ID: 964575699

View in Genome Browser
Species Human (GRCh38)
Location 3:158165214-158165236
Sequence GCTTTTCCTGCAATTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964575696_964575699 23 Left 964575696 3:158165168-158165190 CCATAACTATTTATAAGATAATT 0: 1
1: 0
2: 0
3: 59
4: 644
Right 964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG 0: 1
1: 0
2: 2
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964575699 Original CRISPR GCTTTTCCTGCAATTAATGG AGG Intronic
901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG + Exonic
903384601 1:22918178-22918200 GCTTCTCCTGGAATAAATGAGGG - Intergenic
903742198 1:25564833-25564855 GCTTTTCCTTCAATAAGAGGAGG - Intronic
903785890 1:25861168-25861190 GTTTTTCCTTCAATTAAGGAGGG - Intergenic
908442890 1:64172539-64172561 TCTTGTCCTTCAACTAATGGAGG + Intronic
910991968 1:93065940-93065962 GCTTTTGCTCCAGTGAATGGTGG + Intergenic
911243228 1:95488178-95488200 GCTTTTGCTGCAATTGATCTTGG - Intergenic
912256960 1:108069998-108070020 TATGTTCCTGCAATTATTGGGGG - Intergenic
915789578 1:158653450-158653472 GCTTTTCCAAGAATTAATGACGG - Intronic
917171465 1:172180614-172180636 GCTATTCCTGCAATAAAAGAAGG - Intronic
920203489 1:204275215-204275237 GTTTTTTCAGCAAATAATGGGGG - Intronic
921803121 1:219424643-219424665 GCCTCTGCTGCAATGAATGGAGG - Intergenic
924378295 1:243436766-243436788 GCTTTTTCTACAATTAACTGTGG + Intronic
1065459112 10:25937146-25937168 GCTTCTCCTGAAAAAAATGGAGG + Intronic
1066136407 10:32451079-32451101 GCATTTCCTGCAAGTAAGGAGGG - Intronic
1067931888 10:50570194-50570216 GCTTTTTCTGCAAGTAAGGAAGG - Intronic
1070572670 10:77651793-77651815 GCCTTTGCTACAATTAATGAAGG + Intergenic
1074620575 10:115115894-115115916 GGTTTTCCTGCATTTATTAGTGG + Intronic
1076697994 10:132256322-132256344 GCTTTCACTGCAATTAAGGTGGG - Intronic
1077770428 11:5212395-5212417 GCTTTTGCTGCAATGACTGTTGG + Intergenic
1078396025 11:10982923-10982945 GCTCTTCCTGCATTAAAAGGTGG + Intergenic
1078684867 11:13519770-13519792 GCTTTTGCTGCAATTACTTTTGG - Intergenic
1079546396 11:21637890-21637912 GCTGATCCTGAAATTAATAGGGG + Intergenic
1091137074 11:133201480-133201502 GCTTTTCCTGAGATAAATTGGGG + Intronic
1092637175 12:10464591-10464613 GCTTTTCCTGCAATTGTTTTTGG + Intergenic
1093689695 12:22096591-22096613 GCTTTTGTTGCAATTAATTCTGG + Intronic
1096928821 12:55181264-55181286 GCTTTTGTTGCAATTACTGCTGG + Intergenic
1099579047 12:84418508-84418530 GCTTTTGTTGCAATTAGTTGTGG + Intergenic
1099686499 12:85896424-85896446 GCTTTTCTTGCAATTACTTTTGG + Intergenic
1100733664 12:97502095-97502117 ACTTTTTCTGCAATCAGTGGAGG + Intergenic
1101492755 12:105224447-105224469 GCCTCTGCTGCCATTAATGGTGG + Intronic
1102018411 12:109663862-109663884 GCTTTTCCTGCACCAAATGATGG + Intergenic
1104369114 12:128207091-128207113 GCTTTTCCTGCAAGTAGAGTGGG + Intergenic
1104666156 12:130649078-130649100 GCTTTTCCTGCCCTTCGTGGCGG + Intronic
