ID: 964569955

View in Genome Browser
Species Human (GRCh38)
Location 3:158099653-158099675
Sequence CCATGAGGACAGAAGGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 311}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964569950_964569955 -10 Left 964569950 3:158099640-158099662 CCTTCAGGGATTCCCATGAGGAC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311
964569949_964569955 -9 Left 964569949 3:158099639-158099661 CCCTTCAGGGATTCCCATGAGGA 0: 1
1: 0
2: 0
3: 13
4: 125
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311
964569943_964569955 0 Left 964569943 3:158099630-158099652 CCCCCAGGCCCCTTCAGGGATTC 0: 1
1: 0
2: 2
3: 18
4: 204
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311
964569946_964569955 -3 Left 964569946 3:158099633-158099655 CCAGGCCCCTTCAGGGATTCCCA 0: 1
1: 0
2: 0
3: 18
4: 263
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311
964569947_964569955 -8 Left 964569947 3:158099638-158099660 CCCCTTCAGGGATTCCCATGAGG 0: 1
1: 0
2: 3
3: 18
4: 125
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311
964569944_964569955 -1 Left 964569944 3:158099631-158099653 CCCCAGGCCCCTTCAGGGATTCC 0: 1
1: 0
2: 1
3: 14
4: 275
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311
964569940_964569955 10 Left 964569940 3:158099620-158099642 CCAGTTACTGCCCCCAGGCCCCT 0: 1
1: 1
2: 4
3: 35
4: 320
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311
964569945_964569955 -2 Left 964569945 3:158099632-158099654 CCCAGGCCCCTTCAGGGATTCCC 0: 1
1: 0
2: 0
3: 17
4: 200
Right 964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG 0: 1
1: 0
2: 4
3: 24
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964569955 Original CRISPR CCATGAGGACAGAAGGGACT AGG Intronic
901447929 1:9319480-9319502 GCATGGGGACAGCAGGGCCTCGG - Intronic
901683988 1:10933540-10933562 CCATGAGGAAGGGAGTGACTGGG + Intergenic
901841609 1:11957391-11957413 TCATGGTGACAGAAGGGACTGGG + Intronic
902694718 1:18132699-18132721 CCATGAGCACAGGATGGATTGGG - Intronic
902706636 1:18209887-18209909 ACATGAAGACAGAAAGGCCTGGG - Intronic
903062899 1:20682730-20682752 GGATGAGGACAGCGGGGACTGGG - Exonic
903296469 1:22346395-22346417 CCATGGGAGCAGAAGGGACGGGG + Intergenic
903509013 1:23859666-23859688 ACATGGGGGCAGTAGGGACTGGG - Intronic
903704475 1:25274991-25275013 CAAAGAGGAGAGCAGGGACTGGG + Intronic
903722768 1:25418321-25418343 CAAAGAGGAGAGCAGGGACTGGG - Intronic
904376424 1:30085191-30085213 AGATGAGGAAAGAAGGGACATGG - Intergenic
904851429 1:33462666-33462688 CCAGGAGGACAGGAGCGCCTAGG + Intergenic
905007555 1:34722178-34722200 AGATGAGGAGAGAAGGGACTTGG + Intronic
906120287 1:43385288-43385310 CCAGGAGGAAAGAAGTGACATGG + Intronic
906796260 1:48698486-48698508 GGATGAGGACAAAAGGCACTTGG - Intronic
908693584 1:66810978-66811000 CTTTGATGACAGAAGGGCCTTGG - Intergenic
909496567 1:76285649-76285671 TCATGAGGGCAGAAGTGACTAGG + Intronic
910001711 1:82349977-82349999 CCATGAAGACAGATGAGAGTGGG - Intergenic
915141958 1:153773446-153773468 CCAGGAGGAGGGAAGGGGCTAGG - Exonic
915837256 1:159187834-159187856 CCATGTGCACAGAAGGTAGTAGG + Intronic
917154186 1:171978418-171978440 CCCTGAGGTAGGAAGGGACTTGG + Intronic
