ID: 964552027

View in Genome Browser
Species Human (GRCh38)
Location 3:157895646-157895668
Sequence ATAATTTACAGGAGGACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964552022_964552027 14 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552027 3:157895646-157895668 ATAATTTACAGGAGGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964552027 Original CRISPR ATAATTTACAGGAGGACATC TGG Intergenic
No off target data available for this crispr