ID: 964583008

View in Genome Browser
Species Human (GRCh38)
Location 3:158260866-158260888
Sequence AGGGAAAGTACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 9, 2: 75, 3: 162, 4: 409}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964583008_964583016 14 Left 964583008 3:158260866-158260888 CCCACAATCACTGTACTTTCCCT 0: 1
1: 9
2: 75
3: 162
4: 409
Right 964583016 3:158260903-158260925 GATTCTGTCTCTGCACCACATGG 0: 3
1: 6
2: 12
3: 52
4: 263
964583008_964583020 27 Left 964583008 3:158260866-158260888 CCCACAATCACTGTACTTTCCCT 0: 1
1: 9
2: 75
3: 162
4: 409
Right 964583020 3:158260916-158260938 CACCACATGGCTGCTGCTGGGGG 0: 3
1: 0
2: 26
3: 86
4: 577
964583008_964583018 25 Left 964583008 3:158260866-158260888 CCCACAATCACTGTACTTTCCCT 0: 1
1: 9
2: 75
3: 162
4: 409
Right 964583018 3:158260914-158260936 TGCACCACATGGCTGCTGCTGGG 0: 2
1: 6
2: 21
3: 80
4: 295
964583008_964583019 26 Left 964583008 3:158260866-158260888 CCCACAATCACTGTACTTTCCCT 0: 1
1: 9
2: 75
3: 162
4: 409
Right 964583019 3:158260915-158260937 GCACCACATGGCTGCTGCTGGGG 0: 2
1: 8
2: 22
3: 85
4: 390
964583008_964583017 24 Left 964583008 3:158260866-158260888 CCCACAATCACTGTACTTTCCCT 0: 1
1: 9
2: 75
3: 162
4: 409
Right 964583017 3:158260913-158260935 CTGCACCACATGGCTGCTGCTGG 0: 2
1: 6
2: 21
3: 68
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964583008 Original CRISPR AGGGAAAGTACAGTGATTGT GGG (reversed) Intronic
900759652 1:4462232-4462254 AAGGAAAGTAAAGTGAGTGGTGG - Intergenic
901524066 1:9808209-9808231 ATGGAAAATACAGTATTTGTGGG - Intronic
903291531 1:22317386-22317408 AGGGCAGAAACAGTGATTGTGGG + Intergenic
903850543 1:26303158-26303180 TGGGAAAGTACTGTGAGGGTGGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907023635 1:51094212-51094234 AGGAAAAGTGTAGTGATTTTGGG + Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909663707 1:78111089-78111111 ATGGAAAGTACAGAAACTGTTGG + Intronic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910087192 1:83417553-83417575 AGGAAAAGTACAGAGATTGGAGG - Intergenic
910102608 1:83594545-83594567 TGGGAAAATTCAGTAATTGTAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
912179687 1:107204800-107204822 AGGGTATGTACAGAGATTGCAGG - Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915979765 1:160412765-160412787 AGGGAAACTATAATGACTGTAGG - Intronic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919471763 1:197988027-197988049 AGGGAAAGTAAAGTGGGTCTAGG + Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
919920231 1:202162887-202162909 AGAGAAAGTATAGTAATAGTTGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921769648 1:219021483-219021505 AGGAAAAGTTCAGTAATTTTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922275216 1:224071242-224071264 TCGGAAAGTACTGTGATTGCAGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923384204 1:233450254-233450276 AGGTAAAGTACAAGCATTGTAGG + Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1064717279 10:18189879-18189901 AGGCAAAGAAAAGTGATTGTTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069187353 10:65441294-65441316 AGGAAAAGTACAGCTATTATTGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070409963 10:76130569-76130591 AGGGAAAGCATATTGTTTGTAGG + Intronic
1071768341 10:88695690-88695712 AGGGTAAGTAAATTGATAGTTGG + Intergenic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073680767 10:105701096-105701118 AGGGAAATAACAGTGTTTGCTGG + Intergenic
1073766075 10:106684396-106684418 AGGGAAAGCACAGTGTTTAATGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1076579802 10:131499764-131499786 AGGTAAAGTCCAGTGGGTGTGGG - Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1077928049 11:6702061-6702083 AGAGAAGGTACAGTGATTAGAGG + Intergenic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078244718 11:9563618-9563640 AGGGCAAGTGCAGCTATTGTGGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1078821806 11:14890917-14890939 AGGAAAAGTACAGGGATGTTTGG - Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080113085 11:28591717-28591739 AGAGAATGTACAGTGAGTGTAGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081589595 11:44411991-44412013 AGGGAAAATAAAGAGATTATAGG - Intergenic
