ID: 964579804

View in Genome Browser
Species Human (GRCh38)
Location 3:158220353-158220375
Sequence GAGTACAGACAGATGGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964579804_964579807 -1 Left 964579804 3:158220353-158220375 CCTCAGTCCATCTGTCTGTACTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 964579807 3:158220375-158220397 CTGAAGGTTAGATGAAATGATGG 0: 1
1: 0
2: 0
3: 30
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964579804 Original CRISPR GAGTACAGACAGATGGACTG AGG (reversed) Intronic
903405631 1:23092923-23092945 GAGTACAGACAGTGGGACTCAGG - Exonic
903462346 1:23528718-23528740 AGGTACAGACAGATGTACTTGGG + Intronic
905803185 1:40858935-40858957 GACAGCAGACAGATGGACAGGGG - Intergenic
908161983 1:61419139-61419161 CAGTTCAGACAGACAGACTGTGG + Intronic
910844354 1:91591308-91591330 TAGTACAGTGGGATGGACTGCGG + Intergenic
910857298 1:91708295-91708317 GATCACAGAAAGATGAACTGTGG + Intronic
913230664 1:116738267-116738289 GAGTAGAGGAAGATAGACTGAGG - Intergenic
913238661 1:116807958-116807980 GATTTCAGACACAAGGACTGAGG + Intergenic
913956685 1:143305141-143305163 GAGTACAAACAGATCCACAGAGG + Intergenic
913980760 1:143510524-143510546 GAGTACAAACAGATCCACAGAGG - Intergenic
914075122 1:144336954-144336976 GAGTACAAACAGATCCACAGAGG - Intergenic
914104056 1:144629542-144629564 GAGTACAAACAGATCCACAGAGG + Intergenic
915899735 1:159837788-159837810 GAGTACAGAGAGATGGCCTGGGG + Intronic
916047859 1:161014008-161014030 GAGTCCAGGCAGATGAACTCTGG + Intronic
920717916 1:208358592-208358614 CAGAACAGACAGATGTATTGTGG + Intergenic
924454309 1:244206335-244206357 GAGGCTGGACAGATGGACTGGGG + Intergenic
1063001862 10:1932289-1932311 GAGGACAGAGAGAGAGACTGGGG + Intergenic
1068908772 10:62356390-62356412 GTGTAAAGACAGATGGATTCTGG + Intergenic
1072301202 10:94064015-94064037 GGGTACTGAGAGGTGGACTGGGG + Intronic
1073439431 10:103543945-103543967 GAGGCCAGACACATGGGCTGGGG + Intronic
1073452737 10:103619248-103619270 GAGCAGAGAGAGTTGGACTGTGG - Intronic
1074271283 10:111956377-111956399 GAGCTCAGACAGCTGGAGTGGGG - Intergenic
1076676707 10:132150805-132150827 GAGGACAGATAGATGGATTATGG - Intronic
1077002614 11:331921-331943 GTGTACATCCAGATGGCCTGAGG + Intergenic
1080760365 11:35243322-35243344 GAAGACAGGGAGATGGACTGGGG + Intergenic
1083193263 11:61067918-61067940 GAGCACAGACAGAGGAGCTGTGG + Intergenic
1083366028 11:62141854-62141876 GAGAACAGACAGGTTGTCTGTGG + Intronic
1083436758 11:62648250-62648272 CAGGTCAGACAGATGGGCTGAGG + Exonic
1084668707 11:70592586-70592608 GGGTGCAGACAGAGGGACAGAGG - Intronic
1084919803 11:72459829-72459851 GCCTGCAGACAGAGGGACTGTGG + Intergenic
1085420078 11:76349582-76349604 TAGGACAGAGAAATGGACTGTGG + Intergenic
1085477819 11:76798931-76798953 GAGAACAAACAGGAGGACTGTGG - Intergenic
1087916987 11:103822514-103822536 TACTACAGACAGATGCACTTTGG - Intergenic
1089943098 11:122440092-122440114 GAGAAGAGAAAAATGGACTGTGG - Intergenic
