ID: 964576087

View in Genome Browser
Species Human (GRCh38)
Location 3:158170148-158170170
Sequence ATAAGCCAGGTGAACAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964576087_964576089 16 Left 964576087 3:158170148-158170170 CCTAATTTGTTCACCTGGCTTAT 0: 1
1: 0
2: 3
3: 22
4: 210
Right 964576089 3:158170187-158170209 TTATGACCTTGCTTCTTTTGAGG 0: 1
1: 0
2: 6
3: 22
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964576087 Original CRISPR ATAAGCCAGGTGAACAAATT AGG (reversed) Intronic
903710244 1:25318020-25318042 ATATGCCAGGTGAAAATATGTGG + Intronic
903716872 1:25374386-25374408 ATATGCCAGGTGAAAATATGTGG - Intronic
903758285 1:25679324-25679346 AGAAGTCTGGTGAACAAATTAGG - Intronic
906269501 1:44463992-44464014 ATATGCCAACTGAACCAATTAGG - Intronic
907805043 1:57810393-57810415 ATTAGCCAAGTGAACAAATTAGG + Intronic
908649886 1:66320904-66320926 GCTAGCCAGGTGAACAAAGTTGG + Intronic
909062919 1:70899806-70899828 AAAAGCCTGGTGAAGAGATTAGG + Intronic
909813082 1:79955420-79955442 ATAAACCATGTAAAAAAATTTGG + Intergenic
911289411 1:96038666-96038688 GTAAGCCACTTGAACAATTTGGG + Intergenic
911727964 1:101262321-101262343 GTAATCCAGGTGAACAAAAAAGG - Intergenic
913312573 1:117516200-117516222 ATATTCCAGGTAAACAAATATGG + Intronic
915843608 1:159238933-159238955 ATAAGTCAAGTGAAAAAAATTGG - Intergenic
916784068 1:168070880-168070902 ATAAGACATGTTAACACATTTGG - Intronic
917285966 1:173421785-173421807 TTAAGCCAGAAGAACAAATTGGG - Intergenic
917487231 1:175466396-175466418 AGAAGCCAAGTGACCAAATGGGG - Intronic
917750375 1:178048026-178048048 GTTAGCAGGGTGAACAAATTTGG - Intergenic
919021706 1:192114459-192114481 AGAAACCAGGTGAACATTTTTGG - Intergenic
919583378 1:199405667-199405689 AAAAGCCAGTTGATCAAAATAGG - Intergenic
923015466 1:230123229-230123251 ATAAGGCAGGTGATCAAGCTTGG - Intronic
924127356 1:240868862-240868884 ATACCCCAGGTGAAGACATTTGG + Intronic
924246451 1:242090489-242090511 CTAATCCATGTGAACAAATGAGG + Intronic
1062760947 10:18338-18360 AAAAGCCAGGAAAACATATTTGG + Intergenic
1063163186 10:3434793-3434815 ATAATCCAGGTGAGCAAAAGAGG - Intergenic
1065518667 10:26551158-26551180 AGCAGCCAGGTGGACAAATTTGG - Intronic
1071820533 10:89275493-89275515 ATAAGGCAGGTGGAAAAAATGGG - Intronic
1071878261 10:89866041-89866063 CTAAGCCATGTGAAGGAATTTGG + Intergenic
1072970662 10:100014516-100014538 ATAAGCCATGTGAACAAAGGAGG + Intergenic
1079023738 11:16929463-16929485 AAAAGCAAGGTGAACAGTTTTGG - Intronic
1079414209 11:20217925-20217947 ATAGGCCAGGCTAAGAAATTTGG - Intergenic
1079971997 11:27046400-27046422 ATATGGTAGGTGAATAAATTAGG + Intronic
1082581247 11:54872178-54872200 CTAAGCCAAGAGAACAAAGTCGG - Intergenic
1082699157 11:56406679-56406701 ATAAACCAGGTTAAGAAGTTTGG + Intergenic
1086241160 11:84693654-84693676 ATAAGCCAGGTGAGACAATTGGG - Intronic