920676237 1:208040397-208040419 CCCTGAGGCCAGAAGTGAGTTGG - Intronic
920803380 1:209209912-209209934 CCCTGAGTAAGGAAGGGACTGGG + Intergenic
921262710 1:213397922-213397944 CCGTGGAGACAGAAGGGCCTGGG + Intergenic
922132585 1:222794803-222794825 CCATGAAGCCAGCAGGAACTGGG + Intergenic
922518051 1:226223233-226223255 TGATGAGGACAGACGGGACTAGG + Intergenic
922535987 1:226381383-226381405 CCCTCAGCACAGAAAGGACTGGG + Intronic
922943096 1:229485761-229485783 CAAAGAGGACAGAAGGGATGAGG + Intronic
923685294 1:236149266-236149288 ACATGAGAGCAGAAGGCACTGGG + Intronic
1070724468 10:78778783-78778805 CCAGGAGGACAGATGGGAGCTGG + Intergenic
1070781678 10:79141119-79141141 CCATGACGACACAGGGGACGAGG + Intronic
1071992378 10:91112514-91112536 GCAGCAGCACAGAAGGGACTTGG - Intergenic
1072038413 10:91585226-91585248 CCATGAAGACATTAAGGACTCGG - Intergenic
1073467073 10:103700515-103700537 CCATGATGACAGACAGGCCTGGG + Intronic
1073692133 10:105820852-105820874 TCATGAGGGATGAAGGGACTAGG - Intergenic
1074141895 10:110680491-110680513 CCAGGAGAACAGATGAGACTTGG - Intronic
1074912205 10:117921619-117921641 CCATGAGGAGAGAAGGGGGCAGG - Intergenic
1074964964 10:118482748-118482770 CCAGTAGGACACAAGGGCCTTGG + Intergenic
1075566879 10:123511625-123511647 CTTTGAGGACAGAAGGTGCTCGG - Intergenic
1077253172 11:1569644-1569666 CCCTGAGCACAGACGGGACCAGG + Intronic
1078849119 11:15148048-15148070 CCAGGAGCACAGCAGGGACAAGG + Intronic
1080076708 11:28158309-28158331 GCATGATGACAGAAGTGGCTGGG - Intronic
1080764999 11:35287794-35287816 CCATGTGGATAGAAGTGCCTGGG + Intronic
1082679957 11:56154918-56154940 CCAACAAGCCAGAAGGGACTGGG + Intergenic
1083594312 11:63911772-63911794 CACTGAGGACAGAAGGGACTAGG - Exonic
1083708972 11:64535947-64535969 CGGGGAGGAAAGAAGGGACTTGG + Intergenic
1083855159 11:65389636-65389658 CCATGGGGAAAGGTGGGACTTGG + Intronic
1084605374 11:70169036-70169058 CCATGTGGCCAGGAGGGACGGGG + Intronic
1084717075 11:70880771-70880793 CAAGGAGGACTGAAGGGGCTAGG + Intronic
1084980993 11:72828708-72828730 CCCTGAGGACAGACAGGGCTGGG - Exonic
1087339209 11:96881222-96881244 TCATGAGGAAAGAAGGACCTAGG - Intergenic
1090915023 11:131155626-131155648 CCATGATAACTGAAGAGACTTGG + Intergenic
1092290673 12:7157994-7158016 GGATGAGGACAGCAGTGACTCGG + Exonic
1092812708 12:12286559-12286581 GCATGTGGACAGAAAGGAATGGG - Intergenic
1094676556 12:32626539-32626561 CCCTGAGGTAAGAAGGAACTTGG + Intronic
1095907075 12:47389475-47389497 CCTTGAGGATAGAGGGTACTTGG + Intergenic
1096766694 12:53896818-53896840 CCATGTGGATAGGAGGAACTGGG + Intergenic
1097594346 12:61609950-61609972 CCACAAGGAAAGAAGGAACTGGG - Intergenic
1099297642 12:80849559-80849581 CCAAGAGCACAGCAGGGACATGG - Intronic
1099890537 12:88584167-88584189 TTATGAGGACAGAAGGGCCTTGG - Intergenic
1099907664 12:88791262-88791284 CCATCATGGCAGAAGGCACTGGG + Intergenic
1100162639 12:91878070-91878092 CAATGAGTACATTAGGGACTGGG - Intergenic
1100390309 12:94141424-94141446 CACTGAGGACGGAAGGGGCTAGG + Intergenic
1101540563 12:105661058-105661080 CAGTGAGGACAGAAGGGACTAGG - Intergenic
1103316957 12:120063892-120063914 CCTTGAGGCCAGAGGAGACTTGG + Intronic
1103368199 12:120398380-120398402 CCATGGGGGCAGGAGGGAGTGGG - Intergenic
