ID: 964583402

View in Genome Browser
Species Human (GRCh38)
Location 3:158266754-158266776
Sequence AAACCCTGTATCAAAAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 1, 1: 1, 2: 12, 3: 107, 4: 730}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964583402_964583406 -2 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583406 3:158266775-158266797 TTCACTCCTGTTGCCCAGGCTGG 0: 336
1: 12496
2: 23138
3: 30273
4: 29449
964583402_964583411 19 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583411 3:158266796-158266818 GGAGTGCAATGGTATGATCTCGG 0: 332
1: 11801
2: 59931
3: 120853
4: 151164
964583402_964583405 -6 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583405 3:158266771-158266793 GGGTTTCACTCCTGTTGCCCAGG 0: 28
1: 545
2: 12873
3: 23851
4: 30711
964583402_964583408 8 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583408 3:158266785-158266807 TTGCCCAGGCTGGAGTGCAATGG 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964583402 Original CRISPR AAACCCTGTATCAAAAAGAG GGG (reversed) Intronic
900143467 1:1148038-1148060 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
901172562 1:7270803-7270825 AGACCCTGTCTCAAAAACAATGG + Intronic
901415839 1:9115656-9115678 AAACCCAGTATGTAAAAAAGAGG - Intronic
901430768 1:9213253-9213275 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
901471778 1:9461645-9461667 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
902887757 1:19418462-19418484 AAGGCAGGTATCAAAAAGAGAGG - Intronic
903025215 1:20424538-20424560 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
903635158 1:24808523-24808545 AGACCCTGTCTCAAAAAAAAGGG - Intronic
903872376 1:26445700-26445722 AGACCCTGTCTCCAAAAAAGGGG + Intronic
903890011 1:26563234-26563256 AGACCCTGTCTCAAAAAAAAGGG - Intronic
904086424 1:27912534-27912556 AGACCCTGTCTCAAAAAAAAAGG + Intronic
904156341 1:28486344-28486366 AAACTCTGTCTCAAAAAGAAAGG + Intronic
904576778 1:31509947-31509969 AGACTCTGTCTCAAAAAGAGAGG - Intergenic
904632630 1:31854241-31854263 AGACCCTGTCTCAAAAAAATAGG + Intergenic
904658790 1:32069351-32069373 AGACCTTGTCTCAAAAAAAGCGG - Intergenic
904703517 1:32373528-32373550 AGACCCTGTCTCAAAAAAATAGG - Intronic
904719386 1:32495870-32495892 AGACCCTGTCTCAAAAAAAAAGG + Exonic
904934137 1:34114686-34114708 AGACCCTGTCTCAAAAAAAAAGG + Intronic
905265055 1:36746664-36746686 AGACCCTGTTTCAAAAAAAAAGG + Intergenic
905469518 1:38181348-38181370 AAACTCTGTCTCAAAAAAAGCGG - Intergenic
905476950 1:38235688-38235710 AGACCCTGTCTCAAAAAAGGGGG + Intergenic
906218925 1:44061905-44061927 AAACTCTGTCTCAAAAAAAAGGG + Intergenic
906406777 1:45548563-45548585 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
907035005 1:51208351-51208373 AGACCCTGTGTCAAAAAAAAAGG + Intergenic
907816182 1:57920320-57920342 AGGCCCTGTTTCAAAAAAAGGGG - Intronic
907971673 1:59388955-59388977 AGACCCTGTCTAAAAAAAAGAGG - Intronic
908731183 1:67228201-67228223 AGACCCTGTCTAAAAAAGAAGGG - Intronic
908896052 1:68900744-68900766 ACTCCCTGTAGCAGAAAGAGTGG - Intergenic
909077137 1:71062720-71062742 AAACCTTATGTCAAAAACAGGGG + Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909141795 1:71876494-71876516 AGACCCTGTCTGAAAAAGAAAGG + Intronic
909433965 1:75619059-75619081 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
909926338 1:81441847-81441869 AGACCCTGTCTCAAAAAAAATGG - Intronic
910305486 1:85758225-85758247 AAAACTTCTATCATAAAGAGGGG - Intronic
910546928 1:88428929-88428951 ATATCCTGTCTCAAAAAAAGTGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912040423 1:105383330-105383352 AAACTCTTAATCCAAAAGAGTGG + Intergenic
912227264 1:107748371-107748393 CAACCCTGTTTCAAAAGGAATGG - Intronic
913353626 1:117892367-117892389 AAACACTATAGCAAAAAGTGAGG - Intronic
914775620 1:150731914-150731936 AGACCCTGTCTTAAAAAAAGAGG - Exonic
914812763 1:151041173-151041195 AGACCCTGTCTCAAAAAAAAAGG + Intronic
914856282 1:151353288-151353310 AGACCCTGTCTCAAAAAAATAGG + Intergenic
914858056 1:151366377-151366399 AGACCCTGTCTCTAAAAGATGGG - Exonic
914863894 1:151409382-151409404 AGACCCTGTCTCAAAAAAAGGGG - Intronic
915351108 1:155226871-155226893 AGATCCTGTCTCAAAAAAAGGGG - Intergenic
915455499 1:156037920-156037942 AGACCCTGTCTCAAAAAAAAAGG - Intronic
916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG + Intergenic
916667330 1:166977939-166977961 AGACCCTGTCTCAAAAAAAATGG + Intronic
916962856 1:169906708-169906730 AAGCCCAGTTTCAAAAAGTGAGG + Intergenic
916999668 1:170342843-170342865 ACACCCTGTGTCAAAGAAAGGGG - Intergenic
917327389 1:173846784-173846806 AGACCCTGTCTCAAAAAAAAAGG + Intronic
917435835 1:175020515-175020537 AAACTCCGTCTCAAAAAAAGGGG - Intronic
917467079 1:175289247-175289269 AAAGCCTGTACCAAAAAGAAGGG - Intergenic
917926974 1:179797441-179797463 AAACTCTGTCTCAAAAAAAAGGG + Intronic
918081270 1:181209504-181209526 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
918382670 1:183972117-183972139 AGACCCTGTCTCAAAAAAAGAGG - Intronic
918503722 1:185228079-185228101 AGACCCTATCTCAAAAAGAAAGG + Intronic
918705589 1:187657713-187657735 AAAATCTGTGTCAAAAATAGTGG + Intergenic
918798990 1:188946669-188946691 AAAGCCTGTAGCAAAAACATTGG - Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919295145 1:195688551-195688573 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
919458305 1:197846211-197846233 AAACCATGTCTCAAAAAGAAAGG - Intergenic
919851507 1:201676131-201676153 ACACCCTATCTCAGAAAGAGGGG - Intronic
919988370 1:202691638-202691660 AGACCCTGTCTCAAAAAGGGAGG + Intronic
920412499 1:205773524-205773546 AGACCCTGTCTCAAAAACAAAGG - Intronic
921029170 1:211322303-211322325 AAAACCTGTATCACAATGAGAGG + Intergenic
921123047 1:212153260-212153282 AGACCCTGTCTCTAAAAAAGGGG + Intergenic
921388384 1:214594653-214594675 AGATCCTGTCTCAAAAAGAAAGG - Intergenic
921505908 1:215969710-215969732 AATCTCTGAAACAAAAAGAGAGG + Intronic
921727079 1:218535569-218535591 AGACCCTGTTTCAAAAATAAAGG - Intergenic
921742133 1:218697295-218697317 AAAACATGTAGCAAAAAGACAGG + Intergenic
922148099 1:222968922-222968944 AAACTCTGTCTCAAAAAAAAAGG + Intronic
922208968 1:223472527-223472549 AGACCCTGTCTCCAAAAAAGAGG - Intergenic
922303698 1:224325722-224325744 AAATTCTGTCTCAAAAAGAAAGG + Intronic
922410899 1:225374097-225374119 AGACCCTGTCTCAAAAAAAAAGG + Intronic
922630716 1:227107428-227107450 AGACCCTGTCTCAAAAGGAAAGG - Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923191197 1:231622487-231622509 AGACCTTGTGTCAAAATGAGAGG - Intronic
923560711 1:235038644-235038666 AAACCCTGTCTCAAAAAAAAAGG + Intergenic
923888838 1:238188530-238188552 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
923933316 1:238728539-238728561 AAACGATGTTTCAAAAAGAGTGG - Intergenic
924206150 1:241713299-241713321 AGACCCTGTCTCAAAAAGAAAGG + Intronic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924578252 1:245300425-245300447 AAACCCTTTTTAAAAAGGAGAGG - Intronic
924733916 1:246737599-246737621 AGACCCTGTATCAAAAAAAAAGG - Intronic
1063402359 10:5758525-5758547 AAACCCTGTCTCAAAAAAAAAGG + Intronic
1063587938 10:7369867-7369889 AAACCCTGTCTCAAACAAAAAGG - Intronic
1063598753 10:7461438-7461460 AGACCCAGTCTCAAAAAGGGAGG + Intergenic
1063711840 10:8486809-8486831 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1063865247 10:10357633-10357655 TAACCCTGGATCAGAAAGATGGG - Intergenic
1064269792 10:13854397-13854419 AAAGCCTTCATCAAAATGAGAGG - Intronic
1064718518 10:18203339-18203361 AAACCCTTTTTCAGATAGAGGGG - Intronic
1065372052 10:24997394-24997416 AGACCCTGTCTCAAAAAAAGAGG - Intronic
1065620104 10:27572152-27572174 ACACCCTGTCTCTAAAAAAGGGG - Intergenic
