ID: 964555295

View in Genome Browser
Species Human (GRCh38)
Location 3:157930565-157930587
Sequence GAATGACATAACCCCGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964555295_964555301 25 Left 964555295 3:157930565-157930587 CCTTTAACGGGGTTATGTCATTC No data
Right 964555301 3:157930613-157930635 GGCTGACGTGGACAGAGGTGAGG No data
964555295_964555299 13 Left 964555295 3:157930565-157930587 CCTTTAACGGGGTTATGTCATTC No data
Right 964555299 3:157930601-157930623 CTGAGACTTGAAGGCTGACGTGG No data
964555295_964555297 4 Left 964555295 3:157930565-157930587 CCTTTAACGGGGTTATGTCATTC No data
Right 964555297 3:157930592-157930614 TGTCTGAGCCTGAGACTTGAAGG No data
964555295_964555302 26 Left 964555295 3:157930565-157930587 CCTTTAACGGGGTTATGTCATTC No data
Right 964555302 3:157930614-157930636 GCTGACGTGGACAGAGGTGAGGG No data
964555295_964555300 20 Left 964555295 3:157930565-157930587 CCTTTAACGGGGTTATGTCATTC No data
Right 964555300 3:157930608-157930630 TTGAAGGCTGACGTGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964555295 Original CRISPR GAATGACATAACCCCGTTAA AGG (reversed) Intergenic
No off target data available for this crispr