1103536763 12:121638805-121638827 CCATGAGGGCTGGAGGGACAGGG - Intronic
1104555921 12:129799805-129799827 GGTTGAGCACAGAAGGGACTGGG + Intronic
1104971809 12:132534166-132534188 GCATGGGGGCAGCAGGGACTTGG + Intronic
1105053683 12:133078455-133078477 CCATAAGGCCACGAGGGACTCGG + Intergenic
1109483913 13:62994337-62994359 TCATGAGGACAGAAGATATTTGG + Intergenic
1111714782 13:91866524-91866546 ACATGAGGAGAGAAGGGGCAAGG - Intronic
1113592930 13:111513279-111513301 CTCTGAGGGCAGAAGGGACTTGG + Intergenic
1114277419 14:21159280-21159302 CCATGAGGAAACAAGTGGCTGGG + Intergenic
1114277947 14:21164958-21164980 CCATGAGGAAACAAGTGGCTGGG - Intergenic
1114953277 14:27784172-27784194 AAATGAGGACAGAAGACACTGGG + Intergenic
1117083366 14:52174726-52174748 CCATGAAGACAGAAGGAAAATGG - Intergenic
1117494055 14:56284399-56284421 CCCTAAGGTCAGAAGGCACTTGG - Intronic
1118834504 14:69467369-69467391 CCAGGAGGAAATAAGAGACTTGG + Intergenic
1120817062 14:88872263-88872285 CTATGAGGAAAGAAGGGAGGAGG + Intronic
1122113167 14:99515440-99515462 CCATGGGGCCAGGAGGGACACGG + Intronic
1122416590 14:101552647-101552669 CTATGAGGTCAGAGTGGACTAGG - Intergenic
1124881437 15:33646277-33646299 CCACGAGGGAAAAAGGGACTGGG + Intronic
1125570349 15:40712450-40712472 CCATGAGAAAGGAAGGGAGTAGG + Intronic
1128216293 15:65936565-65936587 CCAAGGGCACAGAAGAGACTGGG + Intronic
1129181715 15:73882003-73882025 CCATAAGGAAGGATGGGACTTGG - Intronic
1129249788 15:74302573-74302595 CCAGCCGGACAGAAAGGACTAGG - Intronic
1129303889 15:74644256-74644278 TCTTGAGGCCAGAAGGAACTTGG - Intronic
1130196169 15:81782223-81782245 CCAAGACAACAGATGGGACTGGG + Intergenic
1130231525 15:82100877-82100899 CCATGAGGTCAGCATGGACGAGG + Intergenic
1130608340 15:85337769-85337791 GCATGAGCACTAAAGGGACTGGG - Intergenic
1132013653 15:98297704-98297726 CCATGAAGCCAGCAGGGGCTGGG + Intergenic
1132466846 16:81510-81532 CCATGAGGACAGAAGTGAACAGG - Intronic
1132546627 16:536184-536206 CACTGAGGACAGCAGGGACAGGG - Intronic
1132693589 16:1192469-1192491 CAATGGGGACAGAAGGGAAGGGG - Intronic
1132953053 16:2575611-2575633 CCCTGAGGAAAGAAGGGAGAGGG + Intronic
1132961298 16:2624557-2624579 CCCTGAGGAAAGAAGGGAGAGGG - Intergenic
1133137476 16:3721902-3721924 CCAACAGGACAGAAGGCTCTGGG - Intergenic
1133342430 16:5045331-5045353 CCATGAGGTCACACGGGACCAGG - Intronic
1133386880 16:5376961-5376983 CCCTGAGTGCAGAAGAGACTTGG - Intergenic
1133606676 16:7394375-7394397 CTAAGGAGACAGAAGGGACTGGG - Intronic
1134079649 16:11316041-11316063 CCAAGAGGACAGCAAGGACAGGG - Intronic
1134269236 16:12719130-12719152 CCATAAGAACAGTATGGACTGGG + Intronic
1134550085 16:15134807-15134829 CGTTGAGGAAAGCAGGGACTGGG + Intronic
1134718384 16:16368188-16368210 CGTTGAGGAAAGCAGGGACTGGG - Intergenic
1134956368 16:18383971-18383993 CGTTGAGGAAAGCAGGGACTGGG + Intergenic
1135871881 16:26158760-26158782 CAGTGTGGTCAGAAGGGACTGGG - Intergenic
1136468026 16:30458728-30458750 CCATGAGATCACAAGGGCCTTGG + Intergenic
1138061740 16:53898513-53898535 CCATGAGGGCAGCAGGGACTTGG + Intronic
1138349848 16:56340657-56340679 CCACAAGGACAGACGGGACGTGG - Intronic
1138536025 16:57660697-57660719 CCCTGAGGCCAGCAGGGAATGGG + Intronic