1065824455 10:29557103-29557125 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1065851479 10:29793581-29793603 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1066361842 10:34738800-34738822 AGACCCTGTCTCAAAATAAGGGG + Intronic
1066536621 10:36398712-36398734 AAACTCTGTCTCAAAAAACGAGG + Intergenic
1066680432 10:37932411-37932433 AGACCCTATATTAAAAAAAGGGG - Intergenic
1067580874 10:47444612-47444634 AAAGACAGTATCAAAAAGTGTGG - Intergenic
1068058793 10:52040198-52040220 GAACCCTATAGCAAAAATAGTGG - Intronic
1069673364 10:70229917-70229939 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1069998914 10:72361544-72361566 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1070108975 10:73463938-73463960 AGACTCTGTCTCAAAAAAAGAGG - Intronic
1070867641 10:79716260-79716282 AGACCCTGTCTCAAAACGTGGGG - Intergenic
1071044254 10:81354583-81354605 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1071188709 10:83076143-83076165 AAACCATTTATAAAAGAGAGGGG + Intergenic
1071660693 10:87499539-87499561 AGACCCTGTCTCAAAACGTGGGG + Intergenic
1071687575 10:87776476-87776498 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1072033703 10:91545101-91545123 GCACCCTGAATCAACAAGAGTGG + Intergenic
1072098517 10:92206441-92206463 AGACCCTGTCTCAAAACGAAAGG - Intronic
1072442791 10:95471709-95471731 AGATCCTGTGTCAAAAAGAAAGG + Intronic
1072444318 10:95484962-95484984 AGACCCTGTCTCAAATAGAAAGG + Intronic
1072759039 10:98040753-98040775 AGACCCTGTCTCAAAAAGAGAGG + Intergenic
1072911442 10:99505235-99505257 AGACTCTGTCTCAAAAAAAGGGG + Intergenic
1073149819 10:101304076-101304098 AGACCCTGTCTCAAAAAAAGAGG - Intergenic
1073182124 10:101590041-101590063 AGACCCTGTCTCAAAAAAACTGG + Intronic
1073437783 10:103531540-103531562 AGACCCTGTCTCAAAAAAAGTGG - Intronic
1074126667 10:110533990-110534012 AGACTCTGTCTCAAAAAGAAAGG + Intergenic
1074897259 10:117787842-117787864 AAACCCTCTATCAAAAAAAAAGG + Intergenic
1076087300 10:127645334-127645356 AATCCCTGTATGAGAAATAGTGG + Intergenic
1077052015 11:571155-571177 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1077449395 11:2627758-2627780 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1077938440 11:6814664-6814686 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1078126922 11:8575032-8575054 AGACCCTGTCTCAAAAAAAGGGG + Intronic
1078499233 11:11853178-11853200 AAAGATTGTATCAAAAACAGGGG + Intronic
1078875329 11:15389226-15389248 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1078901198 11:15644298-15644320 AGACCCTGTCTTAAAAAAAGGGG - Intergenic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080010367 11:27453076-27453098 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1080652415 11:34233259-34233281 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1081495781 11:43608936-43608958 AGGCCCTGTCTCAAAAAAAGAGG - Intronic
1081579138 11:44339974-44339996 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1081783624 11:45731057-45731079 AAACTCTGTCTCAAAAAAAGAGG - Intergenic
1082011171 11:47450367-47450389 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1082126780 11:48441486-48441508 AAAACCTGCATGAAAAACAGAGG - Intergenic
1082250239 11:49970841-49970863 AAAACCTGCATGAAAAACAGAGG + Intergenic
1082781615 11:57292631-57292653 AAACCATGTCTCAAAAAAAAAGG + Intergenic
1082863717 11:57879219-57879241 AAACTCTATGTTAAAAAGAGAGG + Intergenic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1083305434 11:61759658-61759680 AAACTTTGTCTCAAAAAGAAAGG + Intronic
1083411090 11:62492866-62492888 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1083649567 11:64193774-64193796 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1083809325 11:65094785-65094807 AAACCCAGTCTCAAAAAAAAAGG + Intronic
1084301180 11:68253702-68253724 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1084307667 11:68297609-68297631 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1085497577 11:76985140-76985162 AGACCCTGTCTCCAAAAAAGAGG - Intronic
1086075556 11:82847579-82847601 AAAACCTGGATCAAAATGATAGG - Intronic
1086361501 11:86065065-86065087 AGACCCTGTATCCAAAAAAAGGG + Intronic
1086387551 11:86325166-86325188 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1086619605 11:88869803-88869825 AATGCCTCTATAAAAAAGAGGGG + Intronic
1087287139 11:96277110-96277132 ATACTCAGTATAAAAAAGAGAGG + Intronic
1087301892 11:96445566-96445588 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1087325502 11:96717047-96717069 AAACTCTGTATCAAAACAAAAGG + Intergenic
1087533693 11:99416285-99416307 AAACCTTGTCTCAAAAAAAAAGG - Intronic
1087546749 11:99593957-99593979 AATCTCTGTATATAAAAGAGAGG - Intronic
1087690524 11:101316467-101316489 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1088128444 11:106458334-106458356 AAGCTCTGTTTCAAAAACAGAGG - Intergenic
1088203881 11:107370290-107370312 CAAGCCTGTTTAAAAAAGAGGGG + Intronic
1088477766 11:110261255-110261277 ATACCTTTTATCAAAATGAGTGG - Intronic
1088662666 11:112063499-112063521 AAATCCTGTCTGAAAAGGAGGGG + Exonic
1089716809 11:120368084-120368106 AGACCCTGTCTCAAAAAAAGAGG - Intronic
1090011376 11:123048603-123048625 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
1092185163 12:6473423-6473445 AGACCCTGTCTCAAAAAAACGGG + Intergenic
1092361848 12:7843340-7843362 AGGCGCTGTTTCAAAAAGAGTGG + Intronic
1092378063 12:7972026-7972048 AGGCGCTGTTTCAAAAAGAGTGG + Intergenic
1092988749 12:13874334-13874356 AAACCTTGTATCAAGAATATGGG - Intronic
1093030966 12:14288156-14288178 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1094458356 12:30664749-30664771 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1094653897 12:32402386-32402408 AGACCCTGTCTCAAAAAGAGAGG + Intronic
1094672407 12:32583325-32583347 AAACCCTGTCTCAAAAAACAAGG + Intronic
1095502172 12:42851785-42851807 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1096365815 12:51027327-51027349 AAACCCTGTCTCAAAAAAAAAGG + Intronic
1097012588 12:55963996-55964018 AAACCCTGTATCAAAAGGAAAGG - Intronic
1097159076 12:57033361-57033383 AAACCCTGTCTCAAAAAAAGAGG - Intronic
1097310723 12:58115630-58115652 ATGCCTTGTATCAAAAAGACAGG - Intergenic
1097437280 12:59565832-59565854 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1097661324 12:62434803-62434825 AAACCCCGAAAAAAAAAGAGAGG - Intergenic
1097771403 12:63590762-63590784 AACCAGCGTATCAAAAAGAGAGG - Intronic
1097955501 12:65481541-65481563 AAACCCTGTCTCTACAAGACAGG + Intronic
1098020492 12:66150422-66150444 AGACCCTGTCTTAAAAAGAAAGG - Intronic
1098254776 12:68606033-68606055 AGACTCTGTCTCAAAAAAAGAGG + Intergenic
1099381133 12:81954229-81954251 AGACCTAGTGTCAAAAAGAGAGG - Intergenic
1099567070 12:84264806-84264828 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1100119777 12:91355743-91355765 AACCTCTGTAACAAAAAGATTGG - Intergenic
1100623542 12:96305724-96305746 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1100836119 12:98568747-98568769 AGACTCTGTCTCAGAAAGAGAGG + Intergenic
1101085385 12:101230389-101230411 AGACCCTGTCTCAAAAACAAAGG + Intergenic
1101486194 12:105163509-105163531 AGACCCTGCCTCAAAAAGAAAGG - Intronic
1101746404 12:107544782-107544804 GACCCATTTATCAAAAAGAGAGG + Intronic
1102022647 12:109694879-109694901 AGACCCTGTCTCAAAAAAAGGGG + Intergenic
1102137600 12:110588176-110588198 AGACCCTGTCTCAAAAAACGGGG + Intergenic
1102832914 12:116023285-116023307 GACCCCTGTCTCAAAAAAAGTGG + Intronic
1103408588 12:120694142-120694164 AGATCCTGTATCAAACTGAGCGG + Exonic
1103452021 12:121035865-121035887 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1103664045 12:122547364-122547386 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1103829582 12:123768141-123768163 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1104032408 12:125074535-125074557 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1105061827 12:133159909-133159931 AGACCCTGTCTCCAAAAAAGGGG + Intronic