1086279215 11:85166431-85166453 AAAAGCCAGGTAGCCAAATTGGG - Intronic
1086481858 11:87248556-87248578 ATAAGCAAGAAGAACAAAATTGG - Intronic
1087262683 11:96028333-96028355 ATTAGCCAGGTGCAGAAATGAGG - Intronic
1087336796 11:96853737-96853759 ATAAACCAGGTGCACATAATAGG - Intergenic
1090506163 11:127317789-127317811 ACAAGCCTGGTAAACAGATTGGG + Intergenic
1091069720 11:132551616-132551638 ATGAGCCAGCTGATCAAACTGGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1095343032 12:41114795-41114817 CTAAGCCAGATGAACATTTTGGG + Intergenic
1095760504 12:45829084-45829106 ATAAGCCAGGAGTAAAGATTTGG + Intronic
1096456608 12:51792653-51792675 GTAAGCCAGGTTAACAAATAGGG + Intronic
1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG + Intronic
1098317742 12:69209761-69209783 ATAAGCCGGGGGAAGAAAGTAGG + Intergenic
1099734315 12:86548575-86548597 ATCAGCCAGATGAACATTTTAGG + Intronic
1100314544 12:93432255-93432277 GTAAGCCAGGTGAACAAGAAAGG - Intronic
1100383607 12:94085079-94085101 ATGATCCAGCAGAACAAATTGGG + Intergenic
1101186654 12:102287914-102287936 ATAAGACAGGCGGACAAGTTTGG - Intergenic
1101309801 12:103565851-103565873 ATAAACCAGGTAAACAATTCAGG + Intergenic
1106325188 13:28682457-28682479 ATTAACCAGGTGATCAAACTTGG - Intergenic
1106690430 13:32109509-32109531 TTTATCCAGATGAACAAATTGGG + Intronic
1109959036 13:69606300-69606322 ACAGGCAAGGTGAACCAATTGGG + Intergenic
1110279177 13:73672710-73672732 ATAAGCCATATGAACAGAATTGG + Intergenic
1110375629 13:74790529-74790551 CTAAGCAAAGTGAACAAATCTGG - Intergenic
1111633305 13:90871378-90871400 ATAGGCCAGTGGAACAAAATAGG + Intergenic
1114030650 14:18576960-18576982 AAAAGCCAGGAAAACATATTTGG - Intergenic
1116116952 14:40665692-40665714 AGAAGTCAGATGATCAAATTAGG + Intergenic
1116230476 14:42209270-42209292 ATAACCCAGTTGAAAACATTTGG + Intergenic
1116522196 14:45863273-45863295 ATAAGCCAGGTGCAGAAAGACGG + Intergenic
1118079256 14:62339412-62339434 AAAAGGCAGGGGACCAAATTTGG - Intergenic
1118953558 14:70457954-70457976 ATAAACCAGGTGTTCAAATGTGG - Exonic
1119701194 14:76756029-76756051 ATAAGACAGATGAGCAGATTTGG - Intergenic
1120294616 14:82623920-82623942 ATTAGAAAGGTGAACAAATATGG - Intergenic
1123099738 14:105788903-105788925 CTAAGCAAGGTGAACAAATCTGG + Intergenic
1124103890 15:26719748-26719770 ACAAGCCAGTTGAAGAAATTAGG + Intronic
1124643715 15:31419249-31419271 ATAAGGCATGTGAAGAAATAGGG + Intronic
1124850166 15:33329142-33329164 GTAAGCCAGGGGAAGAAATGGGG - Intronic
1125349086 15:38748877-38748899 CTAAGCCAGTTGAACAAGTAAGG + Intergenic
1127561279 15:60138814-60138836 ATAAGCCAGCTAAATGAATTGGG - Intergenic
1128452829 15:67816417-67816439 ATAACCCAGTTGAAAAAATAGGG + Intergenic
1130833949 15:87631082-87631104 ATAGGCAAGGTGAACCCATTGGG + Intergenic
1131648953 15:94378030-94378052 CTGGGCCAGGTGAAGAAATTTGG + Intronic
1133707716 16:8371022-8371044 ATAAGCCAGGGGCTCAAACTTGG - Intergenic