1139179419 16:64728394-64728416 CCATGAAGACGGAATGAACTAGG + Intergenic
1139488221 16:67271292-67271314 ACATGGGGCCAGAAGGGCCTGGG + Exonic
1141019484 16:80481811-80481833 CCCTGAAGTCAGAAGGGTCTGGG + Intergenic
1141068693 16:80934104-80934126 GGATGAGGAAAGAAGGGTCTAGG - Intergenic
1141602602 16:85135515-85135537 CCAGAAAGTCAGAAGGGACTTGG + Intergenic
1144068978 17:11650296-11650318 CCATGAGGACTGATGGGCATAGG - Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1144863453 17:18320189-18320211 CAATGAGGACACAGAGGACTGGG - Intronic
1146257379 17:31399299-31399321 CTAGGAGGACAGCAGTGACTTGG - Intronic
1148830389 17:50426884-50426906 CACTGAGGACAGAAGGAAATAGG - Intronic
1150183904 17:63159213-63159235 TCATGATTACAGAAGGGACGGGG + Intronic
1150271737 17:63871262-63871284 CCATCAGGACTGAAGGGACACGG - Intergenic
1150275285 17:63894159-63894181 CCATCAGGACTGCAGGGACACGG - Intergenic
1150277416 17:63908847-63908869 CCATCAGGACTGCAGGGACACGG - Intergenic
1151269652 17:72984298-72984320 CCATGAGACCTGAAGGGGCTTGG + Intronic
1151749030 17:76026625-76026647 GCATGAGGACTGAGGGGACGGGG - Intronic
1152104227 17:78319371-78319393 CAGGGAGGAGAGAAGGGACTAGG - Intergenic
1153000348 18:449746-449768 CCATGAGGGCAGAAGTGACCTGG - Intronic
1153778448 18:8473983-8474005 CAATAAGGACAGAAGGAAGTGGG - Intergenic
1153786058 18:8536645-8536667 CCATAAGAGCAGAGGGGACTTGG - Intergenic
1153789535 18:8565131-8565153 CCATGAGTCCAGTAGGGACAGGG - Intergenic
1155298696 18:24409108-24409130 CCGATAGGACAGAAGGAACTTGG + Intergenic
1155595567 18:27482022-27482044 CAGTGAGGTCAGCAGGGACTGGG + Intergenic
1155886945 18:31219529-31219551 TCTTGAAGACAGAAGGTACTTGG - Intergenic
1156511400 18:37639946-37639968 GGATGAGGAGAGATGGGACTGGG + Intergenic
1157523331 18:48360556-48360578 CCAGGAGGACAGAAGGAGCCAGG + Intronic
1158506328 18:58049255-58049277 GCATTAGCACAGAAGGAACTGGG + Intronic
1159741200 18:72173381-72173403 CCTTGAGAAGAGCAGGGACTTGG - Intergenic
1160560997 18:79755704-79755726 CCATGAAGCCAGAGGGGACTCGG - Exonic
1161618374 19:5285278-5285300 CCATGAGGACATAGGGGATGAGG - Intronic
1162126117 19:8500274-8500296 AAATTAGCACAGAAGGGACTGGG - Intronic
1163825257 19:19519882-19519904 CCAGGCAGACAGAAGGGAGTGGG - Intronic
1164404123 19:27927374-27927396 CCATGATGACAGACAGGGCTAGG - Intergenic
1164852740 19:31498287-31498309 ACATGAGGGCAGAGGGGCCTGGG - Intergenic
1165684018 19:37802411-37802433 CAAAGAGGAAAGAAGGGAATTGG + Intronic
1166825740 19:45607783-45607805 CCCTTAGGGCAGAAGGGACAGGG - Intronic
1167246658 19:48377084-48377106 CCATGAGGAGTGAAAGGGCTTGG - Intergenic
926863618 2:17335682-17335704 CTATGAGGACCCAGGGGACTAGG - Intergenic
926922384 2:17951868-17951890 ATATGAAGAAAGAAGGGACTAGG + Intronic
927313583 2:21656824-21656846 CAATTGTGACAGAAGGGACTCGG + Intergenic
927615401 2:24588688-24588710 ACCTGAGGTCAGAAGGGCCTGGG - Intronic
928098812 2:28422980-28423002 CCAGGAAGACAGAGGGGACAAGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929928908 2:46237087-46237109 TCATGAGGACAGAGGGGACCTGG - Intergenic
930696348 2:54415948-54415970 TCAGGAGGACAGCAGGGATTAGG - Intergenic
930787701 2:55286631-55286653 CCTGGAGGACAGAAGAAACTTGG - Intergenic
932897786 2:75659694-75659716 CCATGAAGTCAGAAGGTAGTGGG - Intronic
