ID: 964552028

View in Genome Browser
Species Human (GRCh38)
Location 3:157895656-157895678
Sequence GGAGGACATCTGGAAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964552022_964552028 24 Left 964552022 3:157895609-157895631 CCAGTACAAATATCAGCAGCTTA No data
Right 964552028 3:157895656-157895678 GGAGGACATCTGGAAGCCAGTGG No data
964552025_964552028 -4 Left 964552025 3:157895637-157895659 CCAAAGTGGATAATTTACAGGAG No data
Right 964552028 3:157895656-157895678 GGAGGACATCTGGAAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964552028 Original CRISPR GGAGGACATCTGGAAGCCAG TGG Intergenic
No off target data available for this crispr