ID: 964552022

View in Genome Browser
Species Human (GRCh38)
Location 3:157895609-157895631
Sequence TAAGCTGCTGATATTTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964552022_964552023 -9 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552023 3:157895623-157895645 AGCAGCTTACAACACCAAAGTGG No data
964552022_964552027 14 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552027 3:157895646-157895668 ATAATTTACAGGAGGACATCTGG No data
964552022_964552024 3 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552024 3:157895635-157895657 CACCAAAGTGGATAATTTACAGG No data
964552022_964552028 24 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552028 3:157895656-157895678 GGAGGACATCTGGAAGCCAGTGG No data
964552022_964552026 6 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552026 3:157895638-157895660 CAAAGTGGATAATTTACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964552022 Original CRISPR TAAGCTGCTGATATTTGTAC TGG (reversed) Intergenic
No off target data available for this crispr