ID: 964581291

View in Genome Browser
Species Human (GRCh38)
Location 3:158241415-158241437
Sequence CTCCAGTAGCACTCTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964581287_964581291 20 Left 964581287 3:158241372-158241394 CCAGGAGGCAGAAGCTGCAGTGA 0: 144
1: 6363
2: 62244
3: 119296
4: 164415
Right 964581291 3:158241415-158241437 CTCCAGTAGCACTCTGGCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 148
964581286_964581291 21 Left 964581286 3:158241371-158241393 CCCAGGAGGCAGAAGCTGCAGTG 0: 83
1: 3998
2: 41757
3: 124353
4: 194995
Right 964581291 3:158241415-158241437 CTCCAGTAGCACTCTGGCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964581291 Original CRISPR CTCCAGTAGCACTCTGGCTG GGG Intronic
904716159 1:32469152-32469174 CACCATTTGCACTCTGGCTTGGG + Intronic
911871101 1:103100450-103100472 CTCCACTACCACTGAGGCTGAGG + Intronic
911902043 1:103518812-103518834 CTGCACTAGCACTCTCGCTTTGG - Intergenic
912968525 1:114258558-114258580 CTACAGTAGCCCTCAGGCTGAGG + Intergenic
916364588 1:164010505-164010527 TTCCATTAGCATTCTGGGTGAGG - Intergenic
921280073 1:213557680-213557702 CTCCATTTGTACTGTGGCTGAGG + Intergenic
922226632 1:223651102-223651124 CTCCAGTAGGACACTGAGTGTGG + Intronic
922701578 1:227764236-227764258 CTCCACGAGCACTGTGGCTCTGG + Intronic
1063083556 10:2791514-2791536 ATCCACTAGCACATTGGCTGTGG + Intergenic
1070925516 10:80218705-80218727 CTCCAGGCGCTCTCTGCCTGGGG - Intergenic
1072360242 10:94652470-94652492 CTCATGTAGCACTCTGGCACTGG + Intergenic
1072728446 10:97829011-97829033 ATCCAGCATCTCTCTGGCTGTGG + Intergenic
1073326598 10:102646905-102646927 CTACAGCAGCACTGTGGGTGCGG - Intronic
1075942032 10:126398131-126398153 CTGCAGCATCACTCTGGGTGGGG + Intergenic
1076103084 10:127797997-127798019 CTCCTGTAATACCCTGGCTGTGG + Intergenic
1076181743 10:128414706-128414728 CTCCAGGGGCACCCTGGGTGTGG + Intergenic
1076260723 10:129063356-129063378 CTCCAATAGCACACTAGCTGGGG + Intergenic
1077023388 11:429636-429658 CTCCAGGAACACCGTGGCTGCGG + Exonic
1078729557 11:13963016-13963038 CTGCAGTAGCCCTCTGACTTGGG - Exonic
1084362961 11:68680985-68681007 AGCCATTAGCACACTGGCTGTGG + Intergenic
1084640304 11:70421880-70421902 CTCCAGCAGCATTCTGCCCGAGG + Intronic
1086520578 11:87663898-87663920 CTCATGTGGCACTGTGGCTGAGG - Intergenic
1087770496 11:102204423-102204445 CTCCTGTGGCACTCAGTCTGAGG + Intronic
1089287274 11:117415692-117415714 CTCCAGCAGCCCTCTGGATGAGG - Intergenic
1091588590 12:1829772-1829794 CTCCATCAGTTCTCTGGCTGGGG + Intronic
1091799676 12:3316965-3316987 CTCCAGCAGCACTGTCGCAGCGG - Intergenic
1092156152 12:6282704-6282726 TTCCAGAATCACTCTGGCTGGGG - Intergenic
1092504276 12:9079752-9079774 CTCCAGATGCCCTATGGCTGTGG - Exonic
1096630636 12:52924786-52924808 CTCCAGGAGCCCTTTAGCTGAGG - Intronic
1100980056 12:100156688-100156710 CTCCAGGAGCACCCAGGCTTGGG - Intergenic
1101023186 12:100573854-100573876 CTCCTGGAGCCCTCAGGCTGAGG - Intronic
1101727544 12:107400742-107400764 CTCAGGTAGCACTCTTGCGGGGG - Intronic
1102769636 12:115464081-115464103 CTCCTGTAGCCCTCTGACTCTGG - Intergenic
