ID: 964584424

View in Genome Browser
Species Human (GRCh38)
Location 3:158280935-158280957
Sequence GAATCACTTTGGGCCAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1427
Summary {0: 1, 1: 1, 2: 18, 3: 177, 4: 1230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964584424_964584430 16 Left 964584424 3:158280935-158280957 CCGCGCCTGGCCCAAAGTGATTC 0: 1
1: 1
2: 18
3: 177
4: 1230
Right 964584430 3:158280974-158280996 ACTGGCTGTTTTGCAACAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 118
964584424_964584429 13 Left 964584424 3:158280935-158280957 CCGCGCCTGGCCCAAAGTGATTC 0: 1
1: 1
2: 18
3: 177
4: 1230
Right 964584429 3:158280971-158280993 TAGACTGGCTGTTTTGCAACAGG 0: 1
1: 0
2: 1
3: 6
4: 84
964584424_964584428 -2 Left 964584424 3:158280935-158280957 CCGCGCCTGGCCCAAAGTGATTC 0: 1
1: 1
2: 18
3: 177
4: 1230
Right 964584428 3:158280956-158280978 TCATTTTTATAAGATTAGACTGG 0: 1
1: 0
2: 0
3: 37
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964584424 Original CRISPR GAATCACTTTGGGCCAGGCG CGG (reversed) Intronic
900029207 1:358790-358812 GAATCCCTTTGGCCCAGAGGCGG + Intergenic
900049809 1:587562-587584 GAATCCCTTTGGCCCAGAGGCGG + Intergenic
900212864 1:1465299-1465321 TATTCATTGTGGGCCAGGCGCGG + Intronic
900673893 1:3872121-3872143 GACTCACTTCTGGCCGGGCGCGG + Intronic
900974443 1:6008328-6008350 GAATCACTCAGAGCCAGGCACGG + Intronic
901230477 1:7639267-7639289 GGACCAGTTTGGGCCGGGCGTGG - Intronic
901372334 1:8810288-8810310 AAATAACTTTAGGCCAGGCGCGG - Intronic
901499954 1:9646060-9646082 GTTTCACTTTCGGCCAGGTGCGG - Intergenic
901545635 1:9954640-9954662 GAAGGAATTTGGGCCAGGCATGG + Intronic
901718049 1:11172578-11172600 ATACAACTTTGGGCCAGGCGCGG + Intronic
902262590 1:15237958-15237980 GGAGCACTGTTGGCCAGGCGCGG + Intergenic
902358309 1:15924748-15924770 CAATGACTTTTGGCCAAGCGTGG - Intronic
902683850 1:18062845-18062867 GAATAGAGTTGGGCCAGGCGCGG - Intergenic
902801547 1:18833074-18833096 GAATCACTGTGAGCCAAGCAAGG - Intergenic
902978160 1:20104306-20104328 AAATAAATTTAGGCCAGGCGTGG + Intergenic
903068709 1:20715954-20715976 AAAACACCTTGGGCCAGGCGGGG + Intronic
903608732 1:24594180-24594202 TAATCACTCTGGGCCTGGCATGG - Intronic
903755979 1:25660979-25661001 GACACACTTTTGGCCAGGCATGG - Intronic
903883580 1:26528943-26528965 AAATCACTCTTGGCCGGGCGCGG + Intergenic
904209538 1:28877651-28877673 AAAACACTTTAGGCCGGGCGGGG + Intergenic
904240843 1:29144061-29144083 GAGTGATTTGGGGCCAGGCGCGG - Intergenic
904496226 1:30888355-30888377 GAATCACTTGAAGCCAGGTGAGG + Intronic
904513867 1:31037758-31037780 GCATCATTTAGGGCCGGGCGTGG + Intronic
904521137 1:31096867-31096889 AAATCTTTTTGGGCCGGGCGCGG + Intergenic
904667446 1:32133950-32133972 GAATTGCTTGAGGCCAGGCGTGG + Intronic
904720974 1:32508316-32508338 GGGTCACTGTGGGCCAGGCATGG + Intronic
904765250 1:32840868-32840890 GGATTATTTTCGGCCAGGCGCGG + Intronic
905211256 1:36375728-36375750 TCATAACTTTAGGCCAGGCGCGG + Intronic
905273241 1:36800731-36800753 GACTAACTTTGGGCTAGGTGAGG - Exonic
905423085 1:37861433-37861455 AAAACATTTTAGGCCAGGCGTGG + Intronic
905736888 1:40335181-40335203 GAAACATTTTGGGCCAGGCGCGG + Intergenic
905747401 1:40430172-40430194 GAAAAAATTTGGGCCAGGCATGG + Intergenic
905760846 1:40556793-40556815 GAAAGGTTTTGGGCCAGGCGCGG + Intergenic
905773068 1:40650570-40650592 GTACCACCTTGGGCCGGGCGTGG + Intronic
905952412 1:41963299-41963321 GAAAAACTTTTGGCCGGGCGCGG - Intronic
906015760 1:42577928-42577950 ACATCACTATGGGCCAGGCGCGG - Intronic
906298464 1:44663528-44663550 CAATGACTTTTGGCCAGGTGCGG - Intronic
906324659 1:44837688-44837710 GAATGCTTTTAGGCCAGGCGTGG - Intronic
906548278 1:46638326-46638348 AAAGAAGTTTGGGCCAGGCGTGG + Intronic
906829410 1:49015712-49015734 AAATCACTTGAGGCCAGGCGCGG - Intronic
907038111 1:51234702-51234724 TCATAATTTTGGGCCAGGCGTGG - Intergenic
907039275 1:51243727-51243749 GAATCATTAAGGGCCGGGCGTGG - Intronic
907088437 1:51701228-51701250 GAATTACAATGGGCCGGGCGCGG - Intronic
907142685 1:52202974-52202996 TAATCACTTTGGGCTGTGCGCGG - Intronic
907254643 1:53169619-53169641 AATTCATTGTGGGCCAGGCGTGG + Intergenic
907433680 1:54430254-54430276 GAAACACCTTGGGTTAGGCGTGG + Intergenic
907914589 1:58856887-58856909 GCTTCACGTTGGGCCAGGCACGG - Intergenic
908221329 1:62009792-62009814 AAACCACTTTTGGCCAGGCCTGG + Intronic
908245597 1:62225344-62225366 AAATACCTTTTGGCCAGGCGTGG - Intergenic
908456160 1:64306950-64306972 GACTCAATTTTGGCCAGGTGTGG - Intergenic
908546800 1:65170084-65170106 AGATCAGTTTTGGCCAGGCGTGG + Intronic
908784853 1:67724678-67724700 GAATAGAATTGGGCCAGGCGCGG - Intronic
908841633 1:68285831-68285853 GAATAAATCTCGGCCAGGCGCGG - Intergenic
908859430 1:68466345-68466367 GGATCACTTGAGGCCAGGAGTGG + Intergenic
909046311 1:70714301-70714323 GAATCACTTCTGGCCAGGAGAGG + Intergenic
909160011 1:72135084-72135106 AAATAACTTTCGGCCGGGCGTGG + Intronic
909259250 1:73465739-73465761 GAATCACTTTGGCCAAGAGGGGG + Intergenic
909361070 1:74759435-74759457 CAATCACTTCTGGCCAGGCCAGG - Intronic
909450723 1:75795623-75795645 TACTCATTTTAGGCCAGGCGTGG - Intergenic
909453237 1:75821989-75822011 GAATCATTGCTGGCCAGGCGCGG + Intronic
909484181 1:76155346-76155368 GAATTACTATGTGCCAGGCATGG + Intronic
909487254 1:76188071-76188093 TAATCTGTATGGGCCAGGCGCGG + Intronic
909506053 1:76391228-76391250 TAAGCATTTTGGGCCAGGCGAGG - Intronic
909636568 1:77823129-77823151 GAATCATGCTGGGCCGGGCGTGG - Intronic
910656165 1:89621168-89621190 AAATTCCTTTTGGCCAGGCGCGG + Intergenic
910944061 1:92569563-92569585 GAAATATTTTGGGCCAGGCGCGG + Intronic
911004874 1:93209246-93209268 AAAACATTTTAGGCCAGGCGTGG - Intronic
911610703 1:99956556-99956578 GAATCATTATAGGCCGGGCGCGG - Intergenic
911704198 1:100991804-100991826 GTCTCACAGTGGGCCAGGCGTGG + Intronic
911839396 1:102660930-102660952 GAATTATTCTTGGCCAGGCGTGG + Intergenic
911952898 1:104198802-104198824 AAACCACTGTAGGCCAGGCGCGG + Intergenic
912030938 1:105242685-105242707 TAGTCACTTTAGGCCGGGCGTGG - Intergenic
912407364 1:109451905-109451927 AAATCCATTTAGGCCAGGCGTGG + Intergenic
912535128 1:110362322-110362344 GAAGCATTTTGGACCAGGCATGG + Intergenic
912767191 1:112425049-112425071 GGATCACTTGGGTCCAGGCCAGG - Intronic
912834307 1:112982151-112982173 GGATCACTTGAGGCCAGGCCAGG + Intergenic
912991745 1:114494249-114494271 AAATGACATTGGGCCAGGCATGG - Intronic
913248650 1:116892772-116892794 CTATAACTTTGGGCCAGGCACGG + Intergenic
913468042 1:119163131-119163153 GAAACACTTTGTGGCAGGCCAGG - Intergenic
913684784 1:121221418-121221440 GAAAGACATTGGGCCAGGCACGG + Intronic