1090475313 11:127014877-127014899 GGGTACAGACTGAGTGACTGGGG + Intergenic
1090994395 11:131852229-131852251 GAGGACAGACAGATGATCTATGG + Intronic
1091068725 11:132542769-132542791 GATTCCAGATAGATGGCCTGAGG - Intronic
1091110333 11:132960589-132960611 GAAGACAGACAGATGGAGAGGGG - Intronic
1091671019 12:2452289-2452311 GAATAAACACAGAGGGACTGTGG + Intronic
1092069048 12:5617918-5617940 GAATCCAAACACATGGACTGAGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093378250 12:18457598-18457620 GATTACAGACAGAGAGAGTGGGG - Intronic
1095410660 12:41917994-41918016 GCAAAAAGACAGATGGACTGTGG - Intergenic
1095895749 12:47278881-47278903 GAGTAAAGACAGACAGTCTGTGG + Intergenic
1098447998 12:70587251-70587273 GAGGACAGCCAGGGGGACTGAGG + Exonic
1100516671 12:95334698-95334720 GAATACAAACAGGTGGGCTGTGG - Intergenic
1103873402 12:124107455-124107477 GAATACATCCAGATGGCCTGAGG - Intronic
1104081861 12:125436148-125436170 CAGTTCAGACAGTTGGACTCCGG - Intronic
1104427648 12:128691418-128691440 ATGCACAGACAGATGGACAGAGG - Intronic
1105790425 13:23792748-23792770 GAGGACTGACAGATGGAATGTGG - Intronic
1108345923 13:49546875-49546897 CAGTACAGGCATATGGCCTGGGG + Intronic
1109589806 13:64463182-64463204 GGGAGCAGACAGATGGACAGGGG - Intergenic
1110794930 13:79624968-79624990 GAGTACCTACAGATTGATTGGGG + Intergenic
1112987293 13:105466649-105466671 TAGCACAGGCAGATGGAGTGAGG - Intronic
1113404739 13:110027821-110027843 GGGTACAGACAGGTGGGTTGGGG + Intergenic
1113542587 13:111120857-111120879 GAGTGCAGCCAGATGACCTGGGG - Intronic
1114771328 14:25430879-25430901 GTGTACATCCAGATGGCCTGAGG - Intergenic
1119885457 14:78136851-78136873 GAGTACAGACAGGACGCCTGTGG - Intergenic
1120458433 14:84761971-84761993 ACATACAGACAGATAGACTGAGG - Intergenic
1120999779 14:90443348-90443370 GAGAACAGCCAGGTGGCCTGTGG + Intergenic
1121050557 14:90816616-90816638 GAGGACAGGGAGAGGGACTGGGG + Intergenic
1121637708 14:95465100-95465122 GAGAATGGACAGAGGGACTGGGG + Intronic
1122736997 14:103848510-103848532 GAGAGCAGACAGGGGGACTGAGG + Intergenic
1126932388 15:53669127-53669149 TACTACAGACAGCTGTACTGGGG - Intronic
1129781279 15:78273318-78273340 GATTACAAACAGGTGGCCTGAGG + Intronic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1133344433 16:5060445-5060467 GAGGACAGATAGATGGGGTGGGG + Intronic
1134375025 16:13664156-13664178 GAATAAAGACAGATGGAGAGAGG - Intergenic
1134676814 16:16096507-16096529 GAGGACAGCCAGAAGGAATGTGG - Intronic
1135764269 16:25163992-25164014 GAGTTCAGTCAGGTGGACAGTGG + Intronic
1135807068 16:25552448-25552470 TAGTACATAGAGATGGAATGGGG + Intergenic
1141435052 16:83995272-83995294 GCCTACAGACAGATGGGCTCAGG + Intronic
1142320836 16:89381893-89381915 GAGTGCAGTCGGCTGGACTGTGG - Intronic
1142455219 16:90216884-90216906 TGGTAGAGACAGAGGGACTGAGG + Intergenic
1143590176 17:7880987-7881009 GAGTACTGACAGACTGACAGAGG + Intronic
1148207498 17:45788312-45788334 GTTTACAGACAGATAAACTGTGG - Intronic
1148818784 17:50348329-50348351 GAGTTCAGGCAGAAGGCCTGAGG + Intronic
1149533008 17:57410452-57410474 GTGCACAGACAGACAGACTGTGG - Intronic
1149689339 17:58561380-58561402 GAGTGCAGACAGGTGGAGTCAGG + Intronic
1152235750 17:79137542-79137564 AAGTCCAGGCAGGTGGACTGGGG - Intronic
1152899429 17:82931572-82931594 GCCCACAGACAGATGCACTGTGG - Intronic
1153634744 18:7103936-7103958 GAGACCAGACAGACGGACAGAGG - Intronic
1154205611 18:12334329-12334351 GAGTACAGACACTGAGACTGTGG + Intronic
1157779522 18:50425125-50425147 GAGTACAACCACATGGAGTGGGG - Intergenic
1158195218 18:54877304-54877326 GAGAACAGACTAATGCACTGTGG + Intronic
1162449973 19:10748730-10748752 CATTTCAGACAGGTGGACTGAGG - Intronic
1164444993 19:28309312-28309334 TATTACAGCCAGATGCACTGAGG + Intergenic
1164967090 19:32494762-32494784 GAGAAGAGACAGAAGGAATGTGG - Intergenic
1165061914 19:33209024-33209046 GAGGACAGACAGATGGACCTTGG + Intronic
1165226659 19:34359730-34359752 GAGTGAAGGCAGAGGGACTGGGG - Intronic
1165718351 19:38061671-38061693 GAGTACAGAGAGATGGAGCAGGG + Intronic
927261640 2:21097541-21097563 GAACACACACAGATGGACTTCGG - Intergenic
930373424 2:50533682-50533704 GAGGCCAGAGAGATGGACTGGGG - Intronic
933747523 2:85581901-85581923 GAAAAAAGAGAGATGGACTGTGG + Exonic
935972369 2:108542670-108542692 AAGTTCAGAAAGAAGGACTGTGG - Intronic
936708192 2:115100870-115100892 GTTTACAGACTCATGGACTGTGG - Intronic
937543294 2:122985958-122985980 GATTAGAGACAGTGGGACTGAGG - Intergenic
937856158 2:126673294-126673316 AAGTACAGACAGATGCCCGGGGG - Intronic
943944235 2:194038297-194038319 GAGTACATGCAGATGGCCTGAGG + Intergenic
944119018 2:196220723-196220745 AAGTACAATAAGATGGACTGTGG + Intronic
946436482 2:219659676-219659698 GAGTAAACACAGAGGGGCTGAGG - Intergenic
1168902536 20:1377326-1377348 GAGTAGAGACGGATGTCCTGGGG + Intronic
1169753058 20:9015076-9015098 GAGTAAACACTGATGCACTGGGG + Intergenic
1172122862 20:32608897-32608919 CAGTTCAGACACATGGAGTGAGG + Intergenic
1175070833 20:56332468-56332490 GAGAACAGACTGAGGGGCTGGGG + Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1176086130 20:63296425-63296447 GAGGACAGCCAGGTGGGCTGGGG + Intronic
1178625066 21:34209242-34209264 GAGAACAGACTGATGTACTTGGG + Intergenic
1181613954 22:24038951-24038973 GAATATAGTCAGAAGGACTGGGG + Intronic
1182102739 22:27669567-27669589 GTGGACAGACAGATGGTCTAGGG - Intergenic
1185207895 22:49550643-49550665 GAGGACAGAGGGATGCACTGTGG - Intronic
950404085 3:12793885-12793907 GAGGACAGAGAGGTGGACAGGGG - Intergenic
951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG + Intronic
952786769 3:37163447-37163469 GAGGACAAAGAGAGGGACTGTGG - Intronic
952846957 3:37695900-37695922 GAGGAAAGACAGAAGGAATGGGG - Intronic
953119585 3:40026849-40026871 GAAGCCAGACAGAAGGACTGAGG - Intronic
953485316 3:43289112-43289134 CAGTACGAACAGATGAACTGTGG + Intronic
953577973 3:44128466-44128488 GAGCTCAGACAGGTGGGCTGTGG - Intergenic
956545215 3:70393802-70393824 GAGCTCAGACAGGTGGTCTGGGG + Intergenic