1103041254 12:117697308-117697330 CTCCAGAAGCCCTCTGGGGGTGG - Intronic
1104808530 12:131605215-131605237 CCCCACTACCACTCTGCCTGTGG - Intergenic
1104948150 12:132426507-132426529 CTCCAGGTGCCCTGTGGCTGCGG + Intergenic
1106173619 13:27309530-27309552 CACCAGCAGCAATCTGGGTGTGG + Intergenic
1109109078 13:58292937-58292959 CCCCAGTAGGACTCTGTGTGTGG - Intergenic
1110506016 13:76287062-76287084 CACCAGTAACTCACTGGCTGAGG - Intergenic
1112218289 13:97459503-97459525 CTCCTGCAGGACTCTGGCAGTGG - Intronic
1114353261 14:21878193-21878215 CTCACGGAGGACTCTGGCTGGGG - Intergenic
1119322808 14:73741667-73741689 CTCCAGGAGCACAGGGGCTGGGG - Intronic
1120380985 14:83779404-83779426 ATCCAGTTGCACCCTGGCTCAGG - Intergenic
1202836991 14_GL000009v2_random:85741-85763 CTCCAGAAGCACCCTTGCAGTGG - Intergenic
1125314551 15:38417258-38417280 CTCCAGTCCCACTTTGGCAGGGG - Intergenic
1131794366 15:95999309-95999331 CTCCAATACCACTTTGGCAGTGG + Intergenic
1132847706 16:2008112-2008134 CTCCAGGAGCTCTGTGGCTGGGG - Intronic
1132958096 16:2607032-2607054 CTCCAGCAGGACTGTGGCTGTGG + Intergenic
1132970570 16:2686280-2686302 CTCCAGCAGGACTGTGGCTGTGG + Intronic
1133448125 16:5879835-5879857 CTCCACTATCACTCTGGCAGGGG + Intergenic
1133504558 16:6398871-6398893 CTCCAGTGGGACTCTGTCTGGGG + Intronic
1133511497 16:6462227-6462249 CTCCAGTCTCACTCTGGGAGGGG + Intronic
1135864602 16:26089625-26089647 TTCCTGAAGCACTCTGCCTGTGG - Intronic
1136118176 16:28108935-28108957 CTCCAGTGTCACTGTGACTGGGG - Intronic
1136142746 16:28297932-28297954 CTCTTCTAGCACTCTGCCTGAGG + Intronic
1138081205 16:54093070-54093092 CTCCAGGAACACTCTTGCTCTGG - Intronic
1140350077 16:74253760-74253782 CTCCAGCAGCCCTAAGGCTGCGG + Intergenic
1141111598 16:81275132-81275154 CTCCAGTAAACCTCTGGATGGGG - Intronic
1142807999 17:2381552-2381574 GACCAGTAGCACTCGGGTTGGGG - Intergenic
1143688812 17:8542749-8542771 CTCCACTGTCACTCAGGCTGTGG + Intronic
1148438397 17:47699246-47699268 CTCCTGTTTCACTCTGGCTCTGG + Intronic
1149305112 17:55339934-55339956 CCCCAGTAGCAATGTGGCAGAGG + Intergenic
1150330293 17:64288720-64288742 TTCCAACAGCACTTTGGCTGAGG - Intergenic
1151744171 17:76002645-76002667 CCCCAGTAGGACCCTGCCTGTGG - Intronic
1152558675 17:81067190-81067212 CTACAGTAGGACTCCGGCAGGGG + Intronic
1156428989 18:37050112-37050134 CTCCAGTAACAATCAGGCTCAGG - Intronic
1158829261 18:61259995-61260017 CACCAGTAACACTCTGACCGAGG + Intergenic
1161220534 19:3116100-3116122 CTCCAGGTCCACTGTGGCTGGGG + Intronic
1162016963 19:7851277-7851299 CTCCCTCAGCACTCTGTCTGAGG - Intronic
1162934179 19:13972931-13972953 CTCCACCAGCACTGGGGCTGGGG - Exonic
1163864110 19:19757947-19757969 CTCCAGTGGGACTCTGTGTGGGG + Intergenic
1165162651 19:33826874-33826896 CTCCTGTAGCTCTCTGCCTGAGG + Intergenic
1167151336 19:47712013-47712035 CTCCAGGATCACCCTGGCTAAGG - Intergenic
1168645676 19:58057572-58057594 CTCCAGTGCCACCCTTGCTGTGG - Intergenic
1202635647 1_KI270706v1_random:41609-41631 CTCCAGAAGCACCCTTGCAGTGG + Intergenic
926241668 2:11093605-11093627 GGCCAGTCACACTCTGGCTGTGG + Intergenic