914036621 1:144009034-144009056 GAAAGACATTGGGCCAGGCACGG + Intergenic
914152833 1:145058912-145058934 GAAAGACATTGGGCCAGGCACGG - Intronic
914389738 1:147209127-147209149 GAATCATTTCAGGCCCGGCGCGG + Intronic
914460737 1:147881422-147881444 GAAATACTTTAGGCCAGGCATGG - Intergenic
914461229 1:147887219-147887241 TCATCACAATGGGCCAGGCGTGG - Intergenic
914792507 1:150890791-150890813 ATTTCACATTGGGCCAGGCGCGG - Intergenic
914854164 1:151338212-151338234 GATACAATTTGGGCCAGGTGCGG + Intergenic
914868297 1:151451614-151451636 TAATGGATTTGGGCCAGGCGCGG - Intronic
914948719 1:152090649-152090671 GTATGTCTCTGGGCCAGGCGTGG + Intergenic
915182213 1:154071924-154071946 GAATGAATTAGGGCCAGACGTGG - Intronic
915197564 1:154201284-154201306 TAATGCCTATGGGCCAGGCGCGG - Intronic
915198892 1:154211623-154211645 AAATAACATTGGGCCGGGCGCGG - Intronic
915287300 1:154861243-154861265 TAAGGACTTGGGGCCAGGCGCGG - Intronic
915406390 1:155663080-155663102 AAATTACTTCTGGCCAGGCGTGG + Intronic
915591395 1:156872965-156872987 GACCCAATCTGGGCCAGGCGCGG - Intronic
915619213 1:157069453-157069475 AAATAATTTAGGGCCAGGCGCGG - Intergenic
915909204 1:159901827-159901849 GAATCACTTGAAGCCAGGAGGGG + Intergenic
916277695 1:163012966-163012988 GAATGAATCTGGGCCAGGCGCGG - Intergenic
916303415 1:163301621-163301643 GACTCATTCTGGGCCTGGCGTGG - Intronic
916529182 1:165639510-165639532 GAAGCACTCTAGGCCTGGCGCGG + Intronic
916957136 1:169850505-169850527 AAAACACTTGGGGCCAGGCGCGG + Intronic
917114309 1:171586666-171586688 GAATCACTTGGACCCAGGAGGGG - Intronic
917123608 1:171665865-171665887 AAACAACTTTGGGCCGGGCGTGG - Intergenic
917293947 1:173499587-173499609 AAAACATTTAGGGCCAGGCGTGG - Intergenic
917704297 1:177616100-177616122 GGGGCACTGTGGGCCAGGCGCGG - Intergenic
917866468 1:179200335-179200357 AAAGCATTGTGGGCCAGGCGCGG - Intronic
918031721 1:180819930-180819952 GAATCACTTGGACCCAGGAGGGG + Intronic
918254262 1:182734209-182734231 AAATAACTTGGGGCCAGGCACGG - Intergenic
918579703 1:186111357-186111379 GAATCACTCTGAGCCAGGTGTGG + Intronic
918952714 1:191160490-191160512 GAATCACTTGAGCCCAGGAGCGG + Intergenic
919459538 1:197860037-197860059 GAATCACTGAAGGCCAGGCATGG + Intergenic
919701019 1:200631083-200631105 GAATCATGTAGGGCCAGGCATGG + Intronic
919713871 1:200754870-200754892 AAAGCTCTTTCGGCCAGGCGCGG - Intronic
919987703 1:202687306-202687328 GGAGCACTTAGGGCCAGGTGGGG - Intronic
920104338 1:203540427-203540449 GAAACTCTTGGGGCCAGGTGCGG + Intergenic
920135778 1:203768221-203768243 GAATCACTTGGACCCAGGAGGGG + Intronic
920320102 1:205113973-205113995 GATTCAAATAGGGCCAGGCGCGG - Intronic
920472096 1:206239973-206239995 GAAAGACATTGGGCCAGGCACGG + Intronic
920771915 1:208894414-208894436 AAAAAATTTTGGGCCAGGCGTGG + Intergenic
921020652 1:211232542-211232564 GAATTAGTGTGGGCCAGGCGCGG + Intergenic
921034324 1:211361977-211361999 TAATTACTGTGGGCCAGGCACGG - Intronic
921287879 1:213625142-213625164 AAATAACTTTTGGCCAGGCGTGG - Intergenic
921549017 1:216510593-216510615 TAATCATTGTGGGCCAGGTGCGG + Intronic
921856074 1:219985693-219985715 GAAAAACTTGAGGCCAGGCGTGG - Intronic
921862500 1:220054446-220054468 AAATCACTTTGGGCCCGGTGTGG + Intergenic
922641192 1:227233641-227233663 GAGCCATTTTGGGCCAGGCACGG + Intronic
923048601 1:230373970-230373992 AACTCACTTGTGGCCAGGCGTGG - Intronic
923097616 1:230788141-230788163 AAAGCACCTGGGGCCAGGCGTGG - Intronic
923372858 1:233329361-233329383 GTCTCTCTATGGGCCAGGCGCGG + Intronic
923489445 1:234470904-234470926 GCACAATTTTGGGCCAGGCGTGG - Intronic
923559691 1:235029161-235029183 GCATTCCTTGGGGCCAGGCGCGG - Intergenic
924043400 1:240005751-240005773 GAATCACGTTTGGTCAGGCATGG + Intergenic
924103049 1:240623800-240623822 TAAGAACTATGGGCCAGGCGCGG - Intergenic
924104694 1:240638432-240638454 AAATAACTTTAGGCCGGGCGCGG - Intergenic
924327875 1:242913758-242913780 AAATCACTATGGGCCGGGCGCGG + Intergenic
924360575 1:243237609-243237631 GTATCACTATAGGCCAGGCATGG + Intronic
924534949 1:244927594-244927616 AAAGCACTGTGGGCCAGGTGCGG - Intergenic
924591500 1:245408643-245408665 GAATCATTTGGGGCCGGACGCGG - Intronic
924857388 1:247887519-247887541 GAAACACTTTTGGCCAGGTGCGG - Intergenic
924898428 1:248368626-248368648 AAATCATTTGGGGCCAGGCATGG + Intergenic
1062790768 10:303811-303833 AAAAAACTTTCGGCCAGGCGCGG - Intronic
1063377245 10:5561650-5561672 GCTTCACTGTGGGCCGGGCGCGG + Intergenic
1063408104 10:5815392-5815414 GGATCACTTGGGGCCAGGAGTGG + Intronic
1063658979 10:8020294-8020316 GTATGAATGTGGGCCAGGCGCGG - Intergenic
1063838684 10:10045976-10045998 AAATCTTTTTGGGCCGGGCGTGG + Intergenic
1063976664 10:11423226-11423248 GAACCTGTTGGGGCCAGGCGCGG - Intergenic
1063995570 10:11615286-11615308 TAAAGGCTTTGGGCCAGGCGTGG - Intergenic
1064103394 10:12481796-12481818 GAAAGAGTTTAGGCCAGGCGTGG - Intronic
1064201209 10:13286423-13286445 GAACTACTGTTGGCCAGGCGCGG + Intronic
1064203518 10:13303392-13303414 GCATCAGTTTGGGCCGGGTGCGG - Intergenic
1064413358 10:15127255-15127277 AAATAACTTTTCGCCAGGCGTGG + Intronic
1064459839 10:15523617-15523639 ATACCACTTTGGGCCAGGTGTGG + Intronic
1064466392 10:15586347-15586369 AAATCACTTTATGCCAGGCGCGG - Intronic
1064741906 10:18442438-18442460 GAACCAGATTCGGCCAGGCGTGG - Intronic
1065029678 10:21572899-21572921 AAATAATTTTAGGCCAGGCGTGG - Intronic
1065155984 10:22870612-22870634 AAATCAACGTGGGCCAGGCGTGG - Intergenic
1065403077 10:25329144-25329166 GATGCATTTTAGGCCAGGCGCGG + Intronic
1065512166 10:26490332-26490354 GTATCTTTATGGGCCAGGCGTGG + Intronic
1065569792 10:27058864-27058886 AAATCACTGTGGGCTGGGCGCGG - Intronic
1065712049 10:28528174-28528196 AAGTCCCTTTTGGCCAGGCGTGG + Intergenic
1065713454 10:28539847-28539869 ACTTCACTATGGGCCAGGCGCGG - Intronic
1065876899 10:30005011-30005033 GGATAAATGTGGGCCAGGCGAGG - Intergenic
1065975240 10:30836021-30836043 GAGACAATTTAGGCCAGGCGCGG + Intronic
1066023817 10:31331374-31331396 TTAACACTTCGGGCCAGGCGTGG - Intronic
1066389676 10:34968655-34968677 AAATCTCTCTGGGCTAGGCGTGG - Intergenic
1066395561 10:35017998-35018020 AAATGAAATTGGGCCAGGCGTGG + Intronic
1066563622 10:36696497-36696519 GAAACAGTCAGGGCCAGGCGTGG - Intergenic
1066592138 10:37006907-37006929 TAATGACATTGGGCCGGGCGTGG - Intergenic
1066698760 10:38104098-38104120 GAAACACATGGGGCCAGGGGTGG - Intronic
1066972384 10:42323167-42323189 GAGTAAAGTTGGGCCAGGCGAGG - Intergenic
1067250561 10:44582969-44582991 GTATCCTTTTGGGCCAGGTGCGG + Intergenic
1067710194 10:48643855-48643877 GAAACATTCTGGGCCAGGCGTGG + Intronic
1067770034 10:49116089-49116111 AAATCACTTTAGCCCAGGCCTGG - Intergenic