956598469 3:70994078-70994100 GTGTACTCACAGAGGGACTGTGG + Intronic
956620565 3:71217605-71217627 GAGAAGAGAGAGATGGGCTGGGG + Intronic
960197851 3:114792746-114792768 CAGGACAGAGAGATGGACGGGGG - Intronic
960330384 3:116352445-116352467 AAGTAGAGACAGAAGAACTGAGG + Intronic
960340954 3:116474459-116474481 GACTACTGACATATGGACTCTGG - Intronic
960445118 3:117738798-117738820 AAGTACAGGCAGATTGGCTGTGG - Intergenic
961721432 3:128899262-128899284 GAGGACAGAAAGATGGACTTTGG - Intronic
962893533 3:139693628-139693650 GACACCAGACACATGGACTGTGG - Intergenic
963039580 3:141058960-141058982 CAGAACACACATATGGACTGTGG - Intronic
964225024 3:154388722-154388744 CAGCACATACAGATAGACTGGGG - Intronic
964579804 3:158220353-158220375 GAGTACAGACAGATGGACTGAGG - Intronic
965862347 3:173161749-173161771 GAGTAAAGACAAATCCACTGAGG - Intergenic
967647296 3:191940806-191940828 GAGAACAGACATTTGGAATGTGG - Intergenic
967764349 3:193261955-193261977 GAGGACAGACAGAAGGATAGTGG + Intronic
968379700 4:80782-80804 GTGTACATCCAGATGGCCTGAGG - Intronic
968974663 4:3815475-3815497 CAGTACAGCCTGATGGAGTGGGG - Intergenic
969118654 4:4890601-4890623 GATGACAGATAGATGGACAGAGG - Intergenic
969258878 4:6021417-6021439 GAGTCCAGACAACTGGGCTGGGG + Intergenic
969511087 4:7618370-7618392 GAGGGCAGACAGAGGGGCTGGGG - Intronic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971712339 4:30130525-30130547 CAGAACAGGCAGATTGACTGAGG - Intergenic
976081693 4:81362064-81362086 GAGTACACATCCATGGACTGAGG - Intergenic
976754340 4:88482438-88482460 GAATTCAGACATATGGGCTGAGG - Intronic
980250862 4:130312973-130312995 CAGTACTGACATCTGGACTGGGG - Intergenic
985999904 5:3622262-3622284 GAGTACAGACAGAGTGAGTTAGG + Intergenic
986018878 5:3782267-3782289 GAATACAAACAGATGCTCTGTGG + Intergenic
986733701 5:10653122-10653144 GAGTCCAGAGAGAGGGACTGGGG - Intergenic
987325726 5:16810410-16810432 GAGAAAGGACAGATGGGCTGAGG - Intronic
989182251 5:38590214-38590236 GAGTAGAGACAGATCCTCTGGGG + Intronic
992126392 5:73646487-73646509 GAGCACAGAAAGATGGAGAGCGG - Intronic
992288596 5:75261619-75261641 GAGGACAGAAAGATGGAGAGAGG + Intergenic
992359764 5:76025063-76025085 GAACACACACAGATGGAGTGTGG - Intergenic
992752253 5:79872240-79872262 GAGAACACACAGATGGACTCTGG + Intergenic
995649892 5:114358684-114358706 GAGTACAGAGAGAAGGAGAGAGG - Intergenic
997791297 5:136764882-136764904 GATTCCAGAAAGATGGGCTGAGG + Intergenic
1000129554 5:158282976-158282998 GTGTACAGCCACCTGGACTGTGG + Intergenic
1000257261 5:159551769-159551791 GAGTACAGACAAAGGGGCTAAGG - Intergenic
1000363278 5:160467832-160467854 GAGTACAGACAGGAAGCCTGGGG + Intergenic
1002201080 5:177528732-177528754 GAGGCCTGACAGAAGGACTGTGG + Intronic
1003069886 6:2937779-2937801 GAATACAGACAGGTAGGCTGTGG + Intergenic
1004058804 6:12170382-12170404 CAGAACAGACAGAAGCACTGTGG + Intergenic
1004251414 6:14026048-14026070 GAGTACACAGAGATGGACAAGGG + Intergenic