934715247 2:96539276-96539298 CCAAGAGGACAGATGGGGCAAGG - Intronic
935266626 2:101400531-101400553 CTCTGAGTACAGAAGGGACAGGG - Intronic
936103135 2:109600970-109600992 CCATGGGGACAGAAGCCCCTGGG - Intronic
936329458 2:111535217-111535239 CCTTGAGGACAGGACTGACTAGG + Intergenic
937241525 2:120465355-120465377 CCATGAGGACAGGATGGAGGAGG - Intergenic
937787657 2:125921238-125921260 GCATGAGGACAGAATGGAGGAGG - Intergenic
938072939 2:128317923-128317945 CCAAGAGGGCAGAAGGGGGTAGG + Intronic
938306002 2:130254249-130254271 CCCTGCGGACAGCAGGGGCTGGG + Intergenic
938448150 2:131393523-131393545 CCCTGCGGACAGCAGGGGCTGGG - Intergenic
939401625 2:141702050-141702072 CCCTGATGATAGAAGGAACTGGG + Intronic
942658976 2:178244160-178244182 CTCTGAGGCAAGAAGGGACTGGG - Intronic
943762396 2:191624015-191624037 AAATGAGGACAGAAGGGACCAGG - Intergenic
947582709 2:231331596-231331618 CCATGAAGACCAAAGGGACAAGG - Intronic
949043100 2:241858454-241858476 CCAGGAGCAAAGAGGGGACTTGG + Intronic
1169298766 20:4423763-4423785 GCATGAGGACAGATGGGATAGGG + Intergenic
1170195090 20:13681316-13681338 CCATCAGGACATTAGGAACTAGG - Intergenic
1171417477 20:24992814-24992836 CCATGAGGCCGGAAGGGGCGGGG - Exonic
1171564741 20:26171129-26171151 CCATGAGAAAAGAAGGGAAGTGG + Intergenic
1172308527 20:33899244-33899266 TCATGAGGACAAAATGAACTCGG + Intergenic
1173199579 20:40944706-40944728 CCATGAAGGCAGAAGCGTCTAGG + Intergenic
1173455689 20:43199526-43199548 CCATGAAGACTGAATGGAGTGGG + Intergenic
1173927199 20:46789651-46789673 CCATAAGGTCAGAAGGGAAGTGG - Intergenic
1174110301 20:48193982-48194004 ACATGAGGCCAGAGGAGACTGGG + Intergenic
1174486581 20:50865276-50865298 GCAGGAGGAAAGAGGGGACTTGG + Intronic
1175081571 20:56424966-56424988 CCAGGAGGAAAGTAGGGACATGG + Intronic
1175185784 20:57178925-57178947 TCATGAGCACAGAAGGGACAAGG + Intronic
1175319791 20:58077383-58077405 ACAGCAGGACAGAAGGCACTTGG - Intergenic
1175946830 20:62562827-62562849 GCATGAAGAGAGAAGGGCCTGGG + Intronic
1176151290 20:63592430-63592452 CCAGCAGCACAGAAGGGCCTAGG + Intronic
1176522348 21:7833893-7833915 GAAGGAGGACAGAAGAGACTGGG - Intergenic
1178656368 21:34463905-34463927 GAAGGAGGACAGAAGAGACTGGG - Intergenic
1178977478 21:37232052-37232074 CCATGAGAAATGAAGGGACGTGG + Intronic
1179436007 21:41362563-41362585 CCATGAGAACGGAAGAGAATCGG - Intronic
1180127904 21:45804634-45804656 TCAGCAGGACAGCAGGGACTGGG - Intronic
1181151158 22:20884430-20884452 TGATGAGGGCAGAAGGGACTAGG - Intronic
1181414745 22:22751156-22751178 CCCTGAGGCCAAAAGGGGCTGGG - Intronic
1183485082 22:38084223-38084245 CCAGGAGGGGAGAAGAGACTGGG + Intergenic
1184695946 22:46139205-46139227 CAAAGTGGGCAGAAGGGACTGGG + Intergenic
1184790295 22:46695887-46695909 CCAGCAGGACAGCAGGGACTGGG + Intronic
1185176013 22:49327340-49327362 CCATGAGGAAGGCATGGACTTGG + Intergenic
949381157 3:3447242-3447264 AAATGAAGACAGAAGGGGCTGGG + Intergenic
951171088 3:19542785-19542807 CCATTGGGACAGATGGGACTTGG - Intergenic
951294680 3:20919391-20919413 CCTTGAGGACAGCAGATACTTGG - Intergenic
951502653 3:23406946-23406968 CCATGAGGAGGGCAGGGGCTGGG + Intronic
951750348 3:26028107-26028129 CTCTGAGGACAGAAGGGACTAGG - Intergenic