1105065823 12:133196342-133196364 AAACCCAGTAACTAAAAGACAGG - Intronic
1105168744 13:17555174-17555196 AACTGCTGCATCAAAAAGAGAGG - Intergenic
1105302106 13:19144654-19144676 AGACCCTGTCTCCAAAAGAAAGG + Intergenic
1106813561 13:33383367-33383389 AGACCCTGTGTCAAAAAAAAAGG + Intergenic
1107366071 13:39678074-39678096 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1107919066 13:45184396-45184418 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1110482239 13:75992915-75992937 AAACCCTGCATCAAAGACACAGG + Intergenic
1111046840 13:82824747-82824769 GAACCCTGTATGAAAAACAAAGG + Intergenic
1111047512 13:82833969-82833991 AAACTATGTATCAAAAAGAGGGG + Intergenic
1111357910 13:87134067-87134089 AATCAATGTATCAAAAACAGAGG + Intergenic
1112039430 13:95531538-95531560 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1112306852 13:98282127-98282149 AAACCCTGTCTCTAAAAAAATGG + Intronic
1112510895 13:100008225-100008247 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1112664447 13:101553783-101553805 AAACTCTGTCTCAAAAAAAGGGG - Intronic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1113707284 13:112443061-112443083 AAACACTGTGTTAAAAAGATGGG + Intergenic
1113746929 13:112751737-112751759 AGACCCTGTCTCAAAAAAAGGGG - Intronic
1114038753 14:18655925-18655947 AAACTCCGTATTAAAAAAAGGGG + Intergenic
1114282531 14:21206468-21206490 AAACCCTGTGTGATAAAGAGGGG - Intergenic
1114456906 14:22861172-22861194 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1115201687 14:30860780-30860802 AGACCCTGTCTCAAAAAAATCGG - Intergenic
1115254263 14:31381774-31381796 AGACCCTGTTTCAAAAAAAGGGG + Intronic
1115712021 14:36061388-36061410 AGACTCTGTCTCAAAAAAAGTGG - Intergenic
1115982895 14:39073298-39073320 AGACTCTGTTTCAAAAAGAAGGG - Intronic
1117129893 14:52675642-52675664 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1117230106 14:53708175-53708197 AAACTCTGTCTCAAAAAAAAGGG + Intergenic
1117354755 14:54913180-54913202 AGACCCTGTCTCAAAAAGGAAGG + Intergenic
1117725797 14:58672398-58672420 AGACCCTGTCTCAAAAACAAAGG - Intergenic
1117902757 14:60551770-60551792 ATCCCCTGTTTCAACAAGAGAGG - Intergenic
1118028854 14:61799825-61799847 AGACTCTGTCTCAAAAAAAGTGG - Intergenic
1118056963 14:62089008-62089030 AAACCTTGGATCAGAAAGATGGG + Intronic
1118178786 14:63470079-63470101 AGACCTTGTCTCAAAAAAAGTGG - Intronic
1118334710 14:64843053-64843075 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1118403466 14:65400873-65400895 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118798748 14:69169579-69169601 AGACTCTGTCTCAAAAAAAGAGG - Intergenic
1119064402 14:71511294-71511316 AGACCCTGTCTCAAAAGGAAAGG - Intronic
1119508620 14:75193747-75193769 AGACTCTGTCTCAAAAAGAGAGG + Intergenic
1119590314 14:75880921-75880943 AGACCCTGTCTCAAAAAAAGCGG - Intronic
1119722871 14:76903017-76903039 AGACCCTGTCTCAGAAAGCGTGG + Intergenic
1119809872 14:77508036-77508058 AGACCCTGGCTCAATAAGAGGGG - Exonic
1119856847 14:77907570-77907592 AAAGCCGGTATCTAAAGGAGTGG + Intronic
1120082702 14:80233807-80233829 AAACCCTTAATCAGAAGGAGGGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121091526 14:91186254-91186276 AGACTCTGTCTCAAAAAAAGGGG - Intronic
1121364657 14:93297881-93297903 AAAGCCTTTACCAAAATGAGGGG + Intronic
1121726933 14:96159097-96159119 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1121753662 14:96382549-96382571 TACCACTTTATCAAAAAGAGGGG + Intronic
1121866307 14:97365870-97365892 AAACCCTCAATGAAAAAAAGAGG + Intergenic
1122095332 14:99366405-99366427 AAACTCTGTCTCAAAAAAAAGGG - Intergenic
1122467116 14:101941312-101941334 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1122494821 14:102145607-102145629 AAACCCTGTCTCTACAAGGGTGG + Intronic
1123905810 15:24920313-24920335 AAACACTGTATCCAAAAAATGGG - Intronic
1123911724 15:24974732-24974754 AAACCCTGTTTCTAATAAAGAGG - Intronic
1124096661 15:26654749-26654771 AGACCTTGTCTCAAAAAAAGGGG + Intronic
1124575972 15:30908830-30908852 AAACTCTGTCTCAAAAAAAATGG + Intronic
1124580801 15:30953122-30953144 AAACCCTTTATGAAAAGGAAGGG + Intronic
1125195582 15:37042139-37042161 AGACCCTATCTCAAAAAGAAAGG + Intronic
1125316432 15:38437246-38437268 AATGCCTCCATCAAAAAGAGAGG - Intergenic
1125669406 15:41459364-41459386 AGACCCTGTGTCAAAAAAAAGGG + Intronic
1125810009 15:42530738-42530760 AGACCCTTTCTCAAAAAGAAAGG + Intronic
1125904135 15:43374910-43374932 AGACTCTGTCTCAAAAAAAGTGG - Intronic
1126054651 15:44718754-44718776 AAACCATGGATCAAAAACACTGG - Exonic
1126168244 15:45672001-45672023 AAAACCTGCGTCAAAAAGGGTGG - Intronic
1126235683 15:46381524-46381546 AAACACTGTATAAGACAGAGGGG + Intergenic
1126876348 15:53045699-53045721 AGACCCTGTCTCAAAAAAAGGGG - Intergenic
1127243431 15:57144606-57144628 AGAAGCTGTCTCAAAAAGAGAGG - Intronic
1127426308 15:58862226-58862248 AGACCCTGTGTCAAAAAAAAAGG + Intergenic
1127474246 15:59317668-59317690 AAACCCTGTGTAAGAAAGGGAGG + Intronic
1127630529 15:60823197-60823219 AAACCCTGTCTCAGAAAGGAAGG - Intronic
1127658714 15:61080132-61080154 AAGCCCTGAATAAATAAGAGAGG - Intronic
1128297283 15:66534109-66534131 AGACCCTGTTTCAAAAAAAAGGG + Intronic
1128583498 15:68826471-68826493 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1128637641 15:69313488-69313510 AGACTCTGTCTCAAAAACAGCGG + Intronic
1128932734 15:71720064-71720086 GGACCCTGTCTCAAACAGAGTGG - Intronic
1129713076 15:77831268-77831290 AAACTCTGTATCAAAAAAAAGGG - Intergenic
1129830178 15:78663917-78663939 AGACCCTGTCTTAAAAAGGGAGG + Intronic
1129969372 15:79763956-79763978 AGACCCCATCTCAAAAAGAGGGG + Intergenic
1130178733 15:81604148-81604170 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1130347882 15:83066288-83066310 AGACCTTGTCTCAAAAAAAGCGG + Intronic
1131140320 15:89971962-89971984 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1131168041 15:90156786-90156808 AAACTCTGTCTCAAAAAGGAAGG + Intergenic
1131240344 15:90736272-90736294 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1131548673 15:93337855-93337877 AGACCCTGTCTCAAATAAAGAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131756158 15:95564596-95564618 AAACCCTGTATCAAGAACTTCGG + Intergenic
1131788534 15:95938799-95938821 AAACTCTGTCTCAAAAAGAAAGG + Intergenic
1131803005 15:96091301-96091323 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1132258101 15:100395835-100395857 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1133252547 16:4493034-4493056 AGACTCTGTCTCAAAAAAAGAGG - Intronic
1133280246 16:4660989-4661011 AGCCCCTGTCTCAAAAAAAGGGG - Intronic
1133612262 16:7444540-7444562 AAACCCTGTCTCAAAAAAAAAGG - Intronic
1133761148 16:8799159-8799181 AAACCCTATATAAATAAGAGTGG + Intronic
1135027535 16:19010161-19010183 AAACTGTGTCTCAAAAGGAGAGG - Intronic
1135104228 16:19633524-19633546 AGACCCTGTTTCAAAAAAAAAGG - Intronic
1135290868 16:21236939-21236961 AAACTATGTGTCCAAAAGAGGGG - Intronic
1135524891 16:23206603-23206625 AGACCCTGTCTCAGAGAGAGAGG + Intronic
1135801513 16:25501312-25501334 AAACCATGTCTAAAAAAAAGGGG + Intergenic
1135857507 16:26025496-26025518 AAACTCTGTTTCAAACAAAGTGG - Intronic
1136574507 16:31115538-31115560 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1137943200 16:52709043-52709065 AGAACCTGGATTAAAAAGAGTGG - Intergenic
1138608030 16:58101135-58101157 AAACTCTGTTTCAAAAAAAAGGG - Intergenic
1138789965 16:59892291-59892313 AGACCCTGTATCTAAAATCGAGG - Intergenic
1139093186 16:63674242-63674264 AGACTCTGTCTCAAAAAAAGAGG - Intergenic
1139205558 16:65025344-65025366 AGACTCTGTCTCATAAAGAGGGG - Intronic
1139363600 16:66419242-66419264 AGACTCTGTCTCAAAAACAGAGG + Intergenic
1139828936 16:69781016-69781038 AGACCCTGTCTCAAAAAAACAGG + Intronic
1139890491 16:70250806-70250828 AAACCCTGTCTCTAAAAAAAAGG + Exonic
1140087651 16:71810922-71810944 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1140157378 16:72445745-72445767 AAACCCTTTCTCAAAAAAGGGGG - Intergenic
1140666140 16:77229436-77229458 AAACTCTGTTTCAAAAAAAAGGG - Intergenic
1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG + Intronic
1141402132 16:83758225-83758247 AAACCTTGTCTCATAAAAAGAGG - Intronic
1141585768 16:85032638-85032660 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1141710096 16:85693719-85693741 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1142169472 16:88613919-88613941 AGACCCTGTCTCAAAAAAAGGGG + Intronic
1142329274 16:89440602-89440624 AAACTCTGTCTCAAAAGGAGGGG + Intronic
1142736100 17:1900774-1900796 AGACCCTATCTCAAAAAAAGGGG + Intergenic
1142908544 17:3066450-3066472 AGACCCTGTCTCAAAAAAAATGG + Intergenic
1143361109 17:6372076-6372098 AGACCCTATCTCAAAAAGAAAGG + Intergenic
1143745860 17:8993785-8993807 AAACCCTGTCTCAAAAAACAAGG + Intergenic
1143873068 17:9971555-9971577 ACACCCTGTATCAAAAAAGTGGG + Intronic
1144698903 17:17323879-17323901 AAACTCTGTCTCAAAAAAAATGG - Intronic
1145026260 17:19470006-19470028 AAACCCTGTCTCAAAAAAAAAGG - Intergenic
1145371813 17:22312394-22312416 AATCCCTGAATGAAAAGGAGGGG - Intergenic
1145942685 17:28751218-28751240 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1145965795 17:28916201-28916223 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1146904605 17:36609933-36609955 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1147246271 17:39123197-39123219 AAACTCCGTCTCAAAAAAAGAGG - Intronic
1147642527 17:42012803-42012825 AAACCCTGTCTCAAAAAAAAGGG - Intronic
1147705809 17:42423911-42423933 ACACCCTGTCTCAGAAAGGGGGG - Intergenic
1147872310 17:43596200-43596222 AAACCCTGTCTCAAAAAAAAAGG - Intergenic
1147876308 17:43623241-43623263 AGACCCTGTATCAAAAAAAGGGG - Intergenic
1147973798 17:44236094-44236116 AAACTCCGTCTCAAAAAGAAAGG - Intergenic
1148004425 17:44414315-44414337 AAACCCTGTCTCCAAAAAAGGGG - Intronic
1148099800 17:45082115-45082137 AGACTCTGTCTCAAAAAGAAAGG - Intronic
1148354440 17:46966291-46966313 AGACCCTGTCTCAAAAAAAGTGG - Intronic
1149069379 17:52521422-52521444 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1149480411 17:56998942-56998964 AAACCCTGTTTCTTAAAAAGGGG + Intronic
1149802256 17:59580778-59580800 AGACCCTGTTTCAAAAGAAGGGG + Intronic
1149844235 17:59994711-59994733 AGACCCTGTTTCAAAAGAAGGGG - Intergenic
1149871503 17:60186041-60186063 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1150109527 17:62486164-62486186 AGACCCCGTCTCAAAAAAAGAGG - Intronic
1150297844 17:64023420-64023442 AGACTCTGTCTCAAAAAGAAAGG - Intergenic
1150744640 17:67806658-67806680 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1150792630 17:68210937-68210959 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1151787268 17:76281170-76281192 AGACCCTGTCTCAAAAACAATGG + Intronic
1152083970 17:78205944-78205966 AGACCCTGTGTCAAGGAGAGTGG + Exonic
1152181484 17:78824532-78824554 AGGCCCTGTCTCAAAAAGAATGG + Intronic
1152478136 17:80531894-80531916 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1153198230 18:2624171-2624193 AAACTCTGGGTCAAACAGAGTGG + Intergenic
1153804728 18:8702368-8702390 AAACCCTGTCTCAAAAAAATGGG - Intergenic
1153972952 18:10242972-10242994 AGACCCTGTCTCAGAAAAAGTGG + Intergenic
1155008493 18:21751190-21751212 AGACCCAGTCTCAAACAGAGGGG + Intronic
1155147192 18:23093917-23093939 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1155423345 18:25679774-25679796 AAAGCCAGTAGCAAAAAAAGAGG - Intergenic
1155876797 18:31099876-31099898 AAATCCTGTCTCAAAAAGGGGGG - Intronic
1156187175 18:34676823-34676845 AGACCTTGTCTCAAAGAGAGAGG + Intronic
1157449984 18:47778821-47778843 AAACCCTGTATCCATTAGCGTGG - Intergenic
1158302788 18:56070957-56070979 AAACCATTTATCAAAAAAAGAGG + Intergenic
1158574846 18:58627746-58627768 AAATCCTGTATTAAAAAGCATGG - Intronic
1159680571 18:71346310-71346332 AAACTCTGTCTCAAAAAAAGTGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160878224 19:1307752-1307774 AGACCCTGTCTCATAAAGAAGGG - Intergenic
1160925792 19:1544849-1544871 AGACCCTGTCTCAGAAAGAAAGG - Intergenic
1161177786 19:2857830-2857852 AGACCCTGTCTCAAAAAAAAAGG + Exonic
1161246611 19:3256053-3256075 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1161524576 19:4745749-4745771 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1161536444 19:4821942-4821964 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1161615957 19:5270298-5270320 AGACCCTGTCTCTAAAAGGGGGG - Intronic
1161828661 19:6586784-6586806 AAACCCTGTCTCAAAAAAAAGGG + Intronic
1161905194 19:7151283-7151305 AGACCCTGTCTCAAAAAGGAAGG - Intronic
1162078038 19:8201968-8201990 AGATCCTGTCTCAAAAAAAGAGG + Intronic
1162120180 19:8460575-8460597 AACCACTTTAACAAAAAGAGAGG - Intronic
1162147960 19:8624840-8624862 AAACTCTATCTCAAAAAAAGGGG + Intergenic
1162317515 19:9948755-9948777 ATACCCTGTCTCAGAGAGAGAGG + Intergenic
1163466836 19:17472827-17472849 ACACCCTGTCTCAAAAAAAAGGG - Intronic
1163811279 19:19433782-19433804 AGACCTTGTCTCAAAAAAAGGGG - Intronic
1163926193 19:20346035-20346057 AAACCCTATCTCAAAAATAAAGG + Intergenic
1164585787 19:29474972-29474994 ACACCCTGTCTCAATAAAAGTGG + Intergenic
1164602602 19:29572951-29572973 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1164609333 19:29621511-29621533 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1165024348 19:32948733-32948755 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1165057203 19:33185284-33185306 AGACCCTGTCTCTAAAAGTGGGG - Intronic
1165308468 19:35016582-35016604 AAACTCTGTCTCAAAAAAACAGG + Intronic
1165498106 19:36166058-36166080 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1165556383 19:36636192-36636214 AAACTCTGTCTCAAAAAGTAAGG - Intergenic
1165691679 19:37868564-37868586 AGACCCTGTCTCAAAAAATGGGG + Intergenic
1165828371 19:38718524-38718546 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1166061677 19:40329494-40329516 AAACCCAGTCTCAAAAACAGGGG + Intronic
1166063483 19:40342308-40342330 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1166620690 19:44297470-44297492 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1167417860 19:49386673-49386695 AGAACCTGTCTCAGAAAGAGAGG + Intergenic
1167429161 19:49444382-49444404 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1167646136 19:50706147-50706169 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1167847477 19:52176457-52176479 AGACCCTGTCTAAAAAAGAAAGG - Intergenic
1168030568 19:53676431-53676453 AAGCTCTGTCTCAAAAAGACTGG - Intergenic
1168042642 19:53770478-53770500 AGACCCTGTCTCAAAAAGAAAGG + Intergenic
1168048848 19:53813694-53813716 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1168434741 19:56308042-56308064 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1168497431 19:56865245-56865267 AGACCCTGTCTCAAAAAAACCGG - Intergenic
1168501483 19:56896992-56897014 AGACTCTGTCTCAAAAAAAGAGG + Intergenic
1168668051 19:58219159-58219181 AGACCTTGTCTCAAAAAAAGAGG + Intergenic
925103496 2:1269509-1269531 AGACCCTGTCTCAAAAAAAAAGG + Intronic
925160908 2:1682928-1682950 AAACTCTGTCTCAAAAAAAAGGG + Intronic
927014086 2:18938446-18938468 AAACAGTGTCTCAAAAAGAGAGG + Intergenic
927329090 2:21841589-21841611 AAAGCCTGTATCAAGCAGTGGGG - Intergenic
927411694 2:22832954-22832976 AGACTCTGTCTCAAAAAGAGAGG + Intergenic
927802976 2:26118321-26118343 AAACCCGGTCTCAAAAAAAAGGG - Intronic
928035061 2:27815215-27815237 AGACCCTGTCTCAAAAAGAGGGG - Intronic
928188727 2:29140945-29140967 AACGCCTGTATCAAGAAGACAGG - Intronic
928231021 2:29499206-29499228 AGACCCTGTCTCAAAAAAAAAGG - Intronic
928893049 2:36228038-36228060 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
929162833 2:38850290-38850312 AAACCTTGTCTCAAAAAAAAAGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929352676 2:40978073-40978095 AAACCATGCAGCAAAAAGAAAGG - Intergenic
929505174 2:42522727-42522749 AGACCCTGTCTCAGAAAGATGGG + Intronic
930475712 2:51878616-51878638 AAACCCAGTAACAAAATGACAGG + Intergenic
930587048 2:53279380-53279402 AAACTCTGTCTCAAAAAAAGAGG + Intergenic
930604125 2:53474983-53475005 AATCACTGTATCAAGAAGAAAGG + Intergenic
932198901 2:69808669-69808691 AGACCCTGTCTCAAAAAAAAAGG - Intronic
932389530 2:71373830-71373852 AGACCTTGTCTCAAAAAGAGGGG - Intronic
932590698 2:73065109-73065131 AGACCCTGTCTCAGAAAGAAGGG - Intronic
933348686 2:81124948-81124970 AAACACTTTATCCAAAAGACAGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933740366 2:85529252-85529274 AGACCCTGTTTCAAAAAAAAAGG - Intergenic
934046392 2:88176083-88176105 AGACCCTGTCTCAAAAAAAAAGG + Intronic
934119530 2:88826460-88826482 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
934788788 2:97038072-97038094 AATACCTGTCACAAAAAGAGAGG + Intergenic
935030789 2:99320015-99320037 AGACCCTGTCTCAAAAAGAAAGG - Intronic
935272302 2:101445400-101445422 AGACCCTGTCTCAAAAAAAAAGG - Intronic
935536632 2:104301769-104301791 AAAACCTGTATCAGAAACAGTGG - Intergenic
936066685 2:109337735-109337757 AAACCCTGTCTCAAAAAAAAAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937377025 2:121344339-121344361 AAACTCTGTCTCAAAAAAAAAGG - Intronic
938848949 2:135240586-135240608 AGACCCTGTCTCAAAAAGGAAGG - Intronic
939653908 2:144798921-144798943 AGACCCTGAATCAAAGACAGTGG + Intergenic
939922901 2:148139213-148139235 AAACTCTGTTTCAAAAAAAAAGG - Intronic
940183450 2:150958724-150958746 AAGCCCTGTTACAAAAAGTGGGG - Intergenic
940595500 2:155787227-155787249 AGACCGTGTCTCAAAAAAAGAGG - Intergenic
940734011 2:157428715-157428737 GAACCCTGGATCCAAAGGAGAGG - Intronic
941800664 2:169656278-169656300 AGACCCTGTCTCAAAAAAAGAGG + Intronic
942709132 2:178812832-178812854 AAACAATGTATCAAGTAGAGTGG - Intronic
942741749 2:179188632-179188654 AGATCCTGTCTCAAAAAAAGGGG + Intronic
943002147 2:182341764-182341786 AGACCCTATCTCAAAAAAAGAGG - Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944450452 2:199836752-199836774 AAACCCTGTTTCAAAAAAAAAGG + Intronic
944695787 2:202199280-202199302 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
944752187 2:202721641-202721663 AGACCCTGTCTCAAAAAAAAAGG - Intronic
944774679 2:202951054-202951076 AAACCTTGTCTCAAAAAAAAAGG - Intronic
944812770 2:203344371-203344393 AGACCCTGTCTCAAAAAAAAAGG - Intronic
945111705 2:206366340-206366362 AGACCCTGTCTCAAAAAGGATGG - Intergenic
945257049 2:207811535-207811557 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
945908092 2:215616352-215616374 AGACCCTGTCTCTAAAAAAGGGG + Intergenic
946712492 2:222520761-222520783 AGACCCTGTCTCAAAAAAAAAGG - Intronic
946866323 2:224044224-224044246 ACACTCTGTCTCAAAAAGAAAGG - Intergenic
946995114 2:225382677-225382699 AAACTCTATAGCAAAAATAGTGG + Intergenic
947095112 2:226557852-226557874 AAACCCAGCATCCAAAAGACAGG + Intergenic
949007285 2:241656821-241656843 AGACTCCGTCTCAAAAAGAGGGG - Intronic
949020181 2:241736520-241736542 AAAACCTGTATGAAAAACAGAGG - Intronic
949051092 2:241897741-241897763 AGACCCTGTCTCAAAAACAAGGG - Intronic
1169697262 20:8404226-8404248 AAACCCTGAAACAAAAACATAGG - Intronic
1169802654 20:9526550-9526572 ACACAGTGTATCAGAAAGAGTGG - Intronic
1170951413 20:20939682-20939704 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1170992416 20:21315499-21315521 AAACCCTGTCTCAAAAAAAAGGG - Intronic
1171055549 20:21903158-21903180 AGACCCTTTATCCTAAAGAGAGG - Intergenic
1171493245 20:25537094-25537116 AGACCCTGTTTCAAAAACAAAGG - Intronic
1171754982 20:29098199-29098221 AAACCATGTGTCAAGAAGGGGGG - Intergenic
1171754993 20:29098311-29098333 AAACCATGTGTCAAGAAGGGGGG - Intergenic
1171755004 20:29098423-29098445 AAACCATGTGTCAAGAAGGGGGG - Intergenic
1171755014 20:29098535-29098557 AAGCCATGTGTCAAGAAGAGGGG - Intergenic
1172227720 20:33316386-33316408 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1172313305 20:33934320-33934342 AAACTCTGTCCCAAAAAGAAAGG + Intergenic
1172730685 20:37084772-37084794 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1172946749 20:38695274-38695296 AGACCCTGTCTCAAAAATAAAGG - Intergenic
1173015116 20:39218459-39218481 AGACCCTGTCTCAAAAAAGGAGG - Intergenic
1173802502 20:45903211-45903233 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1173876929 20:46378999-46379021 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1174241752 20:49141757-49141779 AGACTCTGTCTCAAAAAAAGAGG + Intronic
1174335331 20:49855798-49855820 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1175512306 20:59538113-59538135 ATATCCTGTATCAAAAAAAGTGG + Intergenic
1175558308 20:59891649-59891671 AAACCATTTATTAAAAAGAAAGG + Intronic
1175807331 20:61837181-61837203 AGACCCTGTCTCAAAAAAAACGG + Intronic
1176164682 20:63666543-63666565 AGACCCTGTTTCAAAAAAAAGGG - Intronic
1176409605 21:6441310-6441332 AGACCTTGTCTCAAAAAAAGGGG - Intergenic
1177099950 21:16888471-16888493 AAACGCAATATCAAAAAGATTGG - Intergenic
1177443608 21:21162561-21162583 AAATTCTGTATGAAAAAGAAAGG + Intronic
1177468630 21:21524519-21524541 AAACTCTGTAACAAAAAAAAAGG + Intronic
1177733481 21:25059305-25059327 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1178034898 21:28569702-28569724 AGACTCCGTCTCAAAAAGAGTGG - Intergenic
1178076395 21:29016966-29016988 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1178999459 21:37443157-37443179 AGACCCTGTCTCTAAAAGAAAGG - Intronic
1179105034 21:38391884-38391906 AAACACTGTAACAAAAAAAGAGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179672351 21:42958597-42958619 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1179685098 21:43049632-43049654 AGACCTTGTCTCAAAAAAAGGGG - Intergenic
1179841909 21:44081867-44081889 AGACCCTGTCTCAAAGAAAGGGG + Intronic
1181157909 22:20936148-20936170 AGACCCTATCTCAAAAAAAGGGG + Intronic
1181337470 22:22150075-22150097 AAACCCTTACTCAAAAAGAGAGG - Intergenic
1182188015 22:28427642-28427664 AAACTCCGTCTCAAAAAAAGAGG + Intronic
1182391039 22:29996734-29996756 AGACCCTGTCTCAAAAAAAGGGG - Intronic
1182858823 22:33541168-33541190 AGACCCTGTCTCAAAAAAAGTGG + Intronic
1183714753 22:39527134-39527156 AGACCCTGTCTCAAAAAAAGAGG - Intergenic
1184223612 22:43116283-43116305 AGACCCTGTATCAATAAGTTAGG - Intronic
1184419692 22:44372491-44372513 AAACCTTGTAGAAAAGAGAGGGG - Intergenic
1184578439 22:45394311-45394333 AGACCCTGTCTCAAAAAAAAAGG + Intronic
949809485 3:7991011-7991033 AATTCCTATATTAAAAAGAGAGG - Intergenic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
950785466 3:15430555-15430577 AAAAGCTATATCTAAAAGAGGGG - Intronic
950817872 3:15726031-15726053 AAACTCTGTCTCCAAAAAAGTGG + Intronic
951370970 3:21847213-21847235 AAACCCTGAATGAATAAAAGAGG + Intronic
952850495 3:37724502-37724524 AAACTCTGTCTCAAAAAAAAAGG - Intronic
953013003 3:39046248-39046270 AGACTCTGTCTCAAAAAGAAAGG + Intergenic
953278782 3:41531429-41531451 AGACTCCGTCTCAAAAAGAGGGG + Intronic
953400445 3:42610010-42610032 AAACTCTGTCTCAAAAAAAAAGG - Intronic
953705862 3:45229747-45229769 AGACTCTGTCTCAAAAAAAGAGG - Intergenic
954044909 3:47921136-47921158 AGACCCTGTCTCAAAAAAAAGGG + Intronic
954057495 3:48039489-48039511 GAACCCTGAATCAAGATGAGTGG + Intronic
954103519 3:48396460-48396482 AAACTCTGTATCAGAAAAAAAGG + Intronic
954719909 3:52552779-52552801 ATACCCTGTATCAAGGTGAGAGG + Intronic
954776954 3:53028098-53028120 AGACCCTGTCTCAAAAAGAGTGG - Intronic
954840515 3:53507606-53507628 AGACCCTGTCTCAAAAATAAAGG + Intronic