1083514645 11:63245318-63245340 ATGGAAAGTAAAGTTATTGCGGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1084936112 11:72587593-72587615 AGGGAAGGTAGAGTGAATGGGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086278778 11:85161664-85161686 AGCTAAAGAACTGTGATTGTGGG + Intronic
1086448303 11:86890811-86890833 AGAGAAAGTCCAGTGGTGGTGGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088074785 11:105833941-105833963 AGGCATAGTAAAATGATTGTAGG - Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088629605 11:111761970-111761992 AGGTAAAGTACAGAGATGGTAGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090923093 11:131224482-131224504 AGGGATAATACAGGGATTGCAGG + Intergenic
1091655964 12:2347227-2347249 GGGGAAAGTGCAGTGTTCGTGGG - Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092797037 12:12121985-12122007 AGGGAAATTGCTGTGATTGGGGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095397739 12:41779878-41779900 AGTGAAGGTACAGTGATGGTGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096252895 12:50044694-50044716 AGGGAAGATAAAGTGATGGTGGG - Intergenic
1098060201 12:66553750-66553772 AGGAAAAGTGCTGTGATTTTGGG + Intronic
1098624769 12:72650642-72650664 AGGAAATGTACATTGATTGATGG + Intronic
1098976765 12:76910560-76910582 AGAGAAAGTACAGAGAGTGAAGG - Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099781570 12:87202330-87202352 TGAGATAATACAGTGATTGTGGG + Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1104230678 12:126880991-126881013 AGGGAAAGACCAGGGATTGGTGG - Intergenic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1105601659 13:21893225-21893247 AGGGAAAATCAAGTGATGGTGGG + Intergenic
1105977878 13:25489289-25489311 AGGGAAAGTGCCGTGATTAAAGG - Intronic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108961281 13:56234293-56234315 AGAGGAAGGACAGTGATTGAAGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110409414 13:75187324-75187346 AGAGAAAGTAGTTTGATTGTAGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112362580 13:98730722-98730744 AGGGGAAATTCAGTGTTTGTGGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115426075 14:33260844-33260866 AGGCAAAATATAGTCATTGTAGG - Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117346990 14:54842493-54842515 AGTTTAAGTACAGTGATGGTTGG - Exonic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117608164 14:57453500-57453522 ATGGAAAATACAGTGTTTGCAGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1119647622 14:76359721-76359743 AGGGAAAGCAGAGGGCTTGTGGG + Intronic
1120344522 14:83268772-83268794 AAAGAAAGAACAGTGAGTGTGGG - Intergenic
1120894401 14:89516908-89516930 AGGCTAAGAACAGTGACTGTTGG - Intronic
1121634838 14:95446833-95446855 GGGGCAAGAAGAGTGATTGTAGG - Intronic
1122145456 14:99685963-99685985 AGGAAAATTACAGTGATTTCAGG - Intronic
1124348595 15:28939037-28939059 AGGGAAAGTAGAGTGGTGGCTGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129665186 15:77575668-77575690 AGGGAAAGTGCTGAGCTTGTTGG - Intergenic
1130058459 15:80551092-80551114 ATCGAAAATACAGTGAGTGTTGG - Intronic
1131098730 15:89671952-89671974 AGGGAAAGAACGGTACTTGTTGG - Intronic
1131646657 15:94352121-94352143 AGGGAATGTACTGTCATTGCTGG - Intronic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132148268 15:99441469-99441491 AGGAGAAGGAAAGTGATTGTGGG - Intergenic
1132395241 15:101468182-101468204 AGGGAAAGTACCTAGTTTGTGGG + Intronic
1132589079 16:718519-718541 AGAGAAAGGACCGTGTTTGTGGG - Exonic
1132950569 16:2560012-2560034 GGGGAAAGGACAGTGATAGGAGG + Intronic
1132963780 16:2640158-2640180 GGGGAAAGGACAGTGATAGGAGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1137329850 16:47482324-47482346 AAGGACAGTACAGAGTTTGTAGG - Intronic
1137839009 16:51622573-51622595 AGGGAAAGCACACTGCTTTTAGG + Intergenic
1138344153 16:56309595-56309617 TGGGAATGTACAGTGCTTGCAGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139286744 16:65821992-65822014 AGGGAAAGGACTGTGAGTTTAGG + Intergenic
