ID: 964570251

View in Genome Browser
Species Human (GRCh38)
Location 3:158102900-158102922
Sequence GATGCACGTGTGGCCCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 3, 2: 1, 3: 1, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964570251_964570255 12 Left 964570251 3:158102900-158102922 CCCAGCGGGGCCACACGTGCATC 0: 1
1: 3
2: 1
3: 1
4: 70
Right 964570255 3:158102935-158102957 CACACACACGCACACACACACGG 0: 23
1: 1873
2: 2169
3: 2992
4: 5249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964570251 Original CRISPR GATGCACGTGTGGCCCCGCT GGG (reversed) Intronic
903848049 1:26290146-26290168 GATGCCCGTGTGCCCAGGCTTGG - Intronic
919279863 1:195475713-195475735 TATGCAGGTGTGGCACCCCTAGG - Intergenic
1067432039 10:46251329-46251351 GATGCAGGTGTGGCTCCATTTGG - Intergenic
1068314152 10:55320011-55320033 AATGCAGGTGTGGCCAGGCTGGG - Intronic
1075189120 10:120290064-120290086 GAGGCACCTGTGGCCTTGCTGGG - Intergenic
1079401683 11:20111107-20111129 GATGCACTTGTGGAACTGCTTGG + Intronic
1084756898 11:71245647-71245669 GAAGGTCGTGTGGCCCAGCTGGG - Intronic
1094430620 12:30365932-30365954 GATGCACGTGTTTTCCAGCTTGG + Intergenic
1096491589 12:52015643-52015665 GATGCCCCTGGGGGCCCGCTGGG - Exonic
1096685415 12:53285344-53285366 GATTCAGGTGTGGGCCTGCTGGG + Intronic
1106013728 13:25848464-25848486 GAAACACGTGTGGCCTCACTGGG + Intronic
1112881064 13:104107201-104107223 GTGGCACGTGTGGGCCCTCTAGG - Intergenic
1118750938 14:68807533-68807555 GCTGCACTTGGGGCCCAGCTAGG + Intergenic
1119029575 14:71181377-71181399 GATGCACGTGTGACCATGCGGGG - Intergenic
1122517634 14:102319853-102319875 GTCGCACGTGTGGCCCCGCTGGG + Exonic
1123029771 14:105446200-105446222 GGTGCAGGTGGGGCCCAGCTCGG - Intronic
1202836372 14_GL000009v2_random:80174-80196 TATGCAGGTGTGGCCAGGCTGGG - Intergenic
1128451148 15:67806638-67806660 GATGAACGGGTGGCCCTGCGGGG - Exonic
1129053687 15:72804723-72804745 AATGGACGTGTGGCCCTACTGGG + Intergenic
1132856247 16:2046165-2046187 GATGCACCTGTGGACCATCTGGG - Exonic
1132971578 16:2691826-2691848 GATGCACGTGGGGTCCCCCGCGG + Intronic
1136396767 16:29996683-29996705 CATGCACTTGTGGCCCTACTCGG - Intronic
1142203077 16:88770325-88770347 GATGCAGGCGGGGCCCGGCTGGG - Intronic
1144823797 17:18093932-18093954 GATGCCCGTGTGGCGCTGATTGG + Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1153643984 18:7178616-7178638 GCTCCACCTGTGGCCCCGGTGGG - Intergenic
1158835728 18:61329921-61329943 GTTGCAGGTGTGGGCCCTCTTGG - Intergenic
1162572728 19:11482281-11482303 GATCCCCGGGTGGCCCCTCTTGG + Intronic
1164845792 19:31431667-31431689 CATGCACGTGTGGTCCTACTTGG - Intergenic
1165263128 19:34637474-34637496 TTTGCACTTGTGGCCTCGCTGGG - Intronic
1166070451 19:40384191-40384213 GATGCCGGGGTGGCCCAGCTCGG - Intronic
1167507814 19:49880427-49880449 GAAGCACGTGTGGGCCAGGTAGG + Intronic
1167577109 19:50323092-50323114 GGTGCGTGTGGGGCCCCGCTGGG + Exonic
1202636268 1_KI270706v1_random:47191-47213 TATGCAGGTGTGGCCAGGCTGGG + Intergenic