926579507 2:14619216-14619238 TCCCAGTAGCTCTCTGGGTGGGG - Intergenic
930838982 2:55825326-55825348 CTCCTGTTGCCCTCAGGCTGAGG + Intergenic
933656243 2:84889212-84889234 CACCACCAGCACTGTGGCTGTGG - Intronic
933695316 2:85213129-85213151 CTCCAGTTTCCCTGTGGCTGGGG + Intronic
933733524 2:85476814-85476836 CTCCAGCAATCCTCTGGCTGAGG + Intergenic
933834628 2:86235760-86235782 CTCCAATATCACACTGGCAGTGG + Intronic
935499721 2:103823827-103823849 ATCCACAAGCACTCTGCCTGAGG + Intergenic
935870418 2:107442157-107442179 TTCCAGTATCACTCTGAATGTGG + Intergenic
936058955 2:109282090-109282112 CTCTAGTTGCATTCTGGCTCAGG + Intronic
937160755 2:119759410-119759432 CTCCAGGAGCACTGAGGTTGGGG + Intergenic
937441204 2:121917692-121917714 CCCCAGTAGCAGCCTGACTGTGG + Intergenic
943313251 2:186353604-186353626 CCCCAGTAGGACTCTGTGTGTGG - Intergenic
946023771 2:216659603-216659625 CCACAGTCTCACTCTGGCTGAGG - Intronic
948191760 2:236064617-236064639 TGCCAGTAGCACTCCTGCTGAGG + Intronic
948360858 2:237419141-237419163 CCCCAGCTGCCCTCTGGCTGTGG - Intergenic
1180365066 22:11931617-11931639 CTCCAGAAGCACCCTTGCAGTGG - Intergenic
1181668092 22:24412203-24412225 CTCCAGTGGCCCTCTGGGTAGGG - Intronic
1182572860 22:31251859-31251881 CTCCAGGTGCCCTCAGGCTGTGG + Intronic
1182702677 22:32253272-32253294 CTGCAGTGGGACCCTGGCTGAGG + Intronic
1183689069 22:39377952-39377974 CTCCAGGAGCCCACAGGCTGGGG + Intronic
950313967 3:11984081-11984103 CCTCAGAAGCACCCTGGCTGTGG + Intergenic
952224480 3:31361118-31361140 TTAAAGGAGCACTCTGGCTGTGG + Intergenic
957654233 3:83051574-83051596 CTCCAGTGGCAGTCTGACTTCGG + Intergenic
963713661 3:148777397-148777419 CTCCAGTAGCCCCAAGGCTGCGG - Intergenic
964426754 3:156561942-156561964 CCCCAGTAGGACTCTGTGTGGGG - Intergenic
964581291 3:158241415-158241437 CTCCAGTAGCACTCTGGCTGGGG + Intronic
964951264 3:162296721-162296743 GTCCAGAAGCTCTCTGCCTGAGG + Intergenic
971831825 4:31704766-31704788 CCCCAGTAGGACTCTGTGTGGGG + Intergenic
972267596 4:37477744-37477766 CTACAGTAGCAGTCTTCCTGTGG + Intronic
974921105 4:68240254-68240276 CTGCTGTAGGACTCTGGCTTAGG - Intronic
977430533 4:96926521-96926543 CTCCAGTAGAGCTCTGGCATTGG + Intergenic
978622401 4:110646082-110646104 CTCAAGTAGCACTCATGGTGAGG - Intergenic
978665120 4:111173094-111173116 CTCCAAAAGCAATTTGGCTGTGG + Intergenic
978712386 4:111800068-111800090 CACCACCACCACTCTGGCTGAGG - Intergenic
980403205 4:132320751-132320773 CTCCAATAATTCTCTGGCTGTGG - Intergenic
981308106 4:143267960-143267982 CCCCAGTAGGACTCTGTGTGGGG - Intergenic
981535313 4:145793926-145793948 CTCCAGTGAAACTCTGACTGGGG + Intronic
985801401 5:2007275-2007297 CTCCAGGTGAACTCTGGGTGTGG + Intergenic
986024585 5:3838677-3838699 CTCCAGGTGCCCTTTGGCTGTGG - Intergenic
986741814 5:10711375-10711397 CTCCAGTCCCACCCTGTCTGAGG - Intronic
989234526 5:39130590-39130612 CTCCACTTCCACTCTGACTGTGG + Exonic
994291603 5:98033676-98033698 CTCCTGTAGAACTCTGGCATTGG - Intergenic
998349408 5:141491213-141491235 AACCAGCAGCACTGTGGCTGTGG - Exonic
999384578 5:151145191-151145213 CTCCAGCAGCAGCCTGGGTGGGG - Intronic
1003570126 6:7250539-7250561 CCCCAGCAGCAGGCTGGCTGGGG - Exonic