1140693833 16:77511976-77511998 AGGGACTGTCCTGTGATTGTAGG - Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144084858 17:11799324-11799346 AGGGAAAGTAAAGACATGGTAGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145797068 17:27661809-27661831 AGGGAAAGTGCAGGGCTTCTCGG - Intergenic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146260537 17:31417418-31417440 GGGGAAAGGACAGTGCCTGTGGG - Intronic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148293571 17:46478882-46478904 AGGGATGGTAGAGAGATTGTGGG + Intergenic
1148315757 17:46696584-46696606 AGGGATGGTAGAGAGATTGTGGG + Intronic
1148498954 17:48074384-48074406 AGGAAAATTACAGAGATTGTTGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149677641 17:58480167-58480189 AGGGTAAGTACTGTGGTCGTGGG + Exonic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150783422 17:68142526-68142548 TGCAAAAGTACAGTGATTCTTGG - Intergenic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153201193 18:2649414-2649436 AGGGCAAGGAAAGTGATTTTGGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155156538 18:23162542-23162564 AGGGAACTTACAGTCCTTGTAGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156625579 18:38903603-38903625 TGAGAAAGTACAGGGATTATTGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158874566 18:61720719-61720741 AGTGAAAGTACAGAGATTTATGG - Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159339797 18:67119809-67119831 ACGGAAAGCTCAGTGATTGGGGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1166816972 19:45552167-45552189 AGGGAAGGTACAATGATTCCAGG + Intronic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
924958598 2:12706-12728 AGGAAAACTACAGCCATTGTGGG + Intergenic
925194883 2:1914832-1914854 ATGGAAAAGACAGTGGTTGTGGG - Intronic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925570229 2:5302671-5302693 AGGGAAACTACCGTAATTGTGGG + Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925870812 2:8268693-8268715 AGGGAAAGTGCAGGCATTGCTGG - Intergenic
926000449 2:9327369-9327391 AAGGAAAATAATGTGATTGTTGG - Intronic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927291290 2:21407500-21407522 AGAGAAAGTACAGTCATTCATGG - Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932639830 2:73433130-73433152 AGGGAAAGTAAAAGGATTGGAGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934039809 2:88118414-88118436 AGAGTAAGTACAGTGATTGGTGG - Intergenic
934917675 2:98313379-98313401 AGGCAAGGAACAGTGCTTGTGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
935964486 2:108460256-108460278 AGGGAAAGTGCATTTTTTGTGGG + Intronic
936498312 2:113042612-113042634 AAGGAAAGTACACTGAGTGAAGG - Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940559959 2:155282274-155282296 AGGAGAAGTGCAGTGATTATGGG - Intergenic
940595925 2:155792965-155792987 AGGGAAAATACAGAGAATGGTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940839229 2:158559853-158559875 AGGGCCAGTACAGGGATGGTGGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
944976089 2:205052986-205053008 AGGGAAAATACAGTGTTCTTTGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947195910 2:227567566-227567588 AGAGAAAGTCCAGTGTTTATAGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172438864 20:34951355-34951377 AGAGAAGGTAGAGTGATTATGGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174120556 20:48262035-48262057 AGGTAAAGTACACGGATTTTTGG + Intergenic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1174845689 20:53941004-53941026 AGGGAAAGGACACAGATTCTTGG + Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177222330 21:18210291-18210313 AGGGGAAGTGCCGTGATTGTGGG - Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178170739 21:30036907-30036929 AGTGTAAGAACAGTGATGGTTGG - Intergenic
1179570227 21:42274188-42274210 AGGGAAAATACAGGGAAGGTGGG + Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
949151968 3:780015-780037 ATGGAAATTACAGTGTTGGTGGG - Intergenic