1134892792 16:17855806-17855828 AAAAGCCAGGTAGAGAAATTTGG - Intergenic
1135712317 16:24728480-24728502 AAAAGCCAGTTGAAGAACTTAGG + Intergenic
1136735835 16:32466823-32466845 AAAAGCCAGGAAAACATATTTGG - Intergenic
1137682744 16:50364981-50365003 ATAAGCCACGTCAACACACTTGG + Intronic
1139980171 16:70850979-70851001 ATAAGCCAGAAGAATAAAATAGG + Intronic
1140655432 16:77134845-77134867 GTAAGCCAGGTAAAGAATTTGGG - Intergenic
1140963926 16:79945298-79945320 ATAAGCCTGGAGGACAGATTAGG + Intergenic
1142336338 16:89491441-89491463 AAAAGCAAGGTGAACAAAATCGG + Intronic
1203017240 16_KI270728v1_random:362751-362773 AAAAGCCAGGAAAACATATTTGG + Intergenic
1203035575 16_KI270728v1_random:635909-635931 AAAAGCCAGGAAAACATATTTGG + Intergenic
1144097527 17:11915089-11915111 ATAAGCCAGGTGAAAGACTATGG - Intronic
1144549978 17:16231966-16231988 AAAAACAAGGTAAACAAATTAGG + Intronic
1145857560 17:28176561-28176583 ATAAGCCAGATGTTAAAATTAGG + Intronic
1146692596 17:34886959-34886981 AAGAGCCACGTGAACACATTTGG + Intergenic
1147501910 17:40973481-40973503 ATAAGAATGGAGAACAAATTAGG - Intergenic
1148526267 17:48339414-48339436 GTAAGCTATGTGAACATATTTGG - Intronic
1151071944 17:71224611-71224633 ATAAAGCACGTGAATAAATTTGG + Intergenic
1152163787 17:78687489-78687511 ATAAGCCAGGTGAATCACCTTGG - Intronic
1152953854 18:18692-18714 AAAAGCCAGGAAAACATATTTGG + Intergenic
1153445022 18:5162157-5162179 ATAGGCCAGGTGAGAAAATGTGG - Intronic
1153597657 18:6744372-6744394 ATAATCCAGATGAAGAAATTGGG - Intronic
1156760969 18:40589934-40589956 ATAAGCCAGCTGAAAAATTTAGG - Intergenic
1156833535 18:41524831-41524853 ATAAGCCAGGTAAACAATACTGG - Intergenic
1157869104 18:51213114-51213136 AAAATCAAGTTGAACAAATTGGG + Intronic
1158333501 18:56389317-56389339 GTAAGCCACGTTAAGAAATTTGG - Intergenic
1158386520 18:56999260-56999282 AGAAGCCTGGTGAAGAATTTAGG + Intronic
1159978748 18:74750487-74750509 ACATGCCAGTTGAATAAATTTGG - Intronic
1163883323 19:19945856-19945878 ATAAGACAGGAAAAAAAATTGGG - Intergenic
1164453808 19:28390246-28390268 ATAAGCCAGTTAAATAAATAAGG + Intergenic
1164562956 19:29306422-29306444 ATAAACCAAGTTAACAAATAAGG - Intergenic
925754688 2:7122186-7122208 ATAAGGCTGTTGAACTAATTTGG - Intergenic
927267434 2:21167021-21167043 ATAAGCCAGAAGAACTAAATAGG - Intergenic
927567545 2:24126052-24126074 ATAAACAGGATGAACAAATTGGG - Intronic
930500668 2:52213308-52213330 ATAAGCCATGTAAACAAGATAGG + Intergenic
931136365 2:59406351-59406373 ATAAGCAAGGAGAACAAATCTGG + Intergenic
932061655 2:68506588-68506610 ATATGACAGATGAAGAAATTGGG + Intronic
932222632 2:70011475-70011497 ATAGGCCAGGTGAGCAGATGAGG + Intergenic
932312165 2:70752223-70752245 ATAAACCAAGAGAATAAATTGGG + Intronic
932552542 2:72785820-72785842 TTAAGCCAGCTGCAGAAATTTGG - Intronic
933152403 2:78931278-78931300 ATAACACAGGTGAAGAAAATGGG + Intergenic
