9:98025235-98025257 CATCCTGTGCAAAGGGCTGGGGG + Intergenic
1057870970 9:98717082-98717104 TAGAATGAGCAAAGGTATGGAGG - Intergenic
1057886668 9:98834846-98834868 CAGCATGAGCAAAGGCTTAAGGG - Intronic
1058003446 9:99890720-99890742 TAGCTTGAGCAAAGGCATAGAGG + Intergenic
1058086737 9:100755798-100755820 CAGCAAGAGCAAAGGCATGGAGG - Intergenic
1058756003 9:108083855-108083877 CGGCCTGAGTAAAGGCATAAAGG + Intergenic
1058791360 9:108449158-108449180 TGGCCTGAGCAAAGTCATGTAGG - Intergenic
1058873210 9:109220247-109220269 TAGCATGAGCAAAGGAACGGTGG + Intronic
1059316098 9:113426957-113426979 TAGCCTGTGCAAAGGCATCTAGG + Intronic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059684910 9:116625752-116625774 CAGCATGAGAAAAGGCTTGTGGG - Intronic
1059687653 9:116652883-116652905 CAGAGTGAGCAAAGGCACAGAGG - Intronic
1059766371 9:117387548-117387570 CAGCCTGTGCAAAGGCCAAGAGG + Intronic
1059982806 9:119791918-119791940 TTGACTGAGCAAAGGCAAGGAGG + Intergenic
1059988923 9:119846362-119846384 CAGCGTGAGCAAAGGCCTGGAGG + Intergenic
1060051719 9:120382968-120382990 CAGCCTGTGCAAAGGCATGGAGG - Intergenic
1060104319 9:120863967-120863989 TAGCCTGAGCAAAGGCTATGAGG + Intronic
1060145917 9:121252281-121252303 CAGCGTGAGCTAAGATATGGGGG + Intronic
1060223505 9:121776537-121776559 CAGCGTGAGCACAGGCCTGGAGG + Intronic
1060265844 9:122111068-122111090 CAGCCTGGGCAAGGGGATGAGGG + Intergenic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1060733734 9:126053335-126053357 CAGCATGGGCAAAAGCAAGGAGG - Intergenic
1060765436 9:126292178-126292200 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1060770976 9:126332115-126332137 CAGCCTCAACAAAGGCACCGTGG - Intronic
1060775741 9:126372891-126372913 CAACACGAGCAAAGGCAGGGAGG + Intronic
1060786110 9:126452675-126452697 CAGCAAGATCAAAGGCATGGGGG - Intronic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1060922777 9:127434132-127434154 CACCATGAGCAGAAGCATGGAGG - Intronic
1060936172 9:127517435-127517457 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1060978835 9:127780836-127780858 CAGCCTGAGCGAAGGCCTGGAGG - Intergenic
1061046634 9:128168785-128168807 CAGCATCAGTAAAGGCACGGAGG - Intronic
1061263003 9:129490238-129490260 CAGCACGTGCAAAGGCCTGGAGG - Intergenic
1061470376 9:130820307-130820329 CAGCCTTTGCAAAGGCATGAAGG - Intronic
1062443453 9:136583702-136583724 CACCCTGGGCAAAGGCCAGGGGG - Intergenic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1186684935 X:11916153-11916175 CAGCTTATGCAAGGGCATGGGGG + Intergenic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1187580540 X:20603011-20603033 CAGCATGAACAAAAGCATGCCGG - Intergenic
1188983788 X:36751697-36751719 CATCCTAAGCAAAGACATGGTGG - Intergenic
1189206349 X:39242480-39242502 CCGCATGAGCAAAGGTATGAAGG + Intergenic
1189225075 X:39406281-39406303 TAGCATGAGCAAAGGCCTGACGG - Intergenic
1189241650 X:39529227-39529249 CAGCAAGGGCAAAGGCCTGGAGG - Intergenic
1189395031 X:40613751-40613773 CACACTGAGGACAGGCATGGTGG + Intergenic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1190286356 X:48963950-48963972 CAGCCTGTGCAAAGGCCTTGAGG - Intronic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1190286971 X:48967786-48967808 CAGCCTGAGAAAAGGCTTAGAGG - Intronic
1190301841 X:49061646-49061668 CAGCCTGGGCAAAGGCCCTGAGG + Intronic
1190311724 X:49121741-49121763 CAGCCCAAGCAATGGCATAGTGG - Intronic
1190312023 X:49123415-49123437 CAGCCTGAGTAAATTCGTGGAGG - Intronic
1190401095 X:50035644-50035666 TTGCCTGAGCACAGGCATGGAGG + Intronic
1190481932 X:50885744-50885766 CAGCATGAGAAATGGCAGGGAGG + Intergenic
1190707637 X:53043866-53043888 CAGCCTGTACAAAGGCTTGGGGG - Intergenic
1190727302 X:53197924-53197946 CAGTCTTAGCATAGACATGGAGG - Intronic
1190736707 X:53260273-53260295 CAGCCAGCGCAAAGGCCCGGAGG + Intronic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1191683804 X:63868581-63868603 CAGCCTAAGTAAAGGCACAGAGG - Intergenic
1191955679 X:66640149-66640171 AAGCTTGAGCCAAGGTATGGGGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192536023 X:71928546-71928568 TTGCATGAGCAAAGGCAAGGAGG + Intergenic
1192632536 X:72788617-72788639 CAGGCTGAGCAAGGAAATGGTGG + Intronic
1192649173 X:72932184-72932206 CAGGCTGAGCAAGGAAATGGTGG - Intronic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1194975377 X:100390858-100390880 CAAAATGAGCAGAGGCATGGTGG + Intronic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1196327308 X:114421995-114422017 TTGCCTGAGAAAATGCATGGAGG + Intergenic
1196424755 X:115559506-115559528 CAGACTGAGCAATAGCATGAAGG - Intergenic
1196432513 X:115641960-115641982 CAGCATGAGCAAAGGCACCTGGG - Intronic
1196505230 X:116434498-116434520 TAGCATGAGCAAAGGCACTGAGG + Intergenic
1196757198 X:119168345-119168367 CAGCATGAGCAAAGTCCTAGAGG - Intergenic
1196919544 X:120571627-120571649 CAGTGTGTGCAAAGACATGGAGG + Intronic
1197194730 X:123687363-123687385 CAGCTTGATGAAAGGCATGTGGG - Intronic
1197640076 X:128958150-128958172 CAGTATGAGCAAAGACATAGAGG - Intergenic
1197827746 X:130608492-130608514 CAGCCTGAGCAATTGGAAGGAGG - Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198081307 X:133242288-133242310 CAGCAAGAGCAAAGGCTTGGTGG + Intergenic
1198438606 X:136640248-136640270 CAGGCTGAGGCCAGGCATGGTGG + Intergenic
1198475066 X:136988145-136988167 CATCATGAGCAAAGGCACGATGG - Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1199780180 X:151051380-151051402 CAGCATGTGCAAAGGCCTGGAGG + Intergenic
1199886008 X:152022583-152022605 TAACAAGAGCAAAGGCATGGTGG - Intergenic
1200243329 X:154508922-154508944 CAACCTGAGCAAAGGCAGTGTGG + Intronic