949251471 3:1989554-1989576 ATGGAAAGCACATGGATTGTTGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952677161 3:36046667-36046689 AGACAAAATACAGGGATTGTGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
955510610 3:59676847-59676869 ATGGAAAATACAGTGATAGAGGG - Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955688150 3:61564552-61564574 AGGGAAAGGACAGTGGTGGGAGG + Intronic
955870292 3:63431572-63431594 AGGAAAAGTAGAGTCATGGTTGG + Intronic
956221549 3:66909367-66909389 TGAGAAAGTACAGTGATAGTTGG + Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
958818075 3:98939733-98939755 AGAGAAAGTACAGAGGTTTTTGG + Intergenic
958865387 3:99495118-99495140 ACGAAAAGTTCAGTGATTGATGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961033652 3:123627377-123627399 CATGAAAGTTCAGTGATTGTCGG - Intronic
961044194 3:123697636-123697658 GTGGACAGTACAGTCATTGTTGG + Intronic
961161521 3:124730642-124730664 AGGGAAAGGACAGGGCTTGGTGG + Intronic
961244537 3:125440208-125440230 AGGGGAAGTACAGGGAGTTTTGG + Intergenic
961349431 3:126290289-126290311 AGGGAAAGCACAGGGATGCTTGG + Intergenic
962106727 3:132397374-132397396 AGTGAAAATAAAGTGATTGGAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963701282 3:148629986-148630008 AGGAAAAGCAAAGTGATTATGGG + Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
970920768 4:21391781-21391803 AGGGAAAGGAATGTGATTGCAGG - Intronic
970924604 4:21436505-21436527 AGGGAATGTGTAGTGATTTTTGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974461151 4:62189634-62189656 AGGGAAATTAAAATGATTATTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975808823 4:78142642-78142664 AGGTAAAGTTAAATGATTGTTGG + Intronic
976684166 4:87792512-87792534 AGGTACATTACAGTGAGTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
976748328 4:88428391-88428413 ATGGAAGGTGGAGTGATTGTAGG - Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982502780 4:156178809-156178831 AGAGAAAGTAAAGTGTTTGTAGG + Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983276538 4:165624377-165624399 AGAGAAAGTACTGTGATTTGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983671677 4:170245552-170245574 AGGGAAGGTGCCGTGCTTGTGGG + Intergenic
985124652 4:186681086-186681108 AGGGAAACAAGAGTGAATGTAGG + Intronic
985187256 4:187331120-187331142 AGAAAAAGAACAATGATTGTGGG + Intergenic
985487367 5:158980-159002 AGGGAAACTAAAGTGACTGCTGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993535084 5:89074235-89074257 AGATAAAGTACAGTGACTGGAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994013415 5:94936461-94936483 AGGGAACATACATTGCTTGTTGG + Intronic
994226050 5:97253171-97253193 AGGGAAAGTACAATTACTGGGGG + Intergenic
994310750 5:98267706-98267728 AGGAAAAGTGCAGCGGTTGTGGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994413850 5:99443134-99443156 AGAAAAACTACAGTGGTTGTGGG + Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994640369 5:102401040-102401062 AGGAAAAGTACAGGGAATATTGG + Intronic
994793642 5:104265071-104265093 AGAGAAACTACATTGATGGTTGG + Intergenic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995614354 5:113944306-113944328 AGTGAAAGCACAGTGAATGCTGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998751352 5:145324896-145324918 AGGGAAAGCAAAGTATTTGTAGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999953292 5:156672979-156673001 AGGGGAAGTACAGTGAGCCTAGG - Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001141059 5:169144371-169144393 AGGAAAAGTACAGAGACTATGGG - Intronic
1003900790 6:10653629-10653651 ATGGAAAATACAGTATTTGTGGG - Intergenic
1004989971 6:21125865-21125887 CGGGGAAGCACAGAGATTGTGGG - Intronic
1005524141 6:26629032-26629054 ATGGAAAATACAGTATTTGTGGG + Intergenic
1006126512 6:31842220-31842242 AGTGAAAGTGCTGTGATTCTAGG + Intergenic
1008090407 6:47288372-47288394 AGAGAAGGTACAGTGATTAGAGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008333070 6:50265673-50265695 AAGGAAAGTACAATCATTATGGG + Intergenic
1008744593 6:54654306-54654328 AGGGAAAATACAGTTATTTAAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009744737 6:67798298-67798320 AGGGAAATTGGAGTGGTTGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088792 6:71953617-71953639 AGGGAAAGTACAGTGGTAATGGG - Intronic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011479046 6:87776128-87776150 AGGGAAAGTGCAGTGTGTTTAGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1014959487 6:127665149-127665171 TGGGAAAGTACAGTAAATCTGGG - Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018696311 6:166394204-166394226 TGGGAAAGTACAGTATCTGTGGG + Intergenic
1019025575 6:168960050-168960072 AGGGAAAATACAGAGTTTGAAGG - Intergenic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021179599 7:17490201-17490223 AGGGAAAGGACAGTCAGTCTAGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023227052 7:37981648-37981670 AAAAAAAGTACAGTCATTGTAGG + Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027304066 7:76874035-76874057 AGGAAAAGTACAGAGATTGGAGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027889738 7:83956543-83956565 AAGGAAGGTAAAGAGATTGTGGG + Exonic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030079118 7:105762277-105762299 AGGAAAAGAACAGGGATTGAAGG - Intronic
1030257852 7:107530803-107530825 AGGGAAAGGAAATTGATTGGAGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032699421 7:134365752-134365774 AGGGTAAGTAGAGAGATGGTTGG + Intergenic
1032989481 7:137376318-137376340 AGAGAAAGAACAGTAATTTTAGG - Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034878215 7:154743885-154743907 ATGGAAAGTACAGTATTTGAGGG - Intronic
1034887439 7:154808699-154808721 TGGGAAATTACAGGGATTGACGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1036225441 8:6953949-6953971 GGGGAAGGTCCAGTGGTTGTGGG + Intergenic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038754546 8:30328392-30328414 AGGGAAAGTGCAGAGATCCTAGG - Intergenic
1039597608 8:38804981-38805003 AGGGCAATTAAAGTGATTTTTGG + Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1040991986 8:53362051-53362073 GGGGAAAGGACAGTCAGTGTAGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041979915 8:63845896-63845918 AGGGAAAGTCCAGTGATAACGGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043488210 8:80719904-80719926 ATGGAAAGTACCGAGATTGATGG + Intronic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047031985 8:120891906-120891928 AGGGAAAGTGAAATGGTTGTGGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051497209 9:17736796-17736818 ATGAAAAGTACAGTAATTGACGG - Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052246116 9:26337407-26337429 AAGGGAAGTTCAGTGGTTGTTGG + Intergenic
1052500743 9:29286195-29286217 AGGGGTTGTCCAGTGATTGTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055278592 9:74648280-74648302 AGGGAAAGTACATTGAGATTGGG + Intronic
1056050281 9:82761376-82761398 AGGGGAAATACATTGATTGAAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056790080 9:89619662-89619684 AGGGAAGGTGCAGTGAATGCTGG + Intergenic
1056847505 9:90053652-90053674 AGGAAAGGTACAGAGATGGTGGG - Intergenic
1057084509 9:92196686-92196708 AAGGAAAGTGAAGTGAGTGTAGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186503067 X:10067555-10067577 AGGGAAGGTTCAGTGTTTGCAGG - Intronic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190395065 X:49973926-49973948 AGAGAAAGTAAACTGATGGTTGG - Intronic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1191878293 X:65818992-65819014 ATGCAAAGTACTGAGATTGTAGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193150401 X:78118661-78118683 AGGGACAGTACAGTAATTTGGGG + Intronic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193912137 X:87318258-87318280 AGCGAAAGAACAGCAATTGTGGG - Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194751287 X:97687130-97687152 AGCGAAAATACAGTGCATGTGGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1198758514 X:140006258-140006280 AGGGAAAGTCCAGTGGTGGCGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198780243 X:140227334-140227356 AGGGAAAGTCCAGTGGTGGCGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic