ID: 964573321

View in Genome Browser
Species Human (GRCh38)
Location 3:158136431-158136453
Sequence TGCAAACTAGAGCTCTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964573321 Original CRISPR TGCAAACTAGAGCTCTGTAG GGG (reversed) Intronic
900796867 1:4713188-4713210 TGCCAACTTGACCTCGGTAGAGG + Intronic
902183553 1:14708224-14708246 TGCAAACTTGGGCTCTCCAGGGG - Intronic
903396890 1:23008354-23008376 TGAAAGCTAGATCTCTGGAGAGG - Intergenic
915938571 1:160103737-160103759 TGGAAGCTGGAGCTGTGTAGTGG - Intergenic
917031627 1:170699425-170699447 TGCAAACTAGAGCTCATGAATGG - Intronic
920744478 1:208613595-208613617 TGCAACCCAGAGCTCTCTTGAGG + Intergenic
921007384 1:211107951-211107973 TTAATACTAGAGCTTTGTAGAGG + Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
924055471 1:240119995-240120017 GGCAAACTGAAGTTCTGTAGGGG + Intronic
1062763146 10:42939-42961 TATAAATTAGAGCCCTGTAGGGG - Intergenic
1066071207 10:31815351-31815373 TGCCAGATAGAGCACTGTAGAGG - Intronic
1067236916 10:44458892-44458914 CCAAAACTAGAGCTCTGCAGTGG - Intergenic
1069970545 10:72164310-72164332 AGCAAACTAGAGGTCACTAGGGG - Intronic
1072328070 10:94318066-94318088 TTGATGCTAGAGCTCTGTAGAGG - Intronic
1078119110 11:8488311-8488333 GGAAAATTAGATCTCTGTAGGGG + Intronic
1080679763 11:34463476-34463498 AGCAAAGTAGAGTTCTGTAATGG + Intronic
1093846768 12:23981269-23981291 TGTAAACTAGGGCTGTGGAGAGG - Intergenic
1096199928 12:49674167-49674189 TCCAAACCCGAGCTCTGGAGAGG - Intronic
1102074135 12:110046530-110046552 TGCACAGTAGGGCTATGTAGTGG - Intronic
1106072644 13:26427040-26427062 TGCAAGCTGCAGCTCTGGAGAGG - Intergenic
1107617726 13:42188469-42188491 TGCAAACCAAAGCTTTGAAGGGG + Intronic
1110115557 13:71811500-71811522 AGCAAACTAGTGGTTTGTAGAGG - Intronic
1112546993 13:100381054-100381076 TTTAAAGTAGAGCTATGTAGTGG - Intronic
1114782577 14:25554852-25554874 TGCAAACTAGAACATTGTATGGG - Intergenic
1119452754 14:74725978-74726000 TGCAACCTTGAACTCCGTAGAGG - Intronic
1125376703 15:39037902-39037924 GGGAAACTAGACCTTTGTAGGGG + Intergenic
1134061312 16:11201300-11201322 TGGAAATTAGAGATCTGCAGGGG + Intergenic
1134375674 16:13670648-13670670 TGCCTACTAAAGCTATGTAGTGG - Intergenic
1137793224 16:51192915-51192937 TGCACACTTGAGCTGTGTATGGG + Intergenic
1138054445 16:53817304-53817326 TGCAAACTAGAGCTCCAGAAGGG - Intronic
1140726763 16:77820456-77820478 CTCAAGCTCGAGCTCTGTAGGGG + Intronic
1151075842 17:71271554-71271576 TGCAAAACAGAGATATGTAGAGG + Intergenic
1152956055 18:43270-43292 TATAAATTAGAGCCCTGTAGGGG - Intergenic
1163841813 19:19615996-19616018 TACCCACTAGAGCCCTGTAGTGG - Intronic
1165477132 19:36037446-36037468 TGCAAACTCCAGCTCTATAGGGG + Intronic
1167068053 19:47201944-47201966 TGTATTTTAGAGCTCTGTAGTGG + Intronic
926526696 2:13990680-13990702 TACAAAATAGAACTCTGGAGTGG + Intergenic
936468843 2:112779380-112779402 TGCAACCCAGAACTCTGAAGAGG + Intronic
943262119 2:185679375-185679397 TGGAAACAAGACCTCTGAAGTGG - Intergenic
1169069144 20:2711523-2711545 TGCCAATTCGATCTCTGTAGGGG + Intronic
1169771893 20:9210212-9210234 TGCAAAACAGGGCTCTTTAGAGG - Intronic
1172211075 20:33198979-33199001 TGCAAACAAGTGCTGTGAAGGGG - Intergenic
1173602581 20:44306653-44306675 TTCAAACTACAGCTCTGGGGAGG + Exonic
1178252942 21:31021775-31021797 TGCAAAATAGTGCTCTTCAGTGG - Intergenic
1182152987 22:28043530-28043552 TGCAAACTGGAGGTCTGCAGCGG + Intronic
1182591970 22:31388277-31388299 TGCAGAGGAGAGCTCTGTAGAGG + Intergenic
1184004274 22:41697184-41697206 TACAAGCCAGAGCTCTGGAGAGG + Exonic
1185209560 22:49562501-49562523 AGGAAACTGGAGATCTGTAGGGG - Intronic
955387226 3:58489349-58489371 TGCAACCCTGAGCTCTGTGGAGG + Intergenic
955424763 3:58776791-58776813 TGCAAACAGGAACTATGTAGAGG + Intronic
956365994 3:68503498-68503520 AGCAAACTAGAGGTCAATAGGGG + Intronic
957529234 3:81419369-81419391 TGCCATCTAGAGGTCTATAGGGG - Intergenic
959124125 3:102269414-102269436 TGGAAACTGGAGCTTTGTAGGGG + Intronic
959540427 3:107531300-107531322 TGGAACCTAGAGCTCTTTGGTGG - Intronic
961492126 3:127263520-127263542 TGCAACCTAGAGGTCTGGACAGG - Intergenic
963819694 3:149875821-149875843 TGAAAAATACAGCTCTTTAGAGG + Intronic
964573321 3:158136431-158136453 TGCAAACTAGAGCTCTGTAGGGG - Intronic
969513102 4:7630960-7630982 TGGAAACCAGAGTTCTGCAGAGG + Intronic
969581640 4:8068797-8068819 AGGAAACTAGAGCTCTGAACTGG - Intronic
972015335 4:34236217-34236239 TGAAAACTAGAGCTCAGTTGGGG - Intergenic
974156923 4:58085626-58085648 TGCAACATAGACATCTGTAGAGG + Intergenic
976123863 4:81812228-81812250 TGTAAATTAGATCTCTGTAATGG - Intronic
976425335 4:84896583-84896605 GGGAAACTGGAGCCCTGTAGTGG - Intronic
977933033 4:102769011-102769033 TGCAAACTATATCTCTGAAAAGG + Intergenic
979222081 4:118238939-118238961 TGCAAAGCAGAGCTGTGTAAAGG + Intronic
984113659 4:175650624-175650646 TGCGAACTAGTGTACTGTAGTGG + Intronic
984577378 4:181466660-181466682 TGTAAACTAGATAACTGTAGAGG - Intergenic
985920646 5:2969904-2969926 TACAAACTCTGGCTCTGTAGGGG - Intergenic
987793867 5:22603972-22603994 TGCAAACATGAGGTCTGTAGTGG + Intronic
991031277 5:62084919-62084941 TTCCAAATGGAGCTCTGTAGTGG - Intergenic
992264763 5:75007666-75007688 TGCAGACTACAGCTCCGTGGGGG + Intergenic