954853298 3:53621262-53621284 AGACACTGTATCAAAAACACAGG - Intronic
955238442 3:57160160-57160182 AAACTCCGTCTCAAAAAAAGAGG + Intronic
955299549 3:57764198-57764220 AACCCCTGTTTAAGAAAGAGTGG + Intronic
955496191 3:59535215-59535237 AATACCTGTTTCAGAAAGAGAGG - Intergenic
956426140 3:69137660-69137682 AGACCCTGCCTCAAAAAAAGGGG - Intergenic
959720276 3:109479244-109479266 AAGCCCTCTATAAACAAGAGGGG + Intergenic
959879765 3:111429835-111429857 AGACCTTGTATAAAAGAGAGAGG + Intronic
960022790 3:112974424-112974446 AGACCCTGTCTCAAAAAAGGGGG + Intronic
960742902 3:120854615-120854637 AAAGCCTATACCACAAAGAGGGG + Intergenic
961231873 3:125320290-125320312 TACACCTGTATCAAAAAAAGAGG + Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
962211655 3:133484262-133484284 AAAGCTTGTATCAAAAAGACAGG - Intergenic
962586051 3:136843634-136843656 AGACCCTGTTTCAAAAAGGCTGG + Intronic
962644891 3:137428440-137428462 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
962955346 3:140261102-140261124 AAACACTGTATTAAGAAAAGAGG - Intronic
963302239 3:143611741-143611763 AGACCCTGTCTCAAAAATAAGGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964583402 3:158266754-158266776 AAACCCTGTATCAAAAAGAGGGG - Intronic
965123075 3:164588659-164588681 AGACCCTCTCTCAAAAAAAGAGG + Intergenic
966365523 3:179182659-179182681 AGACCCTGTCTCAAAAAAAAAGG + Intronic
966553036 3:181227006-181227028 AATCCCTATATCAAAAAGTCTGG - Intergenic
966846063 3:184130801-184130823 AGACCCTGTCTCAAAAAATGGGG + Intergenic
967202198 3:187082046-187082068 AGACCCTGTCTCAAAAAGAATGG - Intergenic
967572588 3:191047964-191047986 AAACCATGTTTCAAAAATAGAGG - Intergenic
967936740 3:194734545-194734567 AGACTCTGTCTCAAAAAGAGAGG + Intergenic
968029982 3:195475249-195475271 AGACTCTGTCTCAAAAAAAGAGG + Intergenic
969088057 4:4671151-4671173 AAACCCTGTCTCTACAAAAGAGG + Intergenic
969536599 4:7760188-7760210 AAAGTCTGTTTCAAAAAGTGTGG - Exonic
971403327 4:26296520-26296542 AAAACTTGTATGAAATAGAGCGG - Intronic
972277288 4:37569085-37569107 AGACCCTGTCTCAAAAAAAAAGG + Intronic
972456656 4:39262263-39262285 AGACCCTGTCTCAAAACGGGGGG - Intronic
972591689 4:40493927-40493949 AGACCCTGTCTCAAAAATAAAGG + Intronic
972773474 4:42219921-42219943 AAACCTTGTCTCAAAAAAAAAGG - Intergenic
972834341 4:42851058-42851080 AAACCCTGTCTCTAAAAAAAAGG - Intergenic
973301039 4:48584654-48584676 ATACCCTGTATCACACAGATAGG - Intronic
973325460 4:48856396-48856418 AAACTCTGTCTCAAAAAAAAAGG - Intronic
973689916 4:53416951-53416973 AGACCCTGTCTCAAAAAAAAAGG + Intronic
973953394 4:56039634-56039656 ATACTCTGTCTCAAAAAAAGAGG + Intergenic
973957591 4:56078414-56078436 AGACTCTGTCTCAAAAAGAAAGG - Intergenic
974042610 4:56870459-56870481 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
974408199 4:61504000-61504022 AAACCCTGTCTTACAAAAAGGGG - Intronic
974961514 4:68707592-68707614 GATCCCTGTAACAAAAAGATAGG + Intergenic
975470801 4:74764503-74764525 ACACCCTTTGACAAAAAGAGGGG - Intronic
975708521 4:77135436-77135458 AAACACTGTCTCAAAAAAAAAGG - Intergenic
976111914 4:81684703-81684725 AAAACCTGTATCAGTCAGAGAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976221795 4:82762160-82762182 AGACCCTGTCTCAAAAGAAGAGG + Intronic
976396811 4:84564859-84564881 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
976735543 4:88305087-88305109 AGACCCTCTCTCAAAAAAAGAGG + Intergenic
977232274 4:94465969-94465991 AGACCCTGTCTCAAAAACAAAGG - Intronic
977540187 4:98308458-98308480 AGACCCTGTCTCAGAAAGAAAGG + Intronic
978135556 4:105254418-105254440 AGACCCTGTCTCAAAAACAAAGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979318744 4:119299095-119299117 AAACCCTGTCTCAAAAAAAGGGG - Intronic
979739948 4:124137359-124137381 AAACTATGCATCAAAAAAAGAGG + Intergenic
981031062 4:140126371-140126393 AAACCCTCTAACAAAAAGCCAGG + Intronic
981206487 4:142046870-142046892 ACACCATGTATTAAAAAGATGGG + Intronic
981946079 4:150345813-150345835 AGACCCTGTCTCAAAAAAAAAGG - Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982623651 4:157736599-157736621 AATACCTGTAGCAAAAATAGTGG + Intergenic
983617590 4:169725154-169725176 AGACCCTGTCTCAAAAAGCAAGG + Intergenic
984750803 4:183271994-183272016 AGACCCTGTCTCAAAAAAATGGG + Intronic
986018316 5:3777475-3777497 AAACCCTGTATAAGGAAGTGTGG + Intergenic
986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG + Intergenic
986699601 5:10393064-10393086 AAACCTTGTCTCAAAAAAAAAGG - Intronic
986879114 5:12147933-12147955 AAACCTTGTCTCAAAAAGAAAGG - Intergenic
987207702 5:15644464-15644486 AAACTCTGTCTCAAAAAAAATGG + Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988137089 5:27187694-27187716 AAACCCTGTCTCAAAAAAAAGGG + Intergenic
988367739 5:30323101-30323123 AAGCAGTGTATCAAAAATAGGGG + Intergenic
988462516 5:31453203-31453225 AGACCCTGTCTCAAAAATAAAGG - Intronic
988645926 5:33095029-33095051 AGACCCTGTCTCAGAAAAAGAGG - Intergenic
989460805 5:41696491-41696513 AAACTCCTAATCAAAAAGAGTGG + Intergenic
990716528 5:58643666-58643688 AAACTCTGTCTCAAAAAAATTGG + Intronic
990767673 5:59204897-59204919 AAGCCCTTGATCAAACAGAGAGG + Intronic
990773933 5:59284123-59284145 TAACTCTTGATCAAAAAGAGGGG - Intronic
991354906 5:65758224-65758246 AGACCCTGTCTTAAAAAAAGAGG + Intronic
992317691 5:75575188-75575210 AGACCCTGTGTCAAAAAAAACGG - Intronic
992734174 5:79702374-79702396 AGACCCTGTCTCAAAAAAAAGGG + Intronic
992806396 5:80342257-80342279 AGACCCTGTATAAAAAAAAAAGG + Intergenic
993389915 5:87306866-87306888 AGACCCTGTCTCAAAAAAAGGGG - Intronic
994712119 5:103278696-103278718 AAACTCTGTGGCAAAAATAGGGG + Intergenic
995137501 5:108695811-108695833 AAATCCTGTCTCAAGAGGAGGGG + Intergenic
995157332 5:108930628-108930650 AGACCCTGTCTCAAAAAGGAAGG - Intronic
995176498 5:109183753-109183775 AGACCCTGTCTCAAGAAAAGTGG + Intronic
995231748 5:109772517-109772539 AGAACCTGTCTCAAAAAAAGTGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995826876 5:116309849-116309871 ATGCCTTGTATCAAAAAGACAGG - Intronic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
995938560 5:117549356-117549378 AAACTTTGTTTCAAAAAGAATGG + Intergenic
996402607 5:123079025-123079047 GAAACCTGTATCAAAAAGAATGG + Intergenic
996445346 5:123542635-123542657 AACACCTGTGGCAAAAAGAGGGG + Intronic
996570676 5:124929739-124929761 AGACCCTGTCTCTAAAAGAAAGG - Intergenic
997014327 5:129914117-129914139 AAACTCTGTGTCAAAAAAAAAGG - Intronic
997859282 5:137401732-137401754 AGACCCTGACTCAAAAAGAAAGG + Intronic
997937018 5:138121406-138121428 ACACCCTGTCTCAAAAAAAAAGG + Intronic
998611762 5:143696597-143696619 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
998926935 5:147136923-147136945 AAACTCTGTCTCAAAAAAAATGG - Intergenic
999085189 5:148881977-148881999 AAAGAATGTTTCAAAAAGAGAGG - Intergenic
999349139 5:150850568-150850590 AGACCCTGTCTCAAAAAAGGGGG - Intronic
999360104 5:150976966-150976988 AGGCCCTGTCTCAAAAAAAGAGG + Intergenic
999788457 5:154913805-154913827 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1000070100 5:157732436-157732458 AGACCCTGTCTCAGAAAAAGAGG + Intronic
1000102476 5:158029689-158029711 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1000117478 5:158166959-158166981 AGACCCTGTCCCAAAAAAAGTGG - Intergenic
1000207023 5:159071549-159071571 CAATCCTGTTTCAAAAACAGGGG + Intronic
1000664654 5:163980077-163980099 AAACCCTGCATTAAAAAGTCAGG - Intergenic
1001608280 5:172979647-172979669 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1001781037 5:174369441-174369463 AAAATCTGTCTCAAAAAAAGAGG - Intergenic
1002130085 5:177075693-177075715 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1003104332 6:3202942-3202964 AGACCCTGTCTCAAAAAAGGAGG + Intergenic
1003812752 6:9803348-9803370 AGACCCTGTCTCAATAAAAGGGG - Intronic
1004224572 6:13773856-13773878 AGACCCTGTCTCAAAAACAAGGG + Intergenic
1004383498 6:15152233-15152255 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1004469187 6:15913726-15913748 AGACCCTGTCTCAAAAAGGAAGG + Intergenic
1004688514 6:17971429-17971451 AGACCCTGTGTCAAAAAAAAAGG - Intronic
1005079760 6:21945027-21945049 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1005150435 6:22742640-22742662 AAACCATGTTTCTAAAAGAAAGG - Intergenic
1005310700 6:24556218-24556240 AGACCCTGTCTCAAAAAAAATGG - Intronic
1005601840 6:27434028-27434050 AGACCCTGTCTCAAACAAAGAGG - Intergenic
1005991554 6:30905992-30906014 AGACCCTGTCCCAAAAGGAGAGG - Intergenic
1006479894 6:34283674-34283696 AAACCCTGCCTCTAAAAGGGCGG - Exonic
1006624711 6:35389174-35389196 AGACCCTGTCTCAAAAAAAGCGG + Intronic
1006739973 6:36301128-36301150 AGAACCTGTCTCAAAAATAGTGG - Intronic
1006975612 6:38098070-38098092 AGACCCTATCTCAAAAAGCGGGG - Intronic
1007020169 6:38511980-38512002 AAACTCCGTCTCAAAAAAAGGGG - Intronic
1007533352 6:42563066-42563088 AGACCCTGTATCAAAAAAGAAGG - Intergenic
1009490040 6:64278771-64278793 AGACCCTATCTCAGAAAGAGAGG - Intronic
1010233726 6:73557808-73557830 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1010620245 6:78064614-78064636 GAACCCTATAACACAAAGAGTGG - Intergenic
1010627719 6:78158916-78158938 AAAGCCTGGAAAAAAAAGAGAGG - Intergenic
1011130984 6:84051711-84051733 AGACCTTGTCTCAAAAAAAGGGG + Intronic
1011283671 6:85702275-85702297 AGACCCTGTTTCAAAAAGGAAGG - Intergenic
1011361024 6:86525384-86525406 AAACTCTGTAGCAAAATTAGCGG + Intergenic
1011417453 6:87137369-87137391 AGATCCTGTCTCAAAAAAAGAGG - Intergenic
1011484816 6:87830212-87830234 AGACCCTGTCTCAAAAGAAGAGG - Intergenic
1011581033 6:88865358-88865380 AAACCCTGAATAAAACAGAAAGG + Intronic
1011644784 6:89447243-89447265 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1011661593 6:89599361-89599383 AGACCCTGTCTCAAAATGAGTGG + Intronic
1012256399 6:97037925-97037947 ACACCATGTATTAAAAAGACTGG - Intronic
1012887454 6:104861390-104861412 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013435817 6:110105403-110105425 AAACCTTGTTTCAAAATGAGAGG + Exonic
1014231932 6:118913607-118913629 AGACCCTGTCTCAAAAAAACAGG - Intronic
1015816087 6:137212265-137212287 AGACTCTGTCTCAAAAGGAGGGG - Intronic
1015828990 6:137347009-137347031 CAACCCTGCCTCAAAAAGAAAGG + Intergenic
1015876341 6:137826393-137826415 AAAACCTGAATCAATAAGTGAGG + Intergenic
1016108552 6:140192145-140192167 AAATCCTGGATCCAAAAAAGGGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017155494 6:151319415-151319437 ACACCCTGAATCTAAAAGACAGG + Intronic
1017885659 6:158597508-158597530 AAACCCTGTCTCAAAAAAGGGGG - Intronic
1018015642 6:159710436-159710458 AGACTCTGTCTCAAAAAAAGAGG + Intronic
1018168542 6:161124978-161125000 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019436280 7:1023848-1023870 AGACCGTGTATCAAAAGGAAAGG - Intronic
1019684238 7:2371759-2371781 ACACCCTGTTTAAAAAAAAGGGG - Exonic
1019987755 7:4670207-4670229 AAATGCTGTATCAGAGAGAGGGG - Intergenic
1020036349 7:4965552-4965574 AGACCCTGTCTCAAAAAAATGGG - Intergenic
1020100716 7:5393000-5393022 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1020262821 7:6540121-6540143 AAACTCCGTCTCAAAAAGAAAGG - Intronic
1021602240 7:22375853-22375875 AAACCCTGGAACAACAACAGTGG - Intergenic
1021649322 7:22818276-22818298 AGACTCTGTCTCAAAAAGAAAGG - Intronic
1021724298 7:23534495-23534517 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1022724942 7:32972725-32972747 AAACTTTGTCTCAAAAAGGGTGG - Intronic
1022931001 7:35114542-35114564 AACCAGTGTATCAGAAAGAGAGG - Intergenic
1023059087 7:36312126-36312148 AGACCCTGTCTCAAAAACAGTGG - Intergenic
1023297058 7:38726194-38726216 AAAAACAGTCTCAAAAAGAGTGG + Exonic
1023386851 7:39667049-39667071 AGACCTGGCATCAAAAAGAGTGG - Intronic
1023953487 7:44866949-44866971 AGACCCTGTCTCAAAAGAAGGGG - Intergenic
1024176889 7:46849546-46849568 AGATCCTGTCTCAAAAAAAGAGG - Intergenic
1024607360 7:51033186-51033208 AAAACCTGTAGCAACAAGTGTGG - Intronic
1024678629 7:51660863-51660885 CAACCCTGTTTCCAAATGAGGGG + Intergenic
1024788365 7:52934137-52934159 AAACCCCATCTCAAAAAAAGAGG + Intergenic
1025048658 7:55715109-55715131 AAACTTTGTCTCAAAAAGGGTGG + Intergenic
1025795150 7:64732694-64732716 AGACTCTGTCTCAAAAAGGGGGG - Intergenic
1025950961 7:66145145-66145167 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1026306551 7:69147455-69147477 AGACCCTGTCTCAAAAAGAGTGG + Intergenic
1026347157 7:69483915-69483937 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1026852613 7:73734685-73734707 AGACGTTGTCTCAAAAAGAGAGG - Intergenic
1026912636 7:74100225-74100247 AAACCCTGTCTCAAAAAAATGGG + Intronic
1026919430 7:74144382-74144404 AGACCCTGTCTCAAAGAAAGGGG - Intergenic
1027125674 7:75555169-75555191 AGACCCTATCTCAAAAAGCGGGG + Intronic
1027184437 7:75962301-75962323 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1027522559 7:79228331-79228353 AGACCCTGTCTCAAAAAAACAGG + Intronic
1027795691 7:82691048-82691070 AAATCCTGCATCAAAAAGACAGG - Intergenic
1028153290 7:87400569-87400591 AAACCCTGCATTAGAATGAGGGG - Intergenic
1028286165 7:89003993-89004015 AAAGTATGTAACAAAAAGAGAGG + Intronic
1028559124 7:92154247-92154269 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1028585281 7:92446347-92446369 AAACCCAGGATCATGAAGAGAGG + Intergenic
1028594738 7:92536118-92536140 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1029058428 7:97771383-97771405 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1029133311 7:98350094-98350116 AGACCCTGCCTCAAAAAGGGGGG + Intronic
1029330301 7:99848000-99848022 AAACTCTGTCTCAAAAAAAAGGG + Intronic
1029461930 7:100699702-100699724 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1029528457 7:101109607-101109629 AGACCCTGTTTCAAAAAAAAAGG - Intergenic
1029728091 7:102421496-102421518 AAACCCTGTCTCAAAAAAAAAGG + Intronic
1029826903 7:103207021-103207043 AACCAGTGTATCAAAAAGAGAGG - Intergenic
1029838691 7:103339845-103339867 AAACTCTATCTCAAAAAAAGGGG - Intronic
1030557129 7:111040158-111040180 AAACTCTGTCTCAAAAAAAAGGG + Intronic
1030627384 7:111859026-111859048 AGACCCTGTCTCAAAAAAAGGGG - Intronic
1031026029 7:116680930-116680952 AGACCCTGTCTCAGAAAAAGTGG + Intronic
1031678312 7:124638536-124638558 GAAACATGTATCAAAAAGATAGG - Intergenic
1032964841 7:137084235-137084257 AAACCCAGGAACAAATAGAGAGG + Intergenic
1033151575 7:138919260-138919282 AAAGGCTGTATCAAAAGTAGTGG + Exonic
1033192260 7:139292241-139292263 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1034507767 7:151508664-151508686 AAACCCTGTCTCTACAAAAGTGG - Intronic
1034601860 7:152266252-152266274 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1034684477 7:152958142-152958164 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
1034763943 7:153699855-153699877 AGACCCTGTCTCCAAAAAAGGGG + Intergenic
1035767044 8:2114481-2114503 AGACTCTGTCTCAAAAAAAGGGG - Intronic
1036557310 8:9871592-9871614 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
1036576741 8:10034482-10034504 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1037850310 8:22322260-22322282 CAACCCTGTCTCAAAAAAAAAGG - Intronic
1037946809 8:22994771-22994793 AGACTCTGTCTCAAAAAGAAAGG - Intronic
1038199046 8:25394875-25394897 AGTCCCTGTGTCAAAAAGATTGG - Intronic
1038529188 8:28303607-28303629 AAACTCTGTCTCAAAAAAAAGGG + Intergenic
1038794354 8:30696707-30696729 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1038795315 8:30704314-30704336 AGACCCTCTCTCAAAAAGACTGG + Intronic
1039463507 8:37765167-37765189 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1039553197 8:38457971-38457993 AGATTCTGTCTCAAAAAGAGAGG + Intronic
1039825036 8:41165891-41165913 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1039975861 8:42364247-42364269 AGACCCTGTTTCAAAAAAAAAGG - Intronic
1041343593 8:56871842-56871864 ATAACCTGTCTCAAAAAGAAGGG - Intergenic
1042254934 8:66792902-66792924 ACACCCTGTCTCTAAAAGAAAGG + Intronic
1043290155 8:78588889-78588911 AGACCCTGTCTCAAAAAGAAAGG + Intronic
1043306249 8:78800305-78800327 AAACCCTGTCTCAAAAAGAGAGG - Intronic
1043477696 8:80621469-80621491 AGGCCCTGTCTCAAAAAGAAAGG - Intergenic
1044041042 8:87368625-87368647 AAAACCTATCTCAAAAAGAGAGG + Intronic
1044199081 8:89413115-89413137 AAATCCTGTATCAACATCAGTGG - Intergenic
1044421008 8:91995775-91995797 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1044561936 8:93620801-93620823 AGACCCTTTCTCAAAAAAAGGGG + Intergenic
1044667746 8:94648245-94648267 AGACCCTGTCTCAAAAAAAGTGG + Intronic
1044926958 8:97217558-97217580 AAAACATGTATTAAGAAGAGTGG - Intergenic
1045299349 8:100897843-100897865 AGACCTTGTCTCAAAAAAAGGGG - Intergenic
1045792211 8:105996627-105996649 AACTCCTGTATCACAATGAGAGG + Intergenic
1046391881 8:113584921-113584943 TAACTCTATATGAAAAAGAGTGG - Intergenic
1046474236 8:114719680-114719702 AATACCTGTTTCAAGAAGAGTGG - Intergenic
1047039360 8:120975420-120975442 AAACCCTGAATCCTAAGGAGGGG - Intergenic
1047403442 8:124565224-124565246 AAACCCTGAAACAAAAATATGGG + Intronic
1048082752 8:131147085-131147107 AAATCCTGTATAACACAGAGTGG - Intergenic
1048399911 8:134055636-134055658 ACACCAAGTATCAAAAAAAGAGG + Intergenic
1048425803 8:134322389-134322411 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1048461436 8:134624646-134624668 AAACTCTGTCTCAAAAAAATAGG + Intronic
1049098551 8:140563240-140563262 AGACCCTGTCTCAACAAAAGTGG - Intronic
1049727962 8:144159347-144159369 AAACTCCGTGTCAAAAAGAAAGG + Intronic
1049866331 8:144940085-144940107 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050874674 9:10619147-10619169 AGACCCTGTTTCAAAAGAAGGGG - Intergenic
1051088451 9:13379121-13379143 AAACCCTGTTTCAAAAAAGAAGG + Intergenic
1051149655 9:14066523-14066545 AAACCCTGTCTCTAAAAGAAAGG + Intergenic
1051464230 9:17359027-17359049 AGACCTTATTTCAAAAAGAGAGG - Intronic
1052903514 9:33815732-33815754 AGACCCTGTCTCAATAAAAGGGG + Intergenic
1053224390 9:36340393-36340415 TAACCCTGTCTCAAAAAACGGGG - Intronic
1053254528 9:36604651-36604673 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1053440163 9:38109390-38109412 AAATCCTGTCTCAAAAAAAAGGG - Intergenic
1053488192 9:38477905-38477927 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1053799105 9:41753214-41753236 AATCCCTGAATGAAAAGGAGGGG + Intergenic
1054146109 9:61561784-61561806 AATCCCTGAATGAAAAGGAGGGG - Intergenic
1054187519 9:61965273-61965295 AATCCCTGAATGAAAAGGAGGGG + Intergenic
1054465839 9:65492863-65492885 AATCCCTGAATGAAAAGGAGGGG - Intergenic
1054650998 9:67623307-67623329 AATCCCTGAATGAAAAGGAGGGG - Intergenic
1054697868 9:68378776-68378798 CAACACTGTAGGAAAAAGAGAGG - Intronic
1054937601 9:70705295-70705317 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1054939292 9:70723288-70723310 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1055117675 9:72623263-72623285 AAGTCCTCTATCAAAAAGTGTGG + Intronic
1056397562 9:86195696-86195718 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1056770286 9:89473554-89473576 AGACCCTGTCTCAAAAACAACGG + Intronic
1057214859 9:93222176-93222198 AGACCCTGCCTCAAAAAAAGGGG - Intronic
1057214940 9:93222689-93222711 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1057374236 9:94504048-94504070 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1057966175 9:99505491-99505513 AGACCCTGTCTCAAAAAAGGGGG + Intergenic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058596353 9:106620009-106620031 ATTCCCTGTGTCAAGAAGAGTGG - Intergenic
1058737463 9:107906993-107907015 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1058968297 9:110057141-110057163 AGACCCTGTCTCTAAAAAAGTGG - Intronic
1059294246 9:113255664-113255686 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1059449891 9:114364022-114364044 AAACCCTGTTAAAAAAAGTGGGG - Intronic
1059524471 9:114977669-114977691 AGACCCTGTCTCTAAAAGAGGGG - Intergenic
1060740499 9:126094863-126094885 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1060903423 9:127281765-127281787 AATGTCTGCATCAAAAAGAGGGG - Intronic
1060950926 9:127602179-127602201 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1061459817 9:130728393-130728415 AAACACTGTCTCAAAAAAAAAGG - Intronic
1061508124 9:131043920-131043942 CAGCCCAGTCTCAAAAAGAGGGG - Intronic
1061518115 9:131101354-131101376 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1062301477 9:135874461-135874483 AGACCCTGTCTCAAAAAAGGGGG + Intronic
1202803475 9_KI270720v1_random:24614-24636 AAACCATGTGTCAAGAAGGGGGG + Intergenic
1202803485 9_KI270720v1_random:24726-24748 AAACCATGTGTCAAGAAGGGGGG + Intergenic
1185981871 X:4788870-4788892 AAAGCCAGAATCAATAAGAGAGG + Intergenic
1186433581 X:9524759-9524781 AAACCCTGTCTCAAAACAAAAGG - Intronic
1187448351 X:19376453-19376475 AGACCCTGTCTCAAAAAGTTGGG - Intronic
1187908319 X:24087717-24087739 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1187995496 X:24922081-24922103 AGATCCTGTCTCAAAAAAAGGGG - Intronic
1188141406 X:26556938-26556960 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1188178694 X:27026382-27026404 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1188784284 X:34325280-34325302 AAATACTGTATCAAATACAGTGG + Intergenic
1188829516 X:34879174-34879196 AAAATCTGTATCAGAAAGTGTGG + Intergenic
1188937289 X:36192498-36192520 AAACCCAGGATCACACAGAGTGG - Intergenic
1190082140 X:47364953-47364975 ATACCCTGTCTAAAAAAGAAAGG - Intergenic
1190635767 X:52432368-52432390 AAATCCTGTCTGAAAAAGGGTGG - Intergenic
1190656691 X:52618853-52618875 AAAACCTATTTCAAAACGAGAGG + Intergenic
1190764352 X:53463796-53463818 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1191682779 X:63858198-63858220 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
1192000143 X:67141023-67141045 AAACCCTGAAAAAAAAAGAGAGG - Intergenic
1192425890 X:71076060-71076082 AAACTCCGTCTCAAAAAAAGAGG + Intergenic
1193677413 X:84472723-84472745 AAACCCTGAGTCAAAAAGTAAGG + Intronic
1193853077 X:86563403-86563425 AAACCCTGTATTACAACTAGTGG - Intronic
1194153850 X:90362459-90362481 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1194796131 X:98213195-98213217 AAACTCTCTAATAAAAAGAGTGG + Intergenic
1195077532 X:101341521-101341543 AAACTCTGTACTAAAAAGTGGGG - Intergenic
1196355168 X:114782706-114782728 AGACCCTGTATAAAAAAAAAAGG + Intronic
1196574064 X:117298036-117298058 AAACCTTTTATCGAAAAGACAGG - Intergenic
1197100076 X:122642414-122642436 AAACCAGGTATTAAAAAGCGTGG + Intergenic
1198340311 X:135707736-135707758 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1198343792 X:135740453-135740475 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1198515604 X:137403671-137403693 AGACCCTGTCTCTAAAAGAAAGG + Intergenic
1198577011 X:138021474-138021496 AAATGCTGTATCAAGAAAAGAGG - Intergenic
1199166085 X:144677486-144677508 TAACCCTGTATCTAAAATACAGG - Intergenic
1199513509 X:148649763-148649785 AAACCCTGAAGGAAAAAGAAAGG - Intronic
1199676303 X:150192333-150192355 AAAACTTGTATTGAAAAGAGTGG + Intergenic
1199703944 X:150407610-150407632 AAACACAGTATCAGAAAAAGTGG - Intronic
1199830477 X:151544729-151544751 AGACCCTGTCTCAAAAACAGAGG + Intergenic
1200241664 X:154498527-154498549 AGACCCTGTCTCAAAAACAGTGG - Intergenic
1201153851 Y:11112100-11112122 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1201372505 Y:13280378-13280400 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1201977798 Y:19871286-19871308 AAACCCTGTATCAGAAATGAAGG + Intergenic