929546004 2:42855570-42855592 AATGCCTGTGTGGCCCAGCTGGG + Intergenic
937470770 2:122172226-122172248 GATGTACTTGTGGCTCTGCTGGG - Intergenic
946309205 2:218873385-218873407 GGTGCGCGTGTGGCTCCGCACGG - Exonic
948468589 2:238163773-238163795 CCTGTACGTGTGGCCCCGCCGGG + Exonic
1169557815 20:6768427-6768449 GAGGGACGCGTGGCCCCGCGCGG - Exonic
1179211673 21:39330136-39330158 GATGCACCTGTGGCCGGGCGTGG - Intergenic
1181575681 22:23793012-23793034 GCAGCACGTGTGGACCGGCTCGG + Intronic
1181636157 22:24175832-24175854 GACTCAGGTGTGGCCCCACTGGG + Intronic
1182211357 22:28679862-28679884 GGTGCATGTGTGGGCCCGCGGGG - Exonic
1183232204 22:36590078-36590100 GATGCAGCTGGGGCCCTGCTGGG - Intronic
1184431525 22:44443894-44443916 CATGCATGTGTGGCCCCTCTCGG + Intergenic
964570251 3:158102900-158102922 GATGCACGTGTGGCCCCGCTGGG - Intronic
968360398 3:198142955-198142977 GATGCACGTCTTGCCTGGCTAGG - Intergenic
968516473 4:1017708-1017730 GCTGCACGTGTGTCCCTGCCTGG + Intronic
985709771 5:1421777-1421799 GGTGCACGTGTGGCCTCAGTTGG - Intronic
985908847 5:2863665-2863687 AATGCATGTGTGGCCCTTCTGGG + Intergenic
1001018435 5:168162559-168162581 GAGGGACGTGAGGCCGCGCTGGG - Intronic
1002808745 6:604715-604737 GAGGCAGGTGTGTCCCCGCAGGG - Intronic
1002808762 6:604793-604815 GAGGCAGGTGTGTCCCCGCGGGG - Intronic
1014613557 6:123574498-123574520 GATTCACTTGTAGCCCCACTTGG - Intronic
1016858728 6:148697141-148697163 GCTCCACCTGTGGCCCCGGTGGG - Intergenic
1019154431 6:170029691-170029713 GTTGCAGGTGTGGACCAGCTTGG - Intergenic
1019154439 6:170029730-170029752 GGTGCAGGTGTGGACCAGCTTGG - Intergenic
1019154447 6:170029769-170029791 GGTGCAAGTGTGGACCAGCTTGG - Intergenic
1019154483 6:170029941-170029963 GGTGCAGGTGTGGACCAGCTTGG - Intergenic
1019154492 6:170029988-170030010 GGTGCAGGTGTGGACCAGCTTGG - Intergenic
1019259603 7:73678-73700 GATGCACGTCTTGCCTGGCTAGG + Intergenic
1024233182 7:47378226-47378248 GATTCATGTGTGGACCCTCTGGG + Intronic
1024525196 7:50342745-50342767 CATGCCAGGGTGGCCCCGCTTGG - Intronic
1049309394 8:141925348-141925370 GATGCTTCTGTGGCCCCGCCTGG + Intergenic
1057527068 9:95812188-95812210 GATGGATGTGTGGCCCTTCTGGG + Intergenic
1057842652 9:98498900-98498922 CATGCACATGTGGCCCTCCTGGG + Intronic
1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG + Intronic
1062440018 9:136565574-136565596 GATGCAGGGGAGGCCCGGCTGGG + Intergenic
1062745097 9:138206785-138206807 GATGCACGTCTTGCCTGGCTAGG - Intergenic
1185528353 X:796953-796975 GGTGCACCTCTGTCCCCGCTAGG - Intergenic
1185892780 X:3835538-3835560 GTTGCACGTGTGGCCCCGCTGGG - Intronic
1185897888 X:3873958-3873980 GTTGCACGTGTGGCCCCGCTGGG - Intergenic
1185903007 X:3912389-3912411 GTTGCACGTGTGGCCCCGCTGGG - Intergenic
1190065764 X:47240836-47240858 GAAGCACGTGTTGCCCAGATTGG - Exonic
1195328232 X:103775362-103775384 GATGCCCCTGTGGGCCCACTGGG - Intronic
1200393351 X:155967017-155967039 GGTGGACGTGTGCCCCCTCTTGG - Intergenic