1004401045 6:15288965-15288987 GAGCTCAGACTGAGGGACTGGGG + Intronic
1006025931 6:31146821-31146843 GAGAACAGAAAGATGCACTGTGG - Intronic
1006053191 6:31359319-31359341 GAGGACAGAGAGAAGGGCTGGGG - Intergenic
1006563040 6:34930329-34930351 AAGCACAGAAAGATGGAATGAGG + Intronic
1009996892 6:70905926-70905948 GTGTAGAGAGAGAGGGACTGGGG + Intronic
1011899541 6:92275139-92275161 GAGTCCAGACAGCTGGACTCTGG - Intergenic
1012747434 6:103111107-103111129 GAGTACAGGCAGAAGGAAAGAGG + Intergenic
1016712690 6:147191803-147191825 AAGTACAGGCAGGGGGACTGGGG + Intergenic
1018770738 6:166969593-166969615 CAGTAGAGACAGTTAGACTGGGG - Intergenic
1020687395 7:11312741-11312763 GATGACAGACAGATAGGCTGAGG - Intergenic
1023020057 7:36003909-36003931 GAGTTCAGCCAGGTGGACTGTGG + Intergenic
1024430512 7:49282975-49282997 GATTTCAGACAGATGGAATGAGG + Intergenic
1028512507 7:91640872-91640894 GAGTAAAGTCAGATTGTCTGGGG - Intergenic
1029316784 7:99723177-99723199 GGGTACATCCAGATGGCCTGAGG + Intronic
1029317721 7:99729535-99729557 GTGTACATCCAGATGGCCTGAGG + Intronic
1030167171 7:106566900-106566922 AAGTACAGAGAGCTGGACAGAGG - Intergenic
1030191570 7:106815811-106815833 GAGTAGAGGAAAATGGACTGTGG - Intergenic
1032196102 7:129789405-129789427 GGGGACAGAGAGATGGACTCGGG - Intergenic
1033538570 7:142334815-142334837 GAGCAGAAACAGATGGACAGTGG - Intergenic
1036749517 8:11435034-11435056 GAGTGGAGACAGATTGAGTGAGG - Exonic
1038075363 8:24067032-24067054 GAGTAGATAGAAATGGACTGAGG - Intergenic
1040741024 8:50575907-50575929 GAATACAGACAGAGGGAAAGAGG - Intronic
1046178403 8:110609907-110609929 GACTAGAAACAGATGAACTGAGG + Intergenic
1047771734 8:128035404-128035426 GAGCAGAGACAGATGGGCTCAGG - Intergenic
1047841122 8:128754465-128754487 GACATCAGACAGAGGGACTGAGG + Intergenic
1049036692 8:140081838-140081860 GAGGACAGAGATATGGACTGAGG - Intronic
1051151666 9:14086277-14086299 GTGTACTGAGAGATGGACAGGGG - Intronic
1051233703 9:14977831-14977853 GGGGACAGACAAATGGACTCTGG + Intergenic
1052247540 9:26354684-26354706 GAATACATACAAATGGACTATGG + Intergenic
1053078023 9:35151546-35151568 CTGTACATCCAGATGGACTGAGG - Intergenic
1055920741 9:81457996-81458018 GAAGACAGACAGAAGTACTGTGG - Intergenic
1057036984 9:91818401-91818423 GAGTACAGGGAGATAGCCTGTGG - Intronic
1057195638 9:93114561-93114583 GGGTGCACACAGATGGACAGGGG - Intergenic
1057336347 9:94158555-94158577 ACGAACAGACAGATGAACTGAGG + Intergenic
1058731186 9:107851378-107851400 GAGCACACACAGGAGGACTGGGG + Intergenic
1060062909 9:120476736-120476758 GTGTACAGACACATGGACAGAGG + Intronic
1061720612 9:132548736-132548758 GTGTACAGAGACAAGGACTGTGG - Intronic
1192198785 X:69050311-69050333 GATTTGAGACAGATGGAATGTGG + Intergenic
1195685364 X:107580221-107580243 GAGTACAGAGGGATAGACTAGGG + Intronic
1197218268 X:123887351-123887373 GAGTACTTTCAAATGGACTGTGG + Intronic
1198798383 X:140424267-140424289 GAGTATAGACAGATGGGTTTTGG - Intergenic
1199019992 X:142868173-142868195 GAGAGCATGCAGATGGACTGGGG + Intergenic