1068675925 10:59769758-59769780 GAATGCATTTGGGCCAGCCGCGG + Intergenic
1069040558 10:63691458-63691480 GAATGACCATGGGCCAGGCGTGG + Intergenic
1069218463 10:65852909-65852931 GTATCAATTCAGGCCAGGCGCGG + Intergenic
1069457513 10:68564437-68564459 GAATAATTTTTGGCCAGGCGTGG - Intronic
1069485822 10:68822472-68822494 TAAGAACTTTGGGCCAGGCGTGG - Intergenic
1069557984 10:69410224-69410246 GAAACAGTGTAGGCCAGGCGTGG + Intronic
1069682635 10:70296189-70296211 GAAACACACTGGGCCAGGCGTGG + Intergenic
1069829376 10:71273177-71273199 CAAGCACTGTGGGCCGGGCGCGG - Intronic
1070190305 10:74106006-74106028 GAATCACTTGAATCCAGGCGGGG - Intronic
1070208926 10:74294575-74294597 ATAACACTTTGGGCCAGGGGTGG - Intronic
1070403709 10:76076051-76076073 TAATAACTTTGGGCTGGGCGCGG + Intronic
1071131674 10:82400864-82400886 GAGTCAATCTGGGCCAGGCATGG - Intronic
1071817580 10:89248768-89248790 TAATTCCTTTGGGCCGGGCGCGG - Intronic
1071832772 10:89388394-89388416 GAATTTTTTTCGGCCAGGCGCGG - Intronic
1071868301 10:89762989-89763011 ATATCACTGTGGGCCAGGCGTGG + Intronic
1071995283 10:91142285-91142307 AAACAACTTTTGGCCAGGCGTGG + Intergenic
1072110769 10:92318039-92318061 GATTCACATTGGGCCAGGCATGG - Intronic
1072131247 10:92496163-92496185 GAAACACTTTAGGCCAGGCGTGG - Intronic
1072184221 10:93019268-93019290 AAATCATTTTGGGCCAAGTGTGG - Intronic
1072629091 10:97133260-97133282 GATACACACTGGGCCAGGCGCGG + Intronic
1072734409 10:97869297-97869319 GACTCACTGTGGGCCTGGGGAGG + Exonic
1072766191 10:98096887-98096909 GGATCACTTTGGGGCTGGAGGGG + Intergenic
1072897757 10:99381449-99381471 AAACCTCTTTAGGCCAGGCGCGG + Intronic
1072934771 10:99701576-99701598 AAATCACTTTTGGCCGGGCCCGG - Intronic
1072983703 10:100121467-100121489 AAGTTAATTTGGGCCAGGCGCGG + Intergenic
1073246975 10:102097933-102097955 TGACCACATTGGGCCAGGCGCGG - Intergenic
1073347822 10:102797839-102797861 AAATCAACTTTGGCCAGGCGCGG - Intronic
1073451127 10:103609990-103610012 ACATCACTTTGGGCCCAGCGAGG + Intronic
1074057190 10:109933392-109933414 GAAGAAATTTCGGCCAGGCGCGG + Intergenic
1074334831 10:112560885-112560907 TAAGCACTTCTGGCCAGGCGCGG - Intronic
1074339248 10:112610624-112610646 GAATTACATTCGGCCGGGCGCGG + Intronic
1074443752 10:113501016-113501038 AAAAAAGTTTGGGCCAGGCGTGG + Intergenic
1074740326 10:116480119-116480141 AAATTATTTTTGGCCAGGCGCGG + Intergenic
1075702569 10:124478757-124478779 GATCCAGTTTGGGCCAGGCGCGG + Intronic
1075764016 10:124878692-124878714 AAATGACTTTTGGCCAGGCTTGG + Intergenic
1075770386 10:124929626-124929648 GAATCTGTGTTGGCCAGGCGCGG - Intergenic
1075894282 10:125981215-125981237 AAGTCACTTTTGGCCAGGCATGG + Intronic
1076506528 10:130977838-130977860 AAATCACTTGGGGCCAGGCCCGG + Intergenic
1077193106 11:1263836-1263858 TAAACACAGTGGGCCAGGCGCGG + Intergenic
1077602234 11:3581671-3581693 GCATCACTGTGGACCAGGCGTGG + Intergenic
1078216028 11:9312613-9312635 GAATAATTGTAGGCCAGGCGTGG + Intronic
1079034138 11:17007863-17007885 GAATATCTTTAGGCCGGGCGTGG - Intronic
1079216415 11:18516649-18516671 AAATCACCATCGGCCAGGCGCGG + Intronic
1079293942 11:19214909-19214931 TCATCACTTTAGGCCAGGTGTGG + Intergenic
1079400441 11:20102569-20102591 GCATCACTTAGAGCCAGGCAGGG - Intronic
1080374257 11:31689216-31689238 GGATCACTTGAGGCCAGGAGTGG + Intronic
1080453445 11:32397608-32397630 GATGCACTTTAGGCCAGGCATGG - Intronic
1081223790 11:40496118-40496140 AAGACACTTTTGGCCAGGCGTGG - Intronic
1081571183 11:44292105-44292127 GAGTATATTTGGGCCAGGCGAGG - Intronic
1081633298 11:44703601-44703623 AACTCACTTGGGGCCAGGCATGG + Intergenic
1081888262 11:46518137-46518159 GAATTACTCACGGCCAGGCGCGG + Intronic
1081943346 11:46964573-46964595 AAAGCACTGTGGGCCAGGCGCGG - Intronic
1082264759 11:50106722-50106744 AAAGCACTTGTGGCCAGGCGCGG - Intergenic
1082840318 11:57684263-57684285 GAGTAATTTTGGGCCAGGCGCGG - Intronic
1082937313 11:58668411-58668433 GAATAATATTGGGCCAGGTGCGG + Intronic
1083352521 11:62041029-62041051 GGATCACTTTGGGCCGGGTGTGG + Intergenic
1083451817 11:62751311-62751333 GAATCGCTTGAGGCCAGGCACGG + Exonic
1083455234 11:62774364-62774386 GAACAAATTTGGGCCGGGCGCGG - Intronic
1083643506 11:64158531-64158553 AAACCACTTTGGGCCAGGCGTGG - Intronic
1083870442 11:65484542-65484564 GAATAGTTTAGGGCCAGGCGCGG - Intergenic
1084258134 11:67956222-67956244 GCATCTCTGTGGACCAGGCGTGG + Intergenic
1084292459 11:68183024-68183046 GAATTACAATGGGCCAGGTGCGG - Intronic
1084737517 11:71115176-71115198 GCATCAATTTTGGCCGGGCGTGG + Intronic
1084897985 11:72289177-72289199 GAATCACTTCTGGCCGGGCGTGG - Intergenic
1084914704 11:72420053-72420075 AAAACACTTTTAGCCAGGCGTGG + Intronic
1084919955 11:72461071-72461093 AAAATACTTTTGGCCAGGCGCGG + Intergenic
1084924076 11:72497605-72497627 GAAGTTCTTTTGGCCAGGCGTGG - Intergenic
1085077382 11:73603546-73603568 GAATTGCTCTAGGCCAGGCGTGG + Intergenic
1085101404 11:73803419-73803441 AAATCACTCTAGGCCAGGTGTGG - Intronic
1085218240 11:74850823-74850845 GAATGGCTATGGGCCAGGCGTGG - Intronic
1085324131 11:75593756-75593778 CAATAACTATGGGCCAGGCTTGG + Intronic
1085382915 11:76136786-76136808 GAAACCCTATGGGCCAGGTGTGG - Intronic
1085441652 11:76569544-76569566 TACGCACATTGGGCCAGGCGTGG + Intergenic
1085586649 11:77714552-77714574 GAAGCACTAGAGGCCAGGCGTGG + Intronic
1085775166 11:79358839-79358861 CAACCACTATGGGCCAGGCACGG + Intronic
1085896103 11:80641605-80641627 TAATGACATTGGGCCGGGCGCGG + Intergenic
1086195869 11:84138656-84138678 CATTCACTTTAGGCCAGGCACGG + Intronic
1086198255 11:84167954-84167976 TATTCATCTTGGGCCAGGCGTGG - Intronic
1086371949 11:86163867-86163889 GAACAACTTTTGGCCTGGCGCGG - Intergenic
1086838745 11:91658517-91658539 AAAATACTTTTGGCCAGGCGCGG + Intergenic
1086910663 11:92468100-92468122 GCCTCACTTTGGGCCAGGTCGGG + Intronic
1087032360 11:93718199-93718221 GAAACAATCTGGACCAGGCGTGG - Intronic
1087287614 11:96281957-96281979 TAATGACTGTAGGCCAGGCGCGG + Intronic
1087638889 11:100734221-100734243 GCTTTGCTTTGGGCCAGGCGCGG - Intronic
1087768567 11:102182107-102182129 CAACCACTTAGGGCCAGGCATGG - Intronic
1087771100 11:102211043-102211065 GAAACACTTCAGGCCAGACGTGG - Intronic
1087875694 11:103353886-103353908 AAATCTCTTTGGGCCGGGTGCGG + Intronic
1088104224 11:106187593-106187615 GAAGAAATTTTGGCCAGGCGTGG + Intergenic
1088290104 11:108226860-108226882 AAAGCACTCTTGGCCAGGCGTGG - Intronic
1088304290 11:108391667-108391689 AATTCATTGTGGGCCAGGCGTGG - Intronic
1088307108 11:108422216-108422238 GAATAAGTGTCGGCCAGGCGCGG - Intronic
1088339665 11:108748952-108748974 AAATGAGTTTAGGCCAGGCGTGG - Intronic