952436716 3:33278525-33278547 CCATGAGGCCAGCTGGCACTCGG - Intronic
952857234 3:37782415-37782437 CCATGGGGACAGTAGTCACTGGG - Intronic
953158244 3:40394608-40394630 CCTTGGGAACAGAAGGGACCAGG - Intronic
953192467 3:40700816-40700838 CTAGGAGGACAGAATGGTCTGGG + Intergenic
953824672 3:46240519-46240541 CCATGTGGGCTGAAGGGACTGGG - Intronic
954302008 3:49705172-49705194 CCGTGAGGACAGTAGGTGCTTGG + Exonic
954437645 3:50504357-50504379 CCTCCAGGACAGAAAGGACTGGG - Intergenic
954438024 3:50506178-50506200 CCTCCAGGACAGAAAGGACTAGG - Intergenic
954808332 3:53232912-53232934 GCAGGAGGAGAGGAGGGACTTGG - Intronic
955043152 3:55336097-55336119 CCCTGATGACAGAGGGGTCTTGG + Intergenic
955471797 3:59294341-59294363 GCATATGGGCAGAAGGGACTTGG - Intergenic
956014568 3:64867971-64867993 CCCTGAAGACACATGGGACTTGG + Intergenic
956096680 3:65723548-65723570 CCATGAGCAGGGAAAGGACTTGG - Intronic
957617983 3:82556227-82556249 CCTCGAAAACAGAAGGGACTGGG + Intergenic
959305401 3:104658229-104658251 CCTTAAGGACAGAAGAGAGTAGG - Intergenic
960555728 3:119028260-119028282 TCAGGAGGAGAGAAGGGAATAGG + Intronic
961305935 3:125959161-125959183 CCGTGAGGCCAGGAGGGACCTGG - Intergenic
962374296 3:134847313-134847335 CCAGGAAGACAGCTGGGACTAGG + Intronic
963067459 3:141274761-141274783 CCATGACGGCAGCAGGAACTGGG + Intronic
964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG + Intronic
964748447 3:160033239-160033261 TCATGAGGACAGAAGCTCCTAGG - Intergenic
965597390 3:170422116-170422138 CCATGAGGACAGCAGCCTCTGGG + Intronic
968860095 4:3161068-3161090 CCATGGGGAGTGAGGGGACTGGG - Intronic
968875179 4:3262940-3262962 CCTAGAGGACAGGAGGGAGTGGG + Intronic
968926694 4:3552034-3552056 CTGTGAGAACTGAAGGGACTGGG - Intergenic
969066084 4:4482417-4482439 CCGTCAGAACAGGAGGGACTAGG - Intronic
969167590 4:5330110-5330132 CCCAGAGGGAAGAAGGGACTTGG - Intronic
969307623 4:6334923-6334945 CCATGAGGGGATAAGGGGCTGGG - Intronic
971625820 4:28918605-28918627 ACATCAGGAAAGTAGGGACTGGG + Intergenic
971986410 4:33830435-33830457 CCATGAGAAAAGAAGGGAAGTGG - Intergenic
973207769 4:47579610-47579632 CCCTGAGGAAAGAATGGATTTGG + Intronic
973334220 4:48939569-48939591 CCATGAAGGCGAAAGGGACTCGG + Intergenic
973849249 4:54945179-54945201 GGATGAGGACAGAAGGGAAGAGG + Intergenic
976383966 4:84434025-84434047 CCAGGAGGACACCTGGGACTTGG + Intergenic
984750432 4:183267662-183267684 CCATGCCTCCAGAAGGGACTTGG - Intronic
985691291 5:1314194-1314216 CCAGCAGGACAGAAGCCACTGGG + Intergenic
985733318 5:1563671-1563693 CCCTGAAGGCAGAGGGGACTTGG + Intergenic
986211631 5:5678979-5679001 CCATGGGGACAGACAGGACGAGG + Intergenic
988709289 5:33757385-33757407 TCCTGAGGACAGAATGGAATGGG + Intronic
989135750 5:38152840-38152862 CCAGGATGACAGATAGGACTTGG + Intergenic
989518965 5:42378326-42378348 CCATGAAGATAGAATGGCCTGGG - Intergenic
992174260 5:74134057-74134079 CCTTGAGGAAAGAAGGCACTGGG + Intergenic
992494197 5:77276222-77276244 CCCTGAGGCCAGAAAAGACTTGG - Intronic
995870546 5:116739243-116739265 CCACCAGGACAGAAGGGAAAGGG + Intergenic
996540308 5:124624666-124624688 CCAGGGTGAAAGAAGGGACTGGG - Intergenic
997077015 5:130690857-130690879 ACAACAAGACAGAAGGGACTTGG - Intergenic
