ID: 964552026

View in Genome Browser
Species Human (GRCh38)
Location 3:157895638-157895660
Sequence CAAAGTGGATAATTTACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964552022_964552026 6 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552026 3:157895638-157895660 CAAAGTGGATAATTTACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964552026 Original CRISPR CAAAGTGGATAATTTACAGG AGG Intergenic
No off target data available for this crispr