1088483765 11:110321182-110321204 GGATCCATTAGGGCCAGGCGTGG - Intergenic
1088610032 11:111568093-111568115 GACCCAATTTTGGCCAGGCGTGG + Intergenic
1088623557 11:111711409-111711431 AAATCATTTAAGGCCAGGCGCGG - Intronic
1088642243 11:111884181-111884203 GAATTATTTTAGGCCAGGCACGG + Exonic
1088717223 11:112559448-112559470 GAAAAACAATGGGCCAGGCGTGG + Intergenic
1089358307 11:117870169-117870191 GACTCCCTCTGGGCAAGGCGCGG - Intronic
1089500100 11:118926880-118926902 AAAGCGCTTTGGGCCGGGCGCGG - Intronic
1089517676 11:119044137-119044159 GAAAAATTTTGGGCCAGGCATGG - Intergenic
1090212957 11:124935818-124935840 GAATGCCTTTGGGGCAGGAGTGG - Intronic
1091098841 11:132850443-132850465 GAATCAATTAGGGCCAGACAGGG + Intronic
1091738582 12:2943411-2943433 GAATCTATTTGGGCCAGGCACGG - Intergenic
1091845503 12:3653269-3653291 AAATCATCCTGGGCCAGGCGCGG - Intronic
1091977372 12:4836237-4836259 CAGTGACTTTTGGCCAGGCGTGG - Intronic
1092130245 12:6106581-6106603 TAATAAATTTTGGCCAGGCGCGG + Intronic
1092347160 12:7724975-7724997 GAAACACTTTTGACCAGGCATGG - Intergenic
1092371266 12:7918307-7918329 AGATCACTCTGGGCCAGGTGCGG + Intergenic
1092428377 12:8391024-8391046 GCATCACTGTGGACCAGGCGTGG + Intergenic
1092429458 12:8397175-8397197 GCATCACTGTGGACCAGGCGTGG + Intergenic
1092595678 12:10002169-10002191 GAATTTTTTTAGGCCAGGCGCGG - Intronic
1092809545 12:12260086-12260108 AAATAAATTTAGGCCAGGCGCGG + Intronic
1092825127 12:12391676-12391698 AGATCATTTTGTGCCAGGCGTGG - Intronic
1093449487 12:19298657-19298679 GACAAGCTTTGGGCCAGGCGCGG - Intronic
1094557405 12:31514907-31514929 GAATCACTTTGGACCAGCCTGGG + Intronic
1094838212 12:34332074-34332096 GGAGCACTTTGGGCCAGTGGTGG + Intergenic
1095702763 12:45207691-45207713 TAATCACTTTGGGCCATGTGGGG - Intergenic
1096141183 12:49243857-49243879 GAAAAACTTTAGGCCAGGCATGG + Intronic
1096305862 12:50474635-50474657 GAAACAGAATGGGCCAGGCGCGG - Intronic
1096317917 12:50584852-50584874 TAAACATTTTTGGCCAGGCGCGG - Intronic
1096414217 12:51399691-51399713 AAAACATGTTGGGCCAGGCGTGG + Intronic
1096989672 12:55789651-55789673 GAATTATTTAGGGCCAGGCGCGG + Intronic
1097015237 12:55981352-55981374 TAGTCAATTTGGGCTAGGCGTGG - Intronic
1097229684 12:57502414-57502436 AACTCACTTGGGGCCAGGTGTGG + Intronic
1097290725 12:57912414-57912436 AAATTAATTTTGGCCAGGCGCGG - Intergenic
1097664571 12:62465017-62465039 GCATCATTTTTGGCCAGGTGTGG + Intergenic
1097857073 12:64474825-64474847 ATAACATTTTGGGCCAGGCGTGG + Intronic
1097869087 12:64585296-64585318 GAATCCTTCTGGGCCAGGCGTGG - Intergenic
1097968696 12:65609210-65609232 AAATCTCCTGGGGCCAGGCGTGG - Intergenic
1098310312 12:69142021-69142043 AAAGCACTTAGGGCCAGGCGCGG + Intergenic
1098762892 12:74447141-74447163 TTATAACTTCGGGCCAGGCGCGG - Intergenic
1098770617 12:74548045-74548067 GGATCACTTGAGGCCAGGCAGGG - Intergenic
1099234743 12:80070538-80070560 GAATTCCTATGGGCCAGGTGTGG - Intergenic
1099459689 12:82907171-82907193 GAATGAATTGGGGCCGGGCGTGG + Intronic
1099671546 12:85700342-85700364 GAAAGATTCTGGGCCAGGCGCGG - Intergenic
1099817973 12:87672931-87672953 AAATTACATTGGGCTAGGCGCGG + Intergenic
1099844037 12:88006204-88006226 GAGTTCTTTTGGGCCAGGCGCGG - Intronic
1100300688 12:93304902-93304924 GATTCAATTTTGGCCAGGTGTGG + Intergenic
1100302883 12:93324318-93324340 GACTCAGCTTGGGCCAGGCATGG + Intergenic
1100362442 12:93891037-93891059 GAAATACATTGGGCTAGGCGTGG - Intronic
1100966344 12:100017227-100017249 GAAATAGTTTTGGCCAGGCGTGG - Intergenic
1101006171 12:100403184-100403206 GAACCTCTTTCTGCCAGGCGTGG + Intronic
1101103312 12:101416735-101416757 TAAAAACTTTTGGCCAGGCGCGG - Intergenic
1101387635 12:104271930-104271952 TAAGCATTTAGGGCCAGGCGCGG + Intronic
1101611913 12:106300618-106300640 AAAGCACTTTGGGCCAGGCACGG - Intronic
1101890542 12:108710850-108710872 GAAAAATTTTAGGCCAGGCGCGG - Intronic
1102049732 12:109854033-109854055 GAATAATATTTGGCCAGGCGCGG - Intronic
1102250226 12:111381634-111381656 GAATAATTTAGGGCCAGGCATGG + Intergenic
1102894667 12:116589158-116589180 GAAACAGTTTGGGCCAGGCACGG + Intergenic
1102929402 12:116850921-116850943 AAAATACTTTGGGCCAGGTGTGG - Exonic
1103498760 12:121384014-121384036 AAAATACTTTTGGCCAGGCGCGG - Intronic
1103583794 12:121936236-121936258 GGATCACTTGAGGCCAGGAGTGG + Intronic
1103586544 12:121960506-121960528 TCATCATTATGGGCCAGGCGCGG - Intronic
1103608960 12:122109472-122109494 GCAACAATTTGGGCCAGGCACGG - Intronic
1103634171 12:122289104-122289126 GATGTGCTTTGGGCCAGGCGCGG - Intronic
1103764053 12:123269578-123269600 GAAGCTCCTGGGGCCAGGCGCGG + Intronic
1103787656 12:123445411-123445433 GCATCACTTGGGGCCAGGAGTGG - Intergenic
1103795978 12:123503491-123503513 AAATCTCTCTGGGCCAGGCACGG - Intronic
1104133685 12:125917862-125917884 GAATCACATTGGGCCGGGCGAGG + Intergenic
1104323752 12:127776005-127776027 GCATAACTTCAGGCCAGGCGCGG + Intergenic
1105021933 12:132822628-132822650 AAATTAATTTGGGCCAGGCGCGG + Intronic
1105379838 13:19876611-19876633 GAAAAATTTTAGGCCAGGCGAGG - Intergenic
1105708612 13:22983834-22983856 GAATTACTTCAGGCCGGGCGCGG - Intergenic
1105786295 13:23752935-23752957 GAAGTGCTTTGGGCCAGGCAAGG + Intronic
1106270144 13:28145006-28145028 GGATGATATTGGGCCAGGCGCGG - Intronic
1106634851 13:31517461-31517483 AAATCACTTAAGGCCAGGCGTGG + Intergenic
1106980790 13:35277329-35277351 AAATCACATTAGGCCGGGCGCGG + Intronic
1107520786 13:41178786-41178808 GTATTGTTTTGGGCCAGGCGCGG + Intergenic
1107563758 13:41581290-41581312 GACTCACTCTCGGCCGGGCGCGG - Intronic
1107855705 13:44613665-44613687 GAATCACTGTGGGCCAGGCGTGG + Intergenic
1107880379 13:44827209-44827231 GACAAACTTTAGGCCAGGCGCGG + Intergenic
1108070088 13:46619398-46619420 TAAGAACTTTAGGCCAGGCGTGG - Intronic
1108274825 13:48797085-48797107 AAAATACTTTAGGCCAGGCGTGG - Intergenic
1108314979 13:49228060-49228082 GACACACTAAGGGCCAGGCGTGG + Intergenic
1109150189 13:58837167-58837189 GAATAATTTTAGGCCAGGCGTGG - Intergenic
1109303670 13:60615665-60615687 GAATTGCTTTGAGCCGGGCGTGG - Intergenic
1110315222 13:74099055-74099077 AAATCACTTTGGACCAGGTGGGG + Intronic
1110423178 13:75336106-75336128 AGATCATTTTGGGCCAGGTGCGG + Intronic
1111549317 13:89785468-89785490 GAACAACTATTGGCCAGGCGCGG - Intergenic
1111640718 13:90966313-90966335 TAAACACTGTGGGCCAGGCATGG + Intergenic
1111708932 13:91786283-91786305 GAAAAACTTTGGGCCAGGCGTGG - Intronic
1111745925 13:92269694-92269716 GGATCCCTTCGGGCCAGGTGTGG - Intronic
1113084574 13:106555065-106555087 GTGTCACTCTGGGCCAGGAGCGG + Intronic
1113222927 13:108125986-108126008 AATTCACTCTTGGCCAGGCGCGG - Intergenic