934309991 2:91853240-91853262 AAAAGCCAGGAAAACATATTTGG + Intergenic
934994704 2:98946959-98946981 AGAAGCAAGGAGAACAAATGTGG + Intergenic
936992534 2:118381462-118381484 ATAAGCCAGGTGAATAAATATGG - Intergenic
938497556 2:131808807-131808829 AAAAGCCAGGAAAACATATTTGG + Intergenic
940089930 2:149903760-149903782 ATAAGCCAGGAAGAGAAATTTGG + Intergenic
947297457 2:228647735-228647757 TTAATCCAGATTAACAAATTAGG - Intergenic
947876853 2:233473492-233473514 ACAAGACAGGTGAGGAAATTGGG + Intergenic
1169955270 20:11095914-11095936 CTAAGGTAGGTTAACAAATTGGG + Intergenic
1170174156 20:13449227-13449249 ATAATGCAGGTGAGCAACTTGGG + Intronic
1170402934 20:16007166-16007188 ATAAGCAGGGTGAACATTTTTGG + Intronic
1170487296 20:16831500-16831522 CAAAGCCAGGTGAAAGAATTAGG - Intergenic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1178354775 21:31901399-31901421 AAAAGCCAGGTGTACAAACCGGG - Intronic
1179536007 21:42052757-42052779 ATACGCCAGGTGAAATATTTAGG - Intergenic
1180454766 22:15504016-15504038 AAAAGCCAGGAAAACATATTTGG - Intergenic
1180536726 22:16399124-16399146 AAAAGCCAGGAAAACATATTTGG + Intergenic
1183826043 22:40388526-40388548 ATAAATCAAGTTAACAAATTTGG + Intronic
949141243 3:635857-635879 ATAATGGAGGTGGACAAATTTGG + Intergenic
949684481 3:6552701-6552723 ATAAGCCAGTTTCACAAAGTTGG - Intergenic
950655946 3:14436398-14436420 ATAAGCCTGGGCAACACATTTGG - Intronic
951927844 3:27928321-27928343 ATAAGCTAGATTAAAAAATTAGG - Intergenic
956017534 3:64899532-64899554 ATAATACAGATGAAAAAATTGGG + Intergenic
956196896 3:66661958-66661980 ATAGGGCAGGGGAAGAAATTAGG + Intergenic
957048245 3:75392935-75392957 ATAAACCAGGAAAAAAAATTGGG + Intergenic
959632521 3:108523687-108523709 ATAATCCAGATTAACAATTTAGG + Intronic
960198086 3:114795561-114795583 ATCAGCCAGGTGAAGAATTTGGG - Intronic
960624623 3:119669480-119669502 AAAAGCCACGTGAGCAAATGAGG + Exonic
961576368 3:127840096-127840118 ATAAGGCAAATAAACAAATTTGG + Intergenic
963005491 3:140723114-140723136 CTTAGCCAGGTGAAGAAGTTGGG - Intergenic
963302733 3:143617108-143617130 ATGAGCCAGGTGAATAAAGGAGG + Intronic
963469793 3:145726035-145726057 ATAAGCCATGTTAAGAATTTAGG - Intergenic
964576087 3:158170148-158170170 ATAAGCCAGGTGAACAAATTAGG - Intronic
964701921 3:159577397-159577419 ATCAGCAAAGTGAACACATTTGG - Intronic
965467314 3:169046112-169046134 ATAAGTCAGGTGAACAAAGATGG + Intergenic
966039731 3:175467303-175467325 ATAAGCCATCTCAGCAAATTAGG - Intronic
968992708 4:3925385-3925407 ATAAACCAGGAAAAAAAATTGGG + Intergenic
970682126 4:18521660-18521682 ATTACCAAGATGAACAAATTTGG - Intergenic
970925626 4:21448516-21448538 ATAAGCCATGAGAAGAAATCAGG - Intronic
970970349 4:21975885-21975907 ATATGCCAGGTTGAGAAATTGGG + Intergenic
972371336 4:38426352-38426374 AACATCCAGGTGAACAAATTTGG - Intergenic
973156482 4:46961296-46961318 AGATGCCAGCTGAAGAAATTAGG - Intronic