1107216671 13:37929393-37929415 GTTTGTCCTGTAATTAATGAAGG - Intergenic
1108466723 13:50724141-50724163 GCTTTTTCTTCAATTAGTGATGG - Intronic
1110242251 13:73282339-73282361 GCTTCTCCTGCAACTCAGGGTGG - Intergenic
1114339617 14:21729506-21729528 GCCTCTCCTGGAATTCATGGTGG - Intergenic
1116970460 14:51059333-51059355 GCATTTCCTGTTATTAATGAAGG - Intronic
1117182769 14:53209197-53209219 GATTTTCCTAGAATCAATGGTGG + Intergenic
1119944181 14:78674322-78674344 GATTATTCTGCAAATAATGGGGG + Intronic
1122061229 14:99137962-99137984 GCTTTTCCTGCAGGTAGTGAAGG + Intergenic
1122679889 14:103451364-103451386 GATTATACTGCAATTAATTGAGG - Intronic
1125583438 15:40803757-40803779 GCTGCTCCTGCCTTTAATGGGGG - Intronic
1127615856 15:60684796-60684818 GCTTTTCTAGGAATTAAAGGAGG - Intronic
1138277064 16:55742857-55742879 CCTGTTCCTGGACTTAATGGGGG + Intergenic
1138282959 16:55786034-55786056 CCTGTTCCTGGACTTAATGGGGG + Intergenic
1138871625 16:60894849-60894871 GATTTTTCTTCATTTAATGGGGG - Intergenic
1140193954 16:72841381-72841403 GCTTTTTCCCCCATTAATGGAGG - Intronic
1149070714 17:52539085-52539107 CTTTTGTCTGCAATTAATGGTGG - Intergenic
1150478262 17:65490085-65490107 GCTTTGCCAGGAATGAATGGTGG + Intergenic
1155051947 18:22156269-22156291 GATTTTTTTGCAATTAAGGGGGG - Intergenic
1158792870 18:60803344-60803366 GCTTTTGCTGCAATTGATTTTGG - Intergenic
1159545484 18:69835507-69835529 GCTCTTACTGCAATGAATTGGGG - Intronic
1165919495 19:39286035-39286057 TCTTTTACTGCAGTTAAAGGTGG - Intergenic
1166403092 19:42498519-42498541 GCTTATTCTGCAATTAGTGAAGG - Intergenic
1166856179 19:45783587-45783609 GCTTTTCCTGCTATGAAAAGGGG + Exonic
1167766906 19:51489464-51489486 GCATTTCCTAGAATAAATGGTGG + Intronic
927618665 2:24627897-24627919 GCTCTTCCTCCAAGTAATAGAGG + Intronic
928417866 2:31111585-31111607 GCTTTTTTTGCAATTTGTGGTGG - Intronic
930502876 2:52244704-52244726 GATTTACCAGCAAGTAATGGAGG + Intergenic
937302064 2:120848635-120848657 GCCTTTCCTGCTAAAAATGGTGG + Intronic
937415476 2:121711053-121711075 GATTTTCATGGAATGAATGGGGG + Intergenic
937969787 2:127540612-127540634 GCTTTTTCTGGAATGAAGGGGGG + Intronic
938146289 2:128837060-128837082 GACTTTACTGCAAGTAATGGAGG - Intergenic
940804450 2:158170451-158170473 GCTTTTGCTGCAATTGCTTGTGG - Intergenic
940913064 2:159225737-159225759 ACTTTTACAGAAATTAATGGAGG + Exonic
941018006 2:160378917-160378939 GGTTTTCCTTCAGTTAATGTGGG + Intronic
942182678 2:173395430-173395452 GCCATCCCTGCAATTAATGAGGG - Intergenic
942419056 2:175789044-175789066 GCTTTTCCTTCAATTATTTCAGG - Intergenic
946900689 2:224368701-224368723 GCTCTTACAGCAAATAATGGAGG - Intergenic
947896120 2:233674404-233674426 CCTGTTACTACAATTAATGGAGG - Intronic
1170199520 20:13727671-13727693 GCATTTCCTCCACATAATGGAGG + Intronic
1170493108 20:16898429-16898451 GAATTTCCTGCACTTTATGGGGG + Intergenic
1179299184 21:40091064-40091086 GCCTTTCTTACAACTAATGGCGG - Intronic
1179308270 21:40174612-40174634 GCTGATCCTTCAATGAATGGAGG + Intronic
1182748442 22:32623519-32623541 GCACTTCCAGCAATCAATGGCGG + Intronic
1183534938 22:38395295-38395317 ACTTTTCCTGCCAAAAATGGAGG + Intronic
950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG + Intergenic
952509550 3:34039338-34039360 CCTTTCCCTGCTAATAATGGGGG + Intergenic
955708317 3:61752084-61752106 ACTTTTGCTGCAATTAATGTTGG + Intronic
956008494 3:64805552-64805574 TCTTTTCCTGCAAGGAGTGGAGG - Intergenic
956638910 3:71395852-71395874 AAATTTCCTGTAATTAATGGGGG + Intronic
957836874 3:85605688-85605710 GCTTTTCTTACAATTACAGGTGG - Intronic
958623323 3:96591831-96591853 ACTTTTATTGCAATTAATGGTGG - Intergenic
959326824 3:104947346-104947368 GCTTTTCTTGCAATTACTTTTGG + Intergenic
959421818 3:106137595-106137617 GCTTTTGCTGCAATTGATTTTGG - Intergenic
959898172 3:111628634-111628656 GTATTTCCTGAAATTAATGTTGG - Intronic
962707150 3:138055031-138055053 GCTATTCCTGCAAAAAATGTTGG - Intergenic
964355983 3:155852398-155852420 GTTTGTCCTGTAAGTAATGGAGG - Intronic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
964766813 3:160187364-160187386 GCCTTTCTTGCAATTAACAGTGG - Intergenic
965398456 3:168189173-168189195 TCTTTTCCTGGCATGAATGGTGG + Intergenic
966541824 3:181100653-181100675 CCATATCCTGCAATTAATGGTGG - Intergenic
970437378 4:16048688-16048710 GCTTTTACTAGAATTAATGGTGG + Intronic
972302224 4:37795452-37795474 GCTTTTCCTTCAATTCATGGTGG - Intergenic
974379982 4:61127096-61127118 GCTTTTCCAGCAAATGATGCTGG - Intergenic
975022931 4:69513111-69513133 GCTTTTGCTGCAATTGATTTGGG + Intronic
980185103 4:129451174-129451196 GCTTTTGCTGCAATTGATTTTGG - Intergenic
982942466 4:161575370-161575392 GCTTTTCTTGCAATTACTTTTGG + Intronic
983081601 4:163392037-163392059 TCATTTCCTGCATTTAATTGAGG + Intergenic
983731199 4:170995806-170995828 GGTTTCCCTAGAATTAATGGAGG + Intergenic
983878267 4:172902540-172902562 GCTTTTCCTGGAATTATAGATGG - Intronic
984998190 4:185457161-185457183 GCTTTTTCTACATTTATTGGAGG - Intronic
987799068 5:22669514-22669536 GCTTTTCTTGCAACTAAAGGTGG + Intronic
987811207 5:22838576-22838598 CCTTTGCCTGCCTTTAATGGAGG - Intronic
988167297 5:27610244-27610266 GCCTTGCCTGCCATTAATCGTGG - Intergenic
992345728 5:75875544-75875566 GCTTTTCTTGCAATTACTTTTGG - Intergenic
992414698 5:76540920-76540942 GCTTTTTCTGCAATCAATACAGG - Intronic
992746318 5:79824675-79824697 ACTTTTCCTTCAATTACTGCTGG - Intergenic
993620965 5:90167332-90167354 ACTTTTCCTGGCATTAATAGAGG + Intergenic
997151731 5:131503608-131503630 GCTTCATCTGCAATTAATAGTGG + Intronic
997326991 5:133029865-133029887 GCTTTTCCTTCGATTATTTGGGG + Intergenic
997373565 5:133380978-133381000 GCTTTTTCTGCAACTACTGAGGG - Intronic
999420796 5:151440704-151440726 GCTTTTCCAGCAATCCAGGGAGG + Intronic
999569098 5:152898712-152898734 GCATTTCCGGCGATTCATGGAGG - Intergenic
1003051264 6:2783026-2783048 GCTTTTCCTCCAGTAGATGGTGG + Intronic
1003380842 6:5623382-5623404 GTTATTCCTGCAATTTAAGGAGG + Intronic
1005437701 6:25832643-25832665 GCTCTTCCTGCAATTACTGTAGG + Intergenic
1007288640 6:40767262-40767284 GCTTTTGCTGCAATTAATTTTGG + Intergenic
1007636207 6:43301339-43301361 GCTTTTCCTGCCATATATGGTGG - Intronic
1009648352 6:66439569-66439591 ACTATTCCTGCAATTAGTGTTGG + Intergenic
1009783137 6:68295989-68296011 GCTTTTGCTGCAATTGATTTTGG - Intergenic
1011723439 6:90183575-90183597 GCTTTTCCTGCTTTCACTGGTGG - Intronic
1011972106 6:93238425-93238447 GCTTTATTTGCCATTAATGGAGG + Intergenic
1016171821 6:141026959-141026981 GCTTTTCCTGTAGTTCATGTGGG - Intergenic
1016702923 6:147073796-147073818 GCTTTTCTTGAAATCAATGAAGG - Intergenic
1017637600 6:156457872-156457894 GCTATTCTTGCAATTACTGTTGG - Intergenic
1017760615 6:157565305-157565327 ATTTTTCGTGTAATTAATGGTGG + Intronic
1020870139 7:13618956-13618978 GTTTTTCTTGGAATTAATGTTGG + Intergenic
1022962077 7:35437005-35437027 GCTCTTCCTACAATGAGTGGTGG - Intergenic
1026030398 7:66788069-66788091 GCTTGTCCTGCTTTTAAAGGGGG + Intronic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1028878937 7:95857214-95857236 GCTATTGCTGCAACTAAAGGAGG - Intronic
1030882095 7:114893011-114893033 GCTTTTGCTGCAATTGCTGTTGG + Intergenic
1032865512 7:135920373-135920395 GCTTGTAATGCATTTAATGGAGG - Intergenic
1041175825 8:55194880-55194902 GCTTTTCATAAAATTAAAGGAGG + Intronic
1041519331 8:58738147-58738169 GCTTTTCCTGCAATTGCTACAGG + Intergenic
1041632733 8:60106209-60106231 GCTATTCCTCCAATCAAAGGTGG - Intergenic
1042326650 8:67535733-67535755 GCTTTTGTTGCAATTAATTTTGG + Intronic
1042714475 8:71757586-71757608 GCTTTCACTGCTAATAATGGAGG + Intergenic
1044554541 8:93548631-93548653 GCTTTTCTTGCAATTGCTTGTGG - Intergenic
1046251477 8:111637004-111637026 GCTTTTCCTTCACCTAATGCTGG + Intergenic
1046368390 8:113268994-113269016 CCTTTTACTACAATTAATGCTGG + Intronic
1046442037 8:114269401-114269423 GCTGTTCCTGAAATAAATGGGGG + Intergenic
1047078845 8:121436808-121436830 GCTTTCCCAGAAATTACTGGGGG - Intergenic
1047674547 8:127185853-127185875 GCTTCTCTTGCAATTAATTGTGG - Intergenic
1052275298 9:26668620-26668642 GCTCTTGCTGGAATGAATGGTGG - Intergenic
1055171500 9:73264946-73264968 TCTTGTCCTTCAATTCATGGTGG - Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1057574273 9:96229225-96229247 ACTTGACCTGCAGTTAATGGGGG - Intergenic
1057981354 9:99667027-99667049 GCTTTTGCTGGAATTAATGGTGG - Intergenic
1059281039 9:113134344-113134366 GCTTTTCCTGCATGTGGTGGTGG - Intergenic
1059352676 9:113676807-113676829 GGTTTCCCTGCAATCAATGGTGG - Intergenic
1194069233 X:89299021-89299043 GCTTTCTCTGAAATTAATAGAGG - Intergenic
1195526625 X:105898395-105898417 GCTTTTCCTGCTATTTATTTTGG - Intronic
1195813809 X:108863258-108863280 GCCATTCCTGAAATTAATGGTGG - Intergenic
1197819926 X:130531929-130531951 GCTTCCCCTGCAATTCATGGAGG + Intergenic
1200723381 Y:6633163-6633185 GCTTTGTCTGAAATTAATAGAGG - Intergenic
1201566517 Y:15370316-15370338 GCATTTCCTGAATTTAATGTTGG - Intergenic