1113609619 13:111634595-111634617 AGATGACTTTGGGCCATGCGGGG + Intronic
1113726223 13:112604586-112604608 AAATAAATTTGGGCCAGGCATGG - Intergenic
1114178770 14:20347321-20347343 GAAGGACTTTAGGCAAGGCGTGG - Intronic
1115216841 14:31022087-31022109 AAATCACTGTCGGCCGGGCGCGG + Intronic
1115545150 14:34459139-34459161 AAATTAATCTGGGCCAGGCGCGG + Intronic
1115825446 14:37267195-37267217 GAAGGAATTGGGGCCAGGCGTGG + Intronic
1116805616 14:49491468-49491490 TAAACATTTTGGGCCAGGCGTGG - Intergenic
1116816813 14:49591600-49591622 AAATCAAATTGGGCCAGGCATGG - Intronic
1117156068 14:52942920-52942942 ATATCACTCTTGGCCAGGCGTGG + Intronic
1117667513 14:58072426-58072448 GAATCCTTTTGGGCCGGGCACGG + Intronic
1118043830 14:61945563-61945585 GGATGAGTTGGGGCCAGGCGCGG + Intergenic
1118199871 14:63662256-63662278 AAAACAATTTAGGCCAGGCGCGG - Intergenic
1118940006 14:70325289-70325311 AACTAACTTTCGGCCAGGCGTGG + Exonic
1119385540 14:74256138-74256160 TAATTACTTTTGGCCAGGCACGG + Intronic
1119583893 14:75813591-75813613 AAAACAGTTTGGGCCAGGCACGG - Intronic
1119610911 14:76061169-76061191 GAAACAATGTAGGCCAGGCGAGG - Intronic
1119634130 14:76260436-76260458 TAATCACTTGAGGCCAGGCCCGG + Intergenic
1119675892 14:76553664-76553686 AAATCACTATCTGCCAGGCGCGG + Intergenic
1119785230 14:77308148-77308170 AATTAACTTGGGGCCAGGCGTGG - Intronic
1119968075 14:78939133-78939155 AAATCACTCTGGGCCGGGCGCGG - Intronic
1120205008 14:81578789-81578811 GAGCAACTCTGGGCCAGGCGTGG + Intergenic
1120819996 14:88903228-88903250 GGCTCACTCTGGGCCAGGTGCGG + Intergenic
1120911585 14:89671765-89671787 TAATCATTTTTGGCCGGGCGCGG - Intergenic
1121470048 14:94145860-94145882 GAAGTTCTCTGGGCCAGGCGTGG - Intergenic
1121541423 14:94729852-94729874 AAAACACTCTTGGCCAGGCGTGG - Intergenic
1121833804 14:97074205-97074227 TAGTCCCTTTGGGCCGGGCGTGG - Intergenic
1121835852 14:97091631-97091653 AAAACACAGTGGGCCAGGCGCGG + Intergenic
1122210493 14:100170704-100170726 TAATGCCTTTGGGCCGGGCGCGG - Intergenic
1122516550 14:102312940-102312962 CAAAGACTTTGGGCCTGGCGCGG + Intergenic
1122586343 14:102809418-102809440 AAGTCACTCTAGGCCAGGCGCGG - Intronic
1122646718 14:103199393-103199415 GAAAAACTTTAGGCCGGGCGTGG + Intergenic
1122707691 14:103631368-103631390 GTATAAATTTGGGCCAGGTGCGG - Intronic
1122839760 14:104451431-104451453 TAATACCTTCGGGCCAGGCGGGG + Intergenic
1122971445 14:105153873-105153895 GATGCACACTGGGCCAGGCGAGG + Intronic
1123685823 15:22796524-22796546 GGATCACTTGAGGCCAGGAGTGG - Intronic
1123794212 15:23755321-23755343 CAATCACTGAGGGCCAGGCATGG - Intergenic
1123873743 15:24602540-24602562 GAATCACTTGGGGGCATGGGTGG - Intergenic
1124291635 15:28457220-28457242 GCAGCACTTGGGGCCAGGTGAGG - Intergenic
1124423989 15:29547376-29547398 GAATCAATGTGGGCCAGGTCTGG - Intronic
1124456711 15:29849863-29849885 GAGTCACTAATGGCCAGGCGTGG - Intronic
1124718123 15:32086077-32086099 TAAACACTTTTGGCCAGGCACGG + Intronic
1124930669 15:34116196-34116218 GAACCTGTTTGGGCCAGGTGTGG - Intergenic
1125285942 15:38092667-38092689 GAATCACTTGAAGCCAGGTGTGG + Intergenic
1125448128 15:39780231-39780253 CAATCAATTTTGGCCAGGCGCGG + Intronic
1125656973 15:41366008-41366030 ACATCACTATGGGCCGGGCGTGG - Intronic
1125701542 15:41689829-41689851 GAAACAATATGGGCCAGGTGTGG - Intronic
1125802148 15:42459183-42459205 GAATAATCTTCGGCCAGGCGTGG + Intronic
1125818912 15:42610835-42610857 GAATCAGTTTGGGCCAGGCACGG - Intronic
1125958414 15:43807636-43807658 GTATAATTTTGGGCCGGGCGCGG - Intronic
1125963187 15:43849822-43849844 AAATCACTCCAGGCCAGGCGCGG - Intronic
1126014441 15:44336405-44336427 TAAGCAGTTTGGGCCAGGCACGG - Intronic
1126092705 15:45065960-45065982 GAATGAATCTGGGCCAGGCGGGG + Intronic
1126111671 15:45178821-45178843 GTACCACTTGGGGCCGGGCGCGG - Intronic
1126152694 15:45537496-45537518 TAATAATTTTAGGCCAGGCGCGG + Intergenic
1126157257 15:45577179-45577201 AAATTACTTTAGGCCGGGCGTGG + Intergenic
1126392145 15:48169883-48169905 AAATCAGGTTTGGCCAGGCGTGG - Intronic
1126811551 15:52410864-52410886 GAATCAGTTTTGGCCAGGTGTGG - Intronic
1127383167 15:58446854-58446876 GAGTGAGTTTTGGCCAGGCGAGG + Intronic
1127696362 15:61451895-61451917 GAATCACTGGTGGCCAGGCACGG - Intergenic
1128437229 15:67665169-67665191 GTTTTACTTTTGGCCAGGCGCGG - Intronic
1128567261 15:68709542-68709564 GGATCGCTTGAGGCCAGGCGCGG - Intronic
1128813776 15:70590506-70590528 AAAACACTTCAGGCCAGGCGTGG - Intergenic
1128832224 15:70779971-70779993 GAGTCAGGTTGGGCCTGGCGTGG + Intergenic
1128900427 15:71416085-71416107 GACAAACTTCGGGCCAGGCGAGG - Intronic
1129347915 15:74935998-74936020 GAGTCAGTTTCGGCCAGGTGTGG + Intronic
1129421504 15:75431064-75431086 GAAGCACTTGAGGCCGGGCGCGG - Intronic
1129444814 15:75609477-75609499 GACCCACTTTGGGCCGGGCGCGG - Intronic
1129582818 15:76830935-76830957 GAGCCACTTTGGGCCAGGAATGG - Intronic
1129763618 15:78147378-78147400 GATAAGCTTTGGGCCAGGCGTGG - Intronic
1129988255 15:79937666-79937688 GAATAAATTTCGGCCGGGCGCGG + Intergenic
1130239493 15:82173897-82173919 AAATACATTTGGGCCAGGCGCGG + Intronic
1130474672 15:84254069-84254091 GAATAGCATTGGGCCAGGCACGG + Intergenic
1130482088 15:84368123-84368145 GAATAGCATTGGGCCAGGCACGG + Intergenic
1130665527 15:85866215-85866237 AAATTACTATAGGCCAGGCGAGG - Intergenic
1130976083 15:88776349-88776371 GAATCACTTGAAGCCAGGCATGG + Intergenic
1130983637 15:88830110-88830132 GACTCACGCTGGGCCAGGGGAGG + Intronic
1131034639 15:89214168-89214190 AAATTAGTTTGGGCCAGGTGCGG + Intronic
1131160726 15:90102966-90102988 ATCTCACTTTGGGCCGGGCGCGG + Intergenic
1131253263 15:90844849-90844871 GAACCAGTTTTAGCCAGGCGTGG - Intergenic
1131492226 15:92873062-92873084 GAAACATTATGGGCCAGGTGCGG - Intergenic
1131529562 15:93180007-93180029 GAACCACACTGGGCCGGGCGTGG + Intergenic
1131566742 15:93492572-93492594 GAACCTATCTGGGCCAGGCGCGG - Intergenic
1131638883 15:94268154-94268176 GAATGAATTTGGGCCGGGCGTGG - Intronic
1131673575 15:94648032-94648054 AAAGCATGTTGGGCCAGGCGCGG - Intergenic
1131791071 15:95965941-95965963 GAATAATGTTGGGCCAGGCACGG - Intergenic
1131847537 15:96503670-96503692 AATTCACTTTGTGCCAGGCATGG + Intergenic
1131897428 15:97048831-97048853 AAACCACTTTGGGCCTGTCGTGG - Intergenic
1131914797 15:97253277-97253299 GACTAGATTTGGGCCAGGCGCGG + Intergenic
1131950644 15:97677768-97677790 AAATCAGCTAGGGCCAGGCGTGG - Intergenic
1132826025 16:1906110-1906132 GAAACATTCTGGGCCGGGCGCGG - Intergenic
1133073452 16:3262205-3262227 GAAACATTCTGGGCCGGGCGCGG + Intergenic
1133152285 16:3843856-3843878 GAAAGACTTTCGGCCGGGCGCGG + Intronic