975341228 4:73243329-73243351 AAAAGCCAGGAGATCAAATTAGG + Intronic
975362183 4:73483772-73483794 ATAAGTCATGTGAACAAAATAGG - Intronic
976482204 4:85557614-85557636 AACATCCAGGTGAACACATTGGG - Intronic
976971977 4:91115277-91115299 ATAAGACAGGAGTACAAACTGGG - Intronic
977277369 4:94994190-94994212 ATAAGCCAGGTTGACAAACTTGG - Intronic
978534723 4:109748955-109748977 ATAAGCCAGGTGAAGTAATTTGG + Intronic
979003425 4:115257506-115257528 CTAAGCAAAATGAACAAATTCGG + Intergenic
979542386 4:121900183-121900205 CTAAGCCAGGTTCACAATTTTGG + Intronic
980181111 4:129402052-129402074 ATAAGACAGGTAAGCAAATAAGG + Intergenic
980998656 4:139806794-139806816 ATAATATAGGTGAACAAAGTAGG + Intronic
982001267 4:151023568-151023590 ATAAGCCAGATGAAAAATTTGGG + Intergenic
986554238 5:8995161-8995183 TCAAGCCAGGTACACAAATTTGG + Intergenic
987968786 5:24914281-24914303 ATAAGTCTGGTGAGAAAATTGGG - Intergenic
988569228 5:32347800-32347822 ATATTCCTGGTTAACAAATTAGG - Intergenic
988664296 5:33308344-33308366 AGAGCCCAGGTGAACACATTTGG - Intergenic
991612314 5:68462275-68462297 ATAGGCCATGTGAACAACTTTGG + Intergenic
992922041 5:81535477-81535499 ATAAAAAAGGAGAACAAATTTGG + Intronic
992925332 5:81578967-81578989 ATATGCCAGGTAAAGAAATCTGG + Intronic
995618006 5:113988934-113988956 ATAAGCCAGGTAAAGAACTTTGG - Intergenic
996811597 5:127521664-127521686 ATAAACCAGGTTAAAAAACTTGG - Intronic
998272410 5:140718703-140718725 ATAAGCCAGGTACACAACTGCGG + Intergenic
998603915 5:143614530-143614552 ACAAGACTGGTGAATAAATTGGG - Intergenic
999086743 5:148898802-148898824 ATAAGCCAGGAGACCCAACTAGG + Intergenic
1000306300 5:159997569-159997591 ATAAAGCAGATGAACAAATGAGG - Intergenic
1000592535 5:163175962-163175984 TGAAGCCAGGTGCACACATTGGG + Intergenic
1000842039 5:166232019-166232041 CTAAGCCAGGAGAACAATCTGGG - Intergenic
1001031890 5:168269226-168269248 ACCAGCCAGGTGAAACAATTAGG + Intergenic
1002578727 5:180194307-180194329 ATAAGAAAGAGGAACAAATTAGG - Intronic
1003692670 6:8370096-8370118 ACAAGCCAGCTGACCAAAATAGG + Intergenic
1004826793 6:19431012-19431034 ATAAGCCAGGTTAAGTAGTTTGG + Intergenic
1005201246 6:23347258-23347280 ATAAGCCATGTTAACAAATCTGG + Intergenic
1006639600 6:35483143-35483165 ATTAGCTAAGTGAATAAATTTGG + Intronic
1007948110 6:45844119-45844141 ATAAGCCAGACTACCAAATTTGG - Intergenic
1012355174 6:98305681-98305703 ATAAGTCACGTAAATAAATTAGG + Intergenic
1014695346 6:124614070-124614092 ATAAGAGAGGAGAAAAAATTTGG - Intronic
1014717061 6:124879228-124879250 ATCATCCAGGTGGACACATTGGG + Intergenic
1016494457 6:144644256-144644278 ATCAGCCATTTGAACAAATCAGG - Intronic
1017193795 6:151679909-151679931 ATAAGCCAGGTGATCAGACAGGG - Intronic
1017798357 6:157868845-157868867 ATCAGCCAGGTGAAGAAAGCAGG - Intronic
1018076976 6:160226144-160226166 ATAAGCCAGTTTATCAATTTGGG - Intronic
