ID: 964553049

View in Genome Browser
Species Human (GRCh38)
Location 3:157906378-157906400
Sequence TTCATTTTGACTCTGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964553049_964553053 20 Left 964553049 3:157906378-157906400 CCAGAGACCAGAGTCAAAATGAA No data
Right 964553053 3:157906421-157906443 CTGAGTTAGAGAAAGTCAGTAGG No data
964553049_964553055 22 Left 964553049 3:157906378-157906400 CCAGAGACCAGAGTCAAAATGAA No data
Right 964553055 3:157906423-157906445 GAGTTAGAGAAAGTCAGTAGGGG No data
964553049_964553056 29 Left 964553049 3:157906378-157906400 CCAGAGACCAGAGTCAAAATGAA No data
Right 964553056 3:157906430-157906452 AGAAAGTCAGTAGGGGAAAGAGG No data
964553049_964553054 21 Left 964553049 3:157906378-157906400 CCAGAGACCAGAGTCAAAATGAA No data
Right 964553054 3:157906422-157906444 TGAGTTAGAGAAAGTCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964553049 Original CRISPR TTCATTTTGACTCTGGTCTC TGG (reversed) Intergenic
No off target data available for this crispr