1133158875 16:3896061-3896083 TGATCACTTGGGGCCAGGCGCGG + Intergenic
1133243115 16:4427865-4427887 GAATCACTTTAGCCCAGCCTGGG - Intronic
1133369840 16:5239344-5239366 GCATCACTGTGGACCAGGCGTGG - Intergenic
1133388077 16:5386758-5386780 AACGTACTTTGGGCCAGGCGTGG + Intergenic
1133745214 16:8681279-8681301 AAAGAACTCTGGGCCAGGCGAGG - Intronic
1134063889 16:11214554-11214576 ACAGCACTTTGGGCCGGGCGCGG + Intergenic
1134086925 16:11363656-11363678 TAAACACTTTTGGCCGGGCGTGG + Intronic
1134183840 16:12067776-12067798 GAAACTTCTTGGGCCAGGCGCGG - Intronic
1134266910 16:12700680-12700702 GAAAGTCTTTGGGCCAGGTGTGG - Intronic
1134417733 16:14059008-14059030 GTATTACTTTGGGCCGGGGGCGG - Intergenic
1134457160 16:14403209-14403231 GGACCACTGTGGGCCAGGTGTGG + Intergenic
1134502881 16:14782904-14782926 AAATGAAATTGGGCCAGGCGCGG + Intronic
1134564680 16:15240994-15241016 CAATCCCTTAGGGCCAGGCACGG + Intergenic
1134577682 16:15345992-15346014 AAATGAAATTGGGCCAGGCGCGG - Intergenic
1134737818 16:16515705-16515727 CAATCCCTTAGGGCCAGGCACGG - Intergenic
1134929685 16:18196454-18196476 CAATCTCTTAGGGCCAGGCACGG + Intergenic
1135017589 16:18936715-18936737 GAATTACTATGGGCCGGGTGTGG - Intergenic
1135041895 16:19123794-19123816 GAATCACTTTAGACAAGGAGTGG + Intronic
1135123056 16:19783287-19783309 GAATCAATGCTGGCCAGGCGCGG - Intronic
1135234809 16:20745293-20745315 GGACCACTTGGGGCCAGGCACGG + Intronic
1135254815 16:20932812-20932834 AAATGCCTTTTGGCCAGGCGCGG + Intergenic
1135383969 16:22019921-22019943 GTATCAGTTGGGGCCAGGTGCGG + Intronic
1135596897 16:23751684-23751706 GAATGACTAGCGGCCAGGCGTGG + Intergenic
1135697346 16:24601485-24601507 AAACCATTTAGGGCCAGGCGCGG - Intergenic
1135764821 16:25168336-25168358 AACTCACTTTAGGCCAGGCATGG - Intronic
1135856035 16:26011267-26011289 CATTCAATTTTGGCCAGGCGTGG + Intronic
1136149260 16:28336103-28336125 GAATCCCCTGGGGCCAGGTGTGG - Intergenic
1136369045 16:29824472-29824494 GACTCACTAGGGGCCAGGTGTGG + Intronic
1137266637 16:46874334-46874356 GAATCGCTTCAGGCCGGGCGCGG + Intergenic
1137286874 16:47023482-47023504 AAATCATTTTAGGCCAGGTGTGG - Intergenic
1137551126 16:49438283-49438305 GAATCACTTGAGTCCAGGAGGGG + Intergenic
1137642175 16:50042043-50042065 AAAACATTTTGGGCCAGGCATGG + Intergenic
1137648006 16:50092730-50092752 GAATGACCTTGGGCCGGGCGCGG - Intronic
1138378599 16:56584443-56584465 CACTGACTTTAGGCCAGGCGCGG - Intergenic
1138834017 16:60411368-60411390 AAATCACTTGAGGCCAGGAGTGG + Intergenic
1138949757 16:61898009-61898031 AAACAATTTTGGGCCAGGCGCGG + Intronic
1139181682 16:64755598-64755620 GGATCTCTCTGGGCCAGGCACGG + Intergenic
1139239355 16:65375052-65375074 TAATCACAATGAGCCAGGCGTGG + Intergenic
1139482840 16:67240234-67240256 AACTAACTTTAGGCCAGGCGTGG + Intronic
1139694431 16:68663522-68663544 AGGTCACTTTCGGCCAGGCGTGG - Intronic
1139742438 16:69046884-69046906 GAGTGATTTTAGGCCAGGCGTGG + Intronic
1139900132 16:70321741-70321763 AAATAAATTTTGGCCAGGCGTGG + Intronic
1140056560 16:71530788-71530810 AAAAGATTTTGGGCCAGGCGTGG + Intronic
1140086577 16:71802437-71802459 AAAAAATTTTGGGCCAGGCGCGG + Intronic
1140238566 16:73180951-73180973 GAAGCACAATGGGCCAGGCGCGG - Intergenic
1140336195 16:74107220-74107242 GAAGCACTTGGGGCCGGGCGCGG + Intergenic
1140354497 16:74293730-74293752 ACAGCACTTTAGGCCAGGCGCGG + Intergenic
1140397562 16:74641451-74641473 TAATCTGTTTAGGCCAGGCGTGG - Intronic
1140443502 16:75004904-75004926 AAGCCACGTTGGGCCAGGCGTGG - Intronic
1140486903 16:75300575-75300597 GAAAAACTTGGGGCCAGGCATGG - Intronic
1140511370 16:75510933-75510955 GAATCACTTGCGCCCAGGAGGGG + Intergenic
1141043163 16:80689828-80689850 AAAGCACTCTGGGCCAGGCACGG + Intronic
1141629190 16:85277493-85277515 GAGTCACCTGGGGCCAGGCCTGG + Intergenic
1141716949 16:85732373-85732395 GATTCTCTCTGGGCCAGGTGTGG + Intronic
1142353881 16:89592302-89592324 AAATTATTTTGGGCCGGGCGCGG - Intronic
1142421127 16:89970942-89970964 GAATACCTTCAGGCCAGGCGCGG - Exonic
1142431413 16:90030045-90030067 GAATCAGTTACTGCCAGGCGCGG - Intronic
1142537019 17:625277-625299 GAAACACATTGGGCCAGGCTTGG - Intronic
1142551585 17:743881-743903 AAATGAGTTTGGGCCAGGTGCGG - Intergenic
1142689553 17:1597126-1597148 GAATCACTTGAACCCAGGCGGGG + Intronic
1142734463 17:1887265-1887287 AGATCACTGTAGGCCAGGCGCGG + Intronic
1143019274 17:3908268-3908290 GAATGACTATGGGCTGGGCGCGG + Intronic
1143097375 17:4485684-4485706 GATGAACTCTGGGCCAGGCGCGG - Intronic
1143316713 17:6038439-6038461 GAGTCACTCTGGGCCGGGCGTGG + Intronic
1143439545 17:6958435-6958457 TAGTTACTTTGGGCCAGGTGTGG - Intronic
1143474456 17:7194737-7194759 AAAGCAGTTTGGGCCAGGCGTGG + Intronic
1143649453 17:8254511-8254533 CAAACAGTTTTGGCCAGGCGCGG + Intronic
1143724151 17:8833828-8833850 AAGTCACTTTCGGCCAAGCGCGG - Intronic
1143792939 17:9312898-9312920 AGGTCACTGTGGGCCAGGCGTGG + Intronic
1143909512 17:10236175-10236197 GCATTGCTTTGGGCCAGGTGTGG + Intergenic
1144516163 17:15918757-15918779 TATTCACTGTTGGCCAGGCGCGG - Intergenic
1144570469 17:16394912-16394934 GAACAATTTTTGGCCAGGCGCGG - Intergenic
1144594324 17:16554462-16554484 GGATAACTTTAGGCCAGGTGTGG - Intronic
1144632892 17:16883018-16883040 GAAAAACTTTCGGCCAGGCGTGG + Intergenic
1144805369 17:17962602-17962624 TATTCACATTGGGCCAGTCGCGG - Intronic
1144845222 17:18214239-18214261 AAAAAATTTTGGGCCAGGCGCGG + Intergenic
1144932112 17:18868181-18868203 AAATTATTTTAGGCCAGGCGTGG + Intronic
1144949513 17:18986454-18986476 GAATTGCTTTGGGCAAGGCATGG + Intronic
1145257323 17:21333447-21333469 AAAGCAGTTTAGGCCAGGCGCGG - Intergenic
1145304928 17:21668740-21668762 GAAAAAACTTGGGCCAGGCGCGG - Intergenic
1145319317 17:21754587-21754609 AAAGCAGTTTAGGCCAGGCGCGG + Intergenic
1146097744 17:29948114-29948136 GAGTTAATTTAGGCCAGGCGCGG - Intronic
1146179125 17:30686090-30686112 GAATCCCTTTCGGCCAGGCACGG + Intergenic
1146229801 17:31097165-31097187 GAATGATTTTGGGCTGGGCGCGG + Intronic
1146355693 17:32132110-32132132 AATTAACTTTGGGCCAGGTGTGG + Intergenic
1146494857 17:33312642-33312664 GAGTCAGTGTGGGCCAGGTGCGG + Intronic
1146531803 17:33613655-33613677 GAATACATGTGGGCCAGGCGCGG - Intronic
1146578901 17:34019195-34019217 GAATCTACTTTGGCCAGGCGTGG - Intronic
1146818263 17:35962611-35962633 ATATCCCTTTTGGCCAGGCGCGG + Intergenic
1146851872 17:36228904-36228926 AAATCAGTATGGGCCGGGCGCGG - Intronic
1146867782 17:36352777-36352799 AAATCAGTATGGGCCGGGCGCGG - Intronic
1146876207 17:36413652-36413674 AAATAATTTTAGGCCAGGCGTGG - Intronic
1146987023 17:37229777-37229799 AAATAAATGTGGGCCAGGCGTGG + Intronic