1004880902 6:20007223-20007245 CTCCAACAGCAATCTGGCAGAGG - Intergenic
1006175656 6:32119922-32119944 CTCGAATAGCACCCTGGATGAGG + Exonic
1007234749 6:40382506-40382528 CTCCAGTGCCAGTCTAGCTGGGG - Intergenic
1007247548 6:40473225-40473247 CTTCACAAGCAGTCTGGCTGAGG - Intronic
1008602224 6:53107423-53107445 CTAGAGTAGCACTCAGGCTTTGG + Intergenic
1012073262 6:94650673-94650695 CTGCAATAGCACACTGGCTCTGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1018648692 6:165972619-165972641 CTCCAGTGGCACTGAGGCTCGGG + Intronic
1018678716 6:166245235-166245257 ATCCAGTAACACTCTGGCCCAGG - Intergenic
1018747824 6:166776043-166776065 CTCCAGCACCGCTGTGGCTGGGG - Intronic
1018861439 6:167713175-167713197 CTCTATTTGCACTGTGGCTGAGG + Intergenic
1019815227 7:3195061-3195083 CTGCAGTAGCACACTGCCGGTGG - Intergenic
1020093358 7:5353788-5353810 CTCCAGCAGGACGGTGGCTGTGG - Intronic
1022523050 7:31020127-31020149 CTTCTGTAGCTCTCTGACTGAGG - Intergenic
1023688771 7:42764469-42764491 CTTCAGGATCACTCTGGGTGAGG + Intergenic
1024232124 7:47370737-47370759 CACCAGCAGCTCCCTGGCTGTGG - Intronic
1027233806 7:76286422-76286444 CTGCAGGAGGACCCTGGCTGAGG + Exonic
1028517986 7:91698951-91698973 CTGAAGAAGCAGTCTGGCTGTGG - Intronic
1033611833 7:142970691-142970713 CTCCAATGACACTATGGCTGGGG - Intergenic
1034528972 7:151683741-151683763 CTCCTGTCCCTCTCTGGCTGTGG - Intronic
1035718984 8:1776827-1776849 CTTCAGTAGGACTCAGTCTGAGG - Intronic
1036525862 8:9534177-9534199 TTCCAGTAGCACACGGGCTTGGG + Intergenic
1036747213 8:11418298-11418320 CTCCACTCGCACTCTGCCGGGGG + Intronic
1037821030 8:22134602-22134624 CTCCAGTTGCACACTGGAGGGGG - Intergenic
1040835939 8:51731562-51731584 CTCCACTAGGACTCTGTGTGGGG + Intronic
1042085983 8:65109203-65109225 CTGCAGTAGCACAATGTCTGGGG - Intergenic
1045669877 8:104538484-104538506 CTCCAGAAGCTTTATGGCTGAGG - Intronic
1045995631 8:108358722-108358744 CCCCAGTAGGACTCTGTGTGGGG + Intronic
1047333748 8:123916859-123916881 CTGCAGTAGCACCACGGCTGGGG + Intronic
1048504422 8:135007955-135007977 CTCCATTCCCACTCTGGCTGTGG + Intergenic
1051238456 9:15026071-15026093 CTCCAATAGAACTCCAGCTGAGG + Intergenic
1051822155 9:21181039-21181061 CCCCAGCAGCCCTCTGGCTGGGG + Intergenic
1051823388 9:21193101-21193123 CCCCAGCAGCCCTCCGGCTGGGG + Intergenic
1051827191 9:21233698-21233720 CCCCAGCAGCCCTCTGGCTGGGG + Intronic
1052024106 9:23556130-23556152 CCCCAGTGGCTCTCTGCCTGAGG + Intergenic
1056409882 9:86314639-86314661 CACCAGTGGCACCCTGGCTGAGG + Intronic
1061806683 9:133140920-133140942 CTCCTGTGGCACTCCAGCTGGGG + Intronic
1062245789 9:135565404-135565426 CTCCACCAGGACTCTGGCTGTGG - Exonic
1190382331 X:49851948-49851970 CTGCAGCAGCCATCTGGCTGGGG - Intergenic
1192085056 X:68087753-68087775 CTCCATTTACACTCTGGCTAAGG + Intronic
1192399895 X:70824576-70824598 CTGCAGTTGCACTGTGACTGGGG - Intronic
1197904643 X:131412172-131412194 CTCTAACAGCACTCGGGCTGGGG + Intergenic
1197986501 X:132271456-132271478 CTCCTGTCTCACTCTGGGTGTGG - Intergenic
1199944961 X:152658063-152658085 CTCCAGTATCACTCTGGGTTGGG + Intergenic