997357329 5:133271600-133271622 TACTGAGAACAGAAGGGACTTGG - Intronic
997405710 5:133645005-133645027 CCATTAGGACCAAAGGGACAGGG - Intergenic
997518322 5:134506295-134506317 ACTTGAGGACACCAGGGACTGGG + Intergenic
998545071 5:143020583-143020605 CCACAAGGAAAGAAAGGACTAGG - Intronic
1001026951 5:168232517-168232539 CCATGTGGAGAGCAGGGATTTGG + Intronic
1001239695 5:170058740-170058762 CCATGAGCAGAGGAGGGACGTGG + Intronic
1001427211 5:171630470-171630492 CTTTGGGGACAGACGGGACTGGG + Intergenic
1001590094 5:172859110-172859132 CCAGGAGGAGGGAAGGGGCTGGG - Intronic
1001617508 5:173055214-173055236 TCATCAGGAGAGCAGGGACTGGG - Intergenic
1001658811 5:173375081-173375103 ACATGAGGACAGGAAGGACAGGG - Intergenic
1001927304 5:175647849-175647871 CCATGAGAACTGAAGGGAAATGG - Intergenic
1002603907 5:180370770-180370792 TCATGAGGACAGAAGAGAACAGG + Intergenic
1002693799 5:181070634-181070656 CCAAGAGCACAGAGGGGGCTCGG + Intergenic
1004231902 6:13841373-13841395 CCATGAGAACACTGGGGACTGGG - Intergenic
1004734345 6:18390084-18390106 TCATAAGGTCAGAAGTGACTTGG + Intronic
1005107533 6:22240686-22240708 TCCTGAAGACAGAAGGAACTTGG - Intergenic
1005357106 6:24995332-24995354 CCATCAGGACAGAAGAGAAATGG + Intronic
1005633115 6:27727675-27727697 CCATGAAGACAGTCGTGACTGGG + Intergenic
1007630049 6:43268448-43268470 ACATGGGGGCACAAGGGACTTGG - Intronic
1007805693 6:44444145-44444167 ACATGATGACAGAAGGAACTAGG - Intronic
1009044643 6:58223624-58223646 CCAAGAGGTCATATGGGACTTGG + Intergenic
1009220461 6:60977865-60977887 CCAAGAGGTCATATGGGACTTGG + Intergenic
1009678390 6:66857606-66857628 CCTTGAGGAATGAAGGGATTGGG - Intergenic
1011015179 6:82746505-82746527 GCACGAGGACAGTAGGGAGTGGG - Intergenic
1011739547 6:90346160-90346182 ACTTGAGGAAGGAAGGGACTGGG - Intergenic
1015575740 6:134669109-134669131 TAATGAGGACAGCAGTGACTTGG + Intergenic
1016650594 6:146455527-146455549 AGATGAGGAGAGAAGGGATTGGG + Intergenic
1016658637 6:146549615-146549637 CCAAGAGGACAGCAGGGATAGGG - Exonic
1018180152 6:161216317-161216339 GCTTGAGGACAGAAGAGACTGGG - Intronic
1019849909 7:3544474-3544496 CCAAGAGAGCAGAAGTGACTGGG - Intronic
1021497786 7:21295031-21295053 CACTGAGGACAGAAAGGAGTGGG + Intergenic
1021912662 7:25401756-25401778 TCCTGAGGACAGAAGGAAGTGGG - Intergenic
1023686229 7:42738098-42738120 CCATGAGAACAGAAGAGAAAGGG - Intergenic
1026409778 7:70108049-70108071 CCATGAGGACAGAACTGAACTGG - Intronic
1026640777 7:72123440-72123462 CCATGATGACAGGAAGGACAAGG - Intronic
1027932933 7:84562927-84562949 CCATGGGGCCAGCAGGGACTTGG - Intergenic
1029363709 7:100104179-100104201 AGCTGAGGACAGATGGGACTTGG + Intronic
1029516381 7:101026072-101026094 ACAAGGGGAGAGAAGGGACTGGG - Intronic
1031143824 7:117975591-117975613 CCATGAGGACCAAAGTGGCTGGG + Intergenic
1032542539 7:132715175-132715197 CCAGGAGGGCAGAGGGTACTGGG + Intronic
1033147237 7:138881907-138881929 CCTTGAGAACAGACAGGACTTGG + Intronic
1033245741 7:139714989-139715011 CCATTAGGAGAGGAGGGACCAGG + Intronic
1033357707 7:140613899-140613921 CCATGGGAAAAGAAGGGAATGGG - Intronic
1034127972 7:148691001-148691023 CCATGAGGGCATAAGAGTCTGGG + Intergenic
1035275578 7:157746190-157746212 CCATGAGGACTGTGGGGTCTAGG - Intronic