1147030526 17:37630928-37630950 AAATCACAGTGGGCCAGGTGCGG - Intronic
1147063176 17:37899221-37899243 AAATAATTTTAGGCCAGGCGTGG + Intergenic
1147070656 17:37953394-37953416 AAATCAGTATGGGCCGGGCGCGG - Intergenic
1147082182 17:38032920-38032942 AAATCAGTATGGGCCGGGCGCGG - Intronic
1147098129 17:38156885-38156907 AAATCAGTATGGGCCGGGCGCGG - Intergenic
1147197122 17:38774476-38774498 AAATCTCTTAGGGCCGGGCGTGG + Intronic
1147408306 17:40229710-40229732 AAATGTCTTTGGGCCAGGCACGG - Intronic
1147847376 17:43413989-43414011 GGATCACTTGAGGCCAGGAGTGG + Intergenic
1148040961 17:44707052-44707074 ATATCACCCTGGGCCAGGCGCGG + Intergenic
1148178717 17:45587946-45587968 GAATCTTTTTCGGCCAGGAGCGG + Intergenic
1148270438 17:46258497-46258519 GAATCTTTTTCGGCCAGGCGTGG - Intergenic
1148570076 17:48661272-48661294 AATTAACTTTAGGCCAGGCGTGG - Intergenic
1148785954 17:50146333-50146355 GCACCACTTGGAGCCAGGCGGGG + Intronic
1148830803 17:50429806-50429828 GAAAGACTCTGGGCCGGGCGTGG - Intronic
1148934988 17:51157987-51158009 TAATCAGTTAGGGCCTGGCGTGG + Intronic
1149317065 17:55448561-55448583 TAAGAACTTTTGGCCAGGCGTGG - Intergenic
1149588315 17:57808572-57808594 GAATTCCTTTCGGTCAGGCGCGG + Intergenic
1149701623 17:58660112-58660134 TTAACACTTTAGGCCAGGCGCGG + Intronic
1149725477 17:58889308-58889330 AAATCATTTTAGGCCAGGTGCGG + Intronic
1149817056 17:59736120-59736142 TAAACATTTTAGGCCAGGCGTGG + Intronic
1149916188 17:60611707-60611729 AAAGAATTTTGGGCCAGGCGTGG - Intronic
1149968426 17:61191483-61191505 TAATGACTTAAGGCCAGGCGCGG + Intronic
1150029085 17:61712502-61712524 GAAACAGGTTGGGCCAGGTGAGG - Intronic
1150068555 17:62132562-62132584 GAATCTGCTTGGGCCAGGTGCGG + Intergenic
1150120640 17:62598811-62598833 GCCTCACTTTCAGCCAGGCGCGG - Intronic
1150137158 17:62702357-62702379 GAAACAGTTTAAGCCAGGCGTGG + Intronic
1150157104 17:62863044-62863066 GCATGACTTTTGGCCAGCCGTGG - Intergenic
1150215761 17:63468225-63468247 CCATCAGATTGGGCCAGGCGCGG - Intergenic
1150298221 17:64026393-64026415 AAATCAATTTGGGCCGGGCGCGG + Intergenic
1150613569 17:66752302-66752324 TAATCACGTTGGGCTGGGCGTGG + Intronic
1150751844 17:67871059-67871081 GAAGCATTTTCGGCCGGGCGCGG - Intronic
1151056292 17:71035421-71035443 GGATCACTTGCGGCCAGGAGTGG + Intergenic
1151085288 17:71373635-71373657 GAATCGCCTCTGGCCAGGCGAGG + Intergenic
1151741398 17:75984951-75984973 GAGTCAAATTGGGCAAGGCGCGG + Intronic
1151932107 17:77239036-77239058 AAAACACTTCAGGCCAGGCGCGG + Intergenic
1151945305 17:77316377-77316399 CAAACATTTTGGCCCAGGCGGGG - Intronic
1152429895 17:80242995-80243017 GATTCACACTGGGCCAGGCGCGG - Intronic
1152520082 17:80850563-80850585 AAATCACTCTTGGCCAGGTGCGG - Intronic
1152950551 17:83227766-83227788 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1153243792 18:3054192-3054214 AGATCACTCTGGGCCGGGCGTGG - Intergenic
1153600490 18:6776585-6776607 GAAACACTTTGGGCCGGGCATGG - Intronic
1153715341 18:7841582-7841604 GAAATGATTTGGGCCAGGCGTGG - Intronic
1153876542 18:9377507-9377529 GACTATCTTTAGGCCAGGCGCGG - Intronic
1153892629 18:9532494-9532516 AAATACCTTTGGGCCAGGCATGG + Intronic
1154048008 18:10925856-10925878 AAAAAACTTTTGGCCAGGCGCGG - Intronic
1154258971 18:12812308-12812330 CAATCACTTTGGGCTGGGTGCGG + Intronic
1154292926 18:13126423-13126445 GAGTCACCTTTGGCCAGGCATGG - Intergenic
1154953227 18:21230170-21230192 GGAAAAGTTTGGGCCAGGCGCGG + Intergenic
1154988807 18:21580697-21580719 GAATTACTATTGGCCAGGCACGG + Intronic
1155004174 18:21713319-21713341 AAAGAACTCTGGGCCAGGCGCGG + Intronic
1155208639 18:23582509-23582531 GAATCCCAGTGGGCCAGGCATGG + Intronic
1155479616 18:26271631-26271653 AAGACACTTTGGGCCAGGCATGG + Intronic
1155908102 18:31476667-31476689 GAATCACAAGGGGCCGGGCGCGG + Exonic
1155975314 18:32122531-32122553 TGAGCACATTGGGCCAGGCGCGG + Intronic
1156595651 18:38544775-38544797 GAAATGCTTTGGGCCAGGCATGG - Intergenic
1156671968 18:39481672-39481694 GAATCAGATTCGGCCGGGCGCGG + Intergenic
1156694869 18:39753991-39754013 GAAGCATTCTGGGCCAGGCGCGG - Intergenic
1157227172 18:45877072-45877094 GAATTTCTCTGGGCCAGGCGTGG - Intronic
1157778887 18:50420203-50420225 AAAGCAGTTTGGGCCGGGCGAGG + Intergenic
1157887070 18:51379028-51379050 AAATTACATTTGGCCAGGCGTGG - Intergenic
1158202927 18:54959876-54959898 AATTCACATTGGGCCAGGTGCGG + Intergenic
1158572725 18:58610649-58610671 ATATCAATTAGGGCCAGGCGCGG + Intronic
1158577461 18:58651046-58651068 GAGTCATTGTTGGCCAGGCGCGG + Intergenic
1158606802 18:58902780-58902802 GGATCACCTGGGGCCAGGTGTGG - Intronic
1158720776 18:59922430-59922452 AAGACATTTTGGGCCAGGCGTGG - Intergenic
1159167200 18:64718835-64718857 TAATCAATTTTGGCCGGGCGCGG - Intergenic
1159443647 18:68512794-68512816 GAAAAACTGTAGGCCAGGCGCGG - Intergenic
1159515133 18:69448662-69448684 GAATCAATTTGGGCTGGGCACGG - Intronic
1159549806 18:69882956-69882978 TAATCCCTTGGAGCCAGGCGTGG - Intronic
1159806380 18:72962657-72962679 GATTCAGTGTCGGCCAGGCGTGG - Intergenic
1160037755 18:75317197-75317219 GAAGCACTTGGGGCCAGGGCTGG - Intergenic
1160762100 19:790720-790742 GGATCACACGGGGCCAGGCGCGG + Intergenic
1160961414 19:1723122-1723144 AAAAAATTTTGGGCCAGGCGTGG + Intergenic
1161463801 19:4415881-4415903 AAATCACTGTTGGCCGGGCGCGG + Intronic
1161496476 19:4589064-4589086 GAAAAAATGTGGGCCAGGCGCGG - Intergenic
1161514276 19:4688084-4688106 AAAACATTTTGGGCCAGGCGCGG - Intronic
1161575085 19:5050608-5050630 GACTCTCCTGGGGCCAGGCGCGG + Intronic
1161622589 19:5306433-5306455 AAATCACCCTGGGCCAGGTGTGG - Intronic
1161906161 19:7158208-7158230 GAAGCATAATGGGCCAGGCGCGG + Intronic
1161927408 19:7311598-7311620 GAAGGACATTCGGCCAGGCGCGG - Intergenic
1161955697 19:7493659-7493681 GAGTCTCTTGGGGCCAGGTGTGG - Intronic
1162138831 19:8573016-8573038 CAATCACTATTGGCCAGGTGTGG + Intronic
1162397578 19:10426047-10426069 AATCCACTTTTGGCCAGGCGAGG + Intronic
1162483059 19:10940650-10940672 TCATCACTGTGGGCCAGGCATGG - Intergenic
1162559416 19:11407274-11407296 AAAACACTCAGGGCCAGGCGTGG - Intronic
1162608888 19:11733942-11733964 AAATCACCTTAGGCCAGGTGAGG + Intronic
1162692458 19:12445327-12445349 GAATAATTTACGGCCAGGCGCGG + Intronic
1162819482 19:13213906-13213928 GGATCACTTGAGGCCAGGAGTGG - Intronic
1162825535 19:13249257-13249279 GAAGCACTTGAGGCCAGGTGTGG - Intronic
1162979497 19:14229484-14229506 GAATCCCTTTCGGCCAGGCACGG - Intergenic
1163035923 19:14568882-14568904 AAATAAATATGGGCCAGGCGCGG + Intronic
1163259331 19:16178339-16178361 AAATTAATTTTGGCCAGGCGAGG + Intergenic
1163335316 19:16667564-16667586 AAATCCTTTTGGGCCAGACGTGG + Intronic