1018755657 6:166847459-166847481 CTAAGCAAGAAGAACAAATTTGG + Intronic
1018851555 6:167644138-167644160 ATAAGCCTGGTGACCCATTTAGG + Intergenic
1021388093 7:20057107-20057129 ATAAGCAAAATGAACAAATCTGG + Intergenic
1021652550 7:22846152-22846174 AAAAGCCAGATGAGCAAACTTGG - Intergenic
1022595059 7:31705567-31705589 AGAACCCATGTGAACAAACTAGG + Intronic
1022858369 7:34339560-34339582 ACAAGGCAGGAGAAAAAATTTGG - Intergenic
1027559240 7:79706377-79706399 GTAAGAAAGGTGAACAAGTTTGG - Intergenic
1027811378 7:82904729-82904751 ATAAAACTGGTGAAAAAATTAGG - Intronic
1028679150 7:93505676-93505698 ATAAGCCATGTCTACAAAATAGG + Intronic
1028823041 7:95234723-95234745 CTAAGCAAGAAGAACAAATTTGG + Intronic
1029956227 7:104643159-104643181 GAGAGCCAGATGAACAAATTAGG - Intronic
1031801769 7:126255723-126255745 ATAAAGCACGTGAATAAATTTGG + Intergenic
1032593715 7:133217900-133217922 ATAAGCAAGGAGAACACATCTGG + Intergenic
1035897429 8:3419381-3419403 TGAAGCCAGATGAACAAAATAGG + Intronic
1037388066 8:18364533-18364555 ATTAGCCAGGTGTACATGTTGGG + Intergenic
1037555299 8:20016486-20016508 AAAAGCCAAGAGAACAATTTTGG - Intergenic
1038832684 8:31079831-31079853 ATCAGTGAGGTGAAAAAATTAGG + Intronic
1038836907 8:31135991-31136013 ATAAACCAGGTGGAAAAATAAGG - Intronic
1039472739 8:37823878-37823900 ATAACCCAGTTGAAAAAAATGGG - Intronic
1039472788 8:37824331-37824353 ATAATCCAGTTGAAAAAAATGGG - Intronic
1041555886 8:59154996-59155018 AAGAGCAAGGTTAACAAATTAGG - Intergenic
1042400029 8:68334083-68334105 ATAAACTAAGTGAACAAACTAGG - Intronic
1043316099 8:78924149-78924171 ATGAGGCAGGTGAACAGATCTGG - Intergenic
1045757586 8:105562962-105562984 ATAACACAGGTGATGAAATTTGG + Intronic
1047116813 8:121851902-121851924 ATAAGCGAGATGAAGAAATATGG - Intergenic
1048528980 8:135230186-135230208 CTAAGCCAGCTGCACAAGTTTGG - Intergenic
1050305395 9:4300319-4300341 ATAAGTCAGTTTAACAAATAAGG - Intronic
1052595951 9:30558541-30558563 ACAAGCCAGTTGCAGAAATTTGG - Intergenic
1054883932 9:70175202-70175224 ATAACCCAGGTGAACAATGATGG + Intronic
1055261058 9:74434308-74434330 AGATGCCAGGGGAAGAAATTTGG - Intergenic
1057799030 9:98178528-98178550 ATAAACCAGGTTAATTAATTGGG + Intronic
1058950381 9:109897679-109897701 AAATGCCTGGTGAAAAAATTTGG - Intronic
1059113028 9:111574793-111574815 ATCGGCCAGATGAAGAAATTTGG - Exonic
1186115537 X:6301603-6301625 ATAAGCAAGGTGAACCCACTGGG - Intergenic
1186952264 X:14639773-14639795 ATAAGGCAAGTGAACAAACAGGG - Intronic
1192692063 X:73374468-73374490 AACATCCAGGTGAACACATTGGG - Intergenic
1194557253 X:95375641-95375663 CTAAGCCAGAAGAACAAATCTGG + Intergenic
1194577165 X:95627307-95627329 ATGAACAAGGTGAACCAATTAGG + Intergenic
1196000733 X:110782789-110782811 AAATGCCACGTGAACAAATGAGG - Intronic
1197311005 X:124905472-124905494 TTAAGGCAGGAGAATAAATTTGG - Intronic
1199261091 X:145776109-145776131 TTATGCAAGGTGAATAAATTTGG - Intergenic