1035275605 7:157746293-157746315 CCGTGAGGACTGTAGGGTCTAGG - Intronic
1035632457 8:1118697-1118719 CTATGAGGACCGAAAGAACTTGG + Intergenic
1035763048 8:2084009-2084031 CCAAGGGGACAGAAGGAACAAGG - Intronic
1037415107 8:18641247-18641269 CCTGGAGGAGAGCAGGGACTTGG - Intronic
1037516280 8:19635153-19635175 CCATCAGGGCAGAGGGGACCAGG + Intronic
1037743827 8:21627975-21627997 CCATGGGAACAGCAGGGACATGG + Intergenic
1038844615 8:31217088-31217110 CCATGAGGGAAGAAGAGATTGGG + Intergenic
1039630721 8:39108316-39108338 CCTGGGCGACAGAAGGGACTCGG - Intronic
1040592401 8:48805588-48805610 CCATGAGGACACACTGGAGTGGG + Intergenic
1041103480 8:54419207-54419229 CCATCTGGACATGAGGGACTTGG + Intergenic
1041346709 8:56906492-56906514 ACAGGAGGACAAGAGGGACTCGG - Intergenic
1041897326 8:62939989-62940011 TCTTGAAGACAGAAGAGACTTGG - Intronic
1042065689 8:64873087-64873109 CAATGAGGACAAAAGGAACTTGG - Intergenic
1043858201 8:85286082-85286104 GCATGATGACAGGAGGGACAAGG - Intergenic
1044875034 8:96656939-96656961 CCATGAGGTCAGATGGGAGTGGG + Intronic
1044885094 8:96768325-96768347 CCATTGGGACAGAAAGGAATTGG + Intronic
1047958885 8:129996481-129996503 CCAGGAGGACAGAGGGGCCGTGG + Intronic
1048180388 8:132189138-132189160 CCATCAAGACAGAAGGCACATGG - Intronic
1048190314 8:132282411-132282433 CAAGGGGGACAGATGGGACTGGG - Intronic
1048282290 8:133114347-133114369 CCCTGGGGACAGCAGGGCCTGGG - Intronic
1048750050 8:137662724-137662746 CCCTGTGGATGGAAGGGACTTGG - Intergenic
1049290891 8:141801227-141801249 TCATCAGGACAGGAGGGGCTGGG - Intergenic
1053673738 9:40399113-40399135 AAATGAGGACAGAAGACACTGGG + Intergenic
1053923540 9:43025473-43025495 AAATGAGGACAGAAGACACTGGG + Intergenic
1054384843 9:64539178-64539200 AAATGAGGACAGAAGACACTGGG + Intergenic
1054510889 9:65977177-65977199 AAATGAGGACAGAAGACACTGGG - Intergenic
1056159604 9:83875373-83875395 CCATGAAGAGAGCAGGGAGTGGG + Intronic
1057797562 9:98169553-98169575 TCCTGAGGACAGAGGGGACCCGG - Intronic
1058750289 9:108032767-108032789 CACTCAGGTCAGAAGGGACTTGG - Intergenic
1059994658 9:119897058-119897080 CCTTATGGACAGAAGGGACTGGG - Intergenic
1060886218 9:127154273-127154295 CCCTGTGGACACAAGGCACTTGG - Intronic
1060895339 9:127213363-127213385 CCATGAGGCTGGAAGGGTCTTGG + Intronic
1060962614 9:127691686-127691708 GCCTGGGGACAGAAGGGCCTGGG - Exonic
1061130535 9:128705564-128705586 CCCTCAGGACAGAAGGCTCTAGG + Intronic
1062262924 9:135671798-135671820 CCATGAGGAGAGGAGGGGATGGG + Intergenic
1185847086 X:3447736-3447758 CCAAGATGGCAGAAGGGACACGG + Intergenic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1187676693 X:21723373-21723395 CCTTGAGGACAGTGGGGACAGGG - Intronic
1188014829 X:25097037-25097059 CCCTGGGAGCAGAAGGGACTTGG - Intergenic
1188528125 X:31107902-31107924 CCATGGGGACAGCAGCGACATGG + Intronic
1189543373 X:42016185-42016207 CCACTAGAAGAGAAGGGACTGGG + Intergenic
1191779496 X:64850369-64850391 CCATGAGGACCAGAGGGACCAGG - Intergenic
1193420216 X:81273948-81273970 ACATGTGGACAGAAATGACTTGG + Intronic
1194912010 X:99657094-99657116 CCATTAGGACAGGAAAGACTAGG - Intergenic
1197054462 X:122099609-122099631 CCTTGAAGACAGAAGATACTTGG + Intergenic
1199483400 X:148323362-148323384 ACATGAGGGCAGAGGGGCCTGGG + Intergenic