1163389236 19:17020262-17020284 GAATTGAATTGGGCCAGGCGTGG - Intronic
1163393985 19:17048250-17048272 GGATGTCTTTGGGCCAGGCACGG - Intergenic
1163468850 19:17485476-17485498 GAAATGCTTTAGGCCAGGCGTGG - Intronic
1163481246 19:17557687-17557709 GAATCACTTGAGCCCAGGAGGGG - Intronic
1163489330 19:17607566-17607588 AAAAAACTATGGGCCAGGCGCGG - Intronic
1163851196 19:19664495-19664517 AAACCACTTTAGGCCGGGCGCGG + Intergenic
1163871186 19:19822658-19822680 AAATCATTTAGGGCCAGGCGCGG + Intergenic
1163894994 19:20051068-20051090 GAATCCTTTTGGGCCAGGATAGG - Intergenic
1163898122 19:20077405-20077427 AAATCATTTAGGGCCAGGCGCGG - Intergenic
1163988287 19:20972854-20972876 GAAACATTTTTGGCCAGGTGCGG + Intergenic
1164184184 19:22847808-22847830 AAATTATTTTCGGCCAGGCGTGG + Intergenic
1164691401 19:30213359-30213381 GAATCAATCTCGGCCGGGCGCGG - Intergenic
1164859714 19:31553351-31553373 GAAACTATTTGGGCAAGGCGTGG - Intergenic
1164950343 19:32331613-32331635 GTGGCACTTTGGGCCGGGCGTGG - Intergenic
1165232691 19:34396896-34396918 GAATCACTTGAGGCCGGGAGGGG - Intronic
1165488551 19:36110178-36110200 GACCCCCTTTGGGCCAGGTGCGG + Intergenic
1165573312 19:36793421-36793443 GAGTAACTTTGGGCCGGGCGCGG + Intergenic
1165736959 19:38183094-38183116 GGAACAGTTTGGGCCAGGGGAGG + Intronic
1166586038 19:43950243-43950265 AGAAAACTTTGGGCCAGGCGCGG + Intergenic
1166671471 19:44712087-44712109 GTAACACTTGGGGCCGGGCGCGG + Intergenic
1166725031 19:45021863-45021885 AGACCACTTTGGGCCGGGCGAGG - Intronic
1166797868 19:45438929-45438951 GAATAACTTCGGGCCGGGCGCGG - Intronic
1166891157 19:45994394-45994416 GAAAAACTTCTGGCCAGGCGCGG - Intergenic
1167031539 19:46965020-46965042 GAGTCTTTTTAGGCCAGGCGCGG + Intronic
1167063656 19:47167800-47167822 AAATTATTTTAGGCCAGGCGTGG - Intronic
1167152370 19:47717614-47717636 CAATCACCTTGGGCCAGGCCCGG + Intronic
1167188330 19:47964235-47964257 AAAACACTTAGGGCCAGGCACGG - Intergenic
1167396014 19:49229449-49229471 AAATCACTTCAGGCCAGGCATGG - Intergenic
1167404972 19:49300759-49300781 CAATTACTCTGGGCCGGGCGCGG + Intronic
1167481205 19:49732675-49732697 TAATTACTTCAGGCCAGGCGCGG - Intergenic
1167632651 19:50635196-50635218 GGAGCACTCTGGGCCAGGTGTGG - Intronic
1167988186 19:53335889-53335911 AAAGTACTATGGGCCAGGCGTGG - Intronic
1168044369 19:53783687-53783709 AAGTCAAATTGGGCCAGGCGTGG + Intergenic
1168054051 19:53851354-53851376 AAATCACTACTGGCCAGGCGCGG + Intergenic
1168090938 19:54083535-54083557 GAATAGCTTAGGGCCAGGCAAGG + Intergenic
1168139792 19:54377971-54377993 AAAAAACTTTAGGCCAGGCGCGG + Intergenic
1168386172 19:55965061-55965083 GGATCACTTGAGGCCAGGAGTGG + Intronic
1168552093 19:57304760-57304782 AAAACACTTTCGGCCGGGCGCGG + Intergenic
1168659763 19:58156479-58156501 GAGTGACTATGGGCCAGCCGTGG + Intergenic
925235941 2:2277258-2277280 GAATCAATCGGGGCCAGGCAAGG - Intronic
925713723 2:6766244-6766266 AAATGATTTTGGGCCAGGCGTGG - Intergenic
925961678 2:9023162-9023184 AAATCTTTTTGGGCCGGGCGTGG + Intergenic
925983016 2:9192326-9192348 AAAGGACTTTGGGCCGGGCGTGG - Intergenic
926180538 2:10639130-10639152 CAAACAGCTTGGGCCAGGCGCGG + Intronic
926627817 2:15107850-15107872 TAATAACTTGGGGCCAGGAGTGG - Intergenic
926657866 2:15428751-15428773 GAATAAATTAAGGCCAGGCGCGG + Intronic
927014691 2:18946700-18946722 GAATTAGGTTGGGCCAGGCGTGG + Intergenic
927167502 2:20339292-20339314 GAATCACTTGAGACCAGGAGTGG + Intronic
927615066 2:24585982-24586004 GATTCATTTGGGGCCAGGGGCGG + Intronic
927624817 2:24704484-24704506 GATTAAGGTTGGGCCAGGCGCGG + Intronic
927765751 2:25805965-25805987 AAATGACTTATGGCCAGGCGTGG - Intronic
927892002 2:26757124-26757146 GAATCACTTGGACCCAGGGGCGG - Intergenic
928044672 2:27917304-27917326 AAAACACTTTGGGCCGGGCGTGG - Intronic
928082635 2:28324481-28324503 AAGTTACTTTGGGCCAGGCATGG + Intronic
928603042 2:32920123-32920145 GAAAAAATTTGGGCCAGGTGTGG - Intergenic
928773469 2:34730804-34730826 GAATATCTGTTGGCCAGGCGCGG + Intergenic
929211830 2:39365732-39365754 AAATTACTATGGGCCGGGCGCGG - Intronic
929488718 2:42377698-42377720 AAATACCTTTGGGCCAGGCATGG + Intronic
929490922 2:42395409-42395431 GAAGGAGTTGGGGCCAGGCGCGG + Intronic
929496561 2:42449671-42449693 GGATCACTTGAGGCCAGGTGTGG - Intronic
929536171 2:42785637-42785659 GGATCACTTGAGGCCAGGAGTGG + Intronic
929710117 2:44258074-44258096 AAAAAACTTGGGGCCAGGCGTGG + Intergenic
931252191 2:60542736-60542758 TACTCAGTTTGGGCCAGGTGCGG + Intronic
931595574 2:63938753-63938775 TAATAACTCTGGGCCTGGCGTGG - Intronic
931598983 2:63983425-63983447 AAATCATTTGGGGCCCGGCGTGG - Intronic
932183937 2:69675210-69675232 AAAACAGTTTGGGCCGGGCGCGG - Intronic
932598500 2:73108751-73108773 GAAGGACGTTGGGCCAGGCGTGG + Intronic
932603713 2:73149174-73149196 AAAACACTTTAGGCCAGGCGCGG - Intronic
932901439 2:75705331-75705353 GAAGCACTTATGGCCGGGCGTGG + Intronic
933599892 2:84318432-84318454 TACACACTTAGGGCCAGGCGCGG - Intergenic
933650320 2:84845058-84845080 TAAGAACTTTAGGCCAGGCGCGG + Intronic
933652905 2:84863520-84863542 GATTCACATGGGGCCAGGCGCGG - Intronic
933907258 2:86907131-86907153 AAGTCACTATGGGCCAGGCATGG - Intergenic
933908504 2:86916793-86916815 AAGTCACTATGGGCCAGGCATGG - Intronic
934024220 2:87986587-87986609 AAGTCACTATGGGCCAGGCATGG + Intergenic
934066907 2:88349534-88349556 AACCCGCTTTGGGCCAGGCGCGG + Intergenic
934572819 2:95383202-95383224 GACTCACTTTGGGCATGGCTTGG + Intronic
935245492 2:101215683-101215705 AAATTAGTTGGGGCCAGGCGTGG + Intronic
935467451 2:103415994-103416016 GAAAAAAATTGGGCCAGGCGTGG + Intergenic
935506828 2:103915753-103915775 AAACTACTTTTGGCCAGGCGTGG - Intergenic
935976416 2:108583331-108583353 AAAACCCTTTGGGCCAGGCGTGG - Intronic
936147410 2:109989666-109989688 GAATATGTTTGGGCCGGGCGCGG - Intergenic
936197282 2:110381775-110381797 GAATATGTTTGGGCCGGGCGCGG + Intergenic
936364858 2:111844276-111844298 AAGTCACTATGGGCCAGGCATGG + Intronic
936384952 2:112020901-112020923 GCATCACTTGAGGCTAGGCGTGG + Intronic
936505977 2:113107431-113107453 AAATATCTTTTGGCCAGGCGTGG + Intronic
936708599 2:115104715-115104737 AAATCTGTTTTGGCCAGGCGCGG + Intronic
936948891 2:117957179-117957201 GAATGAATATGGGCCAGGTGTGG - Intronic
937162153 2:119774734-119774756 AAATCACTGAGGGCCAGGCATGG + Intronic
937946402 2:127341820-127341842 GAAACCCATTGGGCCGGGCGTGG - Intronic
938013226 2:127845663-127845685 AAATGAAATTGGGCCAGGCGTGG - Intergenic
938022587 2:127918356-127918378 GGATCACTTGAGGCCAGGCGTGG - Intergenic
938697601 2:133848643-133848665 GAATCAGGTCTGGCCAGGCGCGG + Intergenic
938891506 2:135710332-135710354 AAAAGAATTTGGGCCAGGCGCGG + Intronic
939309805 2:140