993221470 5:85102892-85102914 TGCAAACTAAATTTCTGTATGGG + Intergenic
995174254 5:109156447-109156469 AGCAAACTAGAGCTATCTGGAGG + Intronic
998754523 5:145361593-145361615 TGCACACCACAGCTCTGCAGAGG + Intergenic
1001781963 5:174376434-174376456 TGCAAATTAGAGGCCTGGAGAGG + Intergenic
1004137272 6:12979456-12979478 TGCAAAACAGAGCTCAGGAGGGG - Intronic
1010016222 6:71107460-71107482 TGCAAATTACAGCTTTGTATGGG - Intergenic
1012333018 6:98017409-98017431 GGGGATCTAGAGCTCTGTAGCGG - Intergenic
1012935588 6:105364128-105364150 GGCAAACTTGAGCTGGGTAGAGG + Intronic
1017116373 6:150980888-150980910 TGTACACTAGAGATCTGTAGCGG + Intronic
1018477951 6:164161420-164161442 TGAAAAATAGAACTCGGTAGAGG - Intergenic
1022354434 7:29599265-29599287 TGAACACCAGAGCTCTGCAGAGG - Intergenic
1024445105 7:49468494-49468516 TGCAAACTAGAGGGCTGGGGAGG - Intergenic
1024602874 7:51000290-51000312 TGAAAACCAGAGCTCTGTAGAGG - Intergenic
1029309396 7:99648029-99648051 TGCTAACTAGAGGTGGGTAGAGG + Intergenic
1034737606 7:153443620-153443642 AGCTAAGAAGAGCTCTGTAGTGG - Intergenic
1037656120 8:20885687-20885709 TGCTAAATAGAACTCTGAAGGGG + Intergenic
1037670926 8:21014796-21014818 TGCAAACAAGTGGTCTGTGGTGG - Intergenic
1037761205 8:21742976-21742998 TGTAAACTAGAGCTCTGATTTGG + Intronic
1038621438 8:29146984-29147006 TGCAAATTTGATCTCTGTATGGG - Intronic
1039830952 8:41213906-41213928 TGCAAACTAAAGCCATGAAGAGG + Intergenic
1039918515 8:41876620-41876642 TGGAAACCAGAGCCCTTTAGAGG - Intronic
1041391116 8:57348487-57348509 TGTAAATTACAGCTGTGTAGTGG - Intergenic
1042794651 8:72648056-72648078 TGCAAACGAGAGCTCAAAAGGGG + Intronic
1044308929 8:90670354-90670376 AGCTTACTAGAGCTTTGTAGTGG - Intronic
1045693782 8:104785664-104785686 TGCCAACAAGAGCTCTGTCCTGG + Intronic
1048691733 8:136972896-136972918 TGGAAACTAGAGGACTGAAGTGG - Intergenic
1049961318 9:741032-741054 TGCAAACAAGTGCACTGTGGTGG - Intronic
1051205067 9:14679163-14679185 TGCTAACTAGATCTCTGTATTGG - Intronic
1051291487 9:15550158-15550180 TCAAAACTAGAGCTCAGGAGAGG + Intergenic
1051748986 9:20322072-20322094 TGCAAACAAGTGCTCTGTCAAGG + Intergenic
1056509133 9:87286008-87286030 TGGAAAGCAGTGCTCTGTAGTGG - Intergenic
1058869709 9:109191323-109191345 TGCAAACTTCAGCTGTGAAGTGG + Intronic
1185578342 X:1191467-1191489 CCCAAACAAGAGCTTTGTAGGGG - Intronic
1186108971 X:6235971-6235993 TTCAAACTCGAGGTCTGTATTGG + Intergenic
1192707007 X:73537258-73537280 TGAAAACTGGAGATTTGTAGTGG - Intergenic
1194131904 X:90091828-90091850 TGTAACCTAGTACTCTGTAGGGG - Intergenic
1195953236 X:110300811-110300833 TGGAAACTATAGCTATGTGGTGG - Intronic