ID: 964583402

View in Genome Browser
Species Human (GRCh38)
Location 3:158266754-158266776
Sequence AAACCCTGTATCAAAAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 1, 1: 1, 2: 12, 3: 107, 4: 730}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964583402_964583405 -6 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583405 3:158266771-158266793 GGGTTTCACTCCTGTTGCCCAGG 0: 28
1: 545
2: 12873
3: 23851
4: 30711
964583402_964583411 19 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583411 3:158266796-158266818 GGAGTGCAATGGTATGATCTCGG 0: 332
1: 11801
2: 59931
3: 120853
4: 151164
964583402_964583406 -2 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583406 3:158266775-158266797 TTCACTCCTGTTGCCCAGGCTGG 0: 336
1: 12496
2: 23138
3: 30273
4: 29449
964583402_964583408 8 Left 964583402 3:158266754-158266776 CCCCTCTTTTTGATACAGGGTTT 0: 1
1: 1
2: 12
3: 107
4: 730
Right 964583408 3:158266785-158266807 TTGCCCAGGCTGGAGTGCAATGG 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964583402 Original CRISPR AAACCCTGTATCAAAAAGAG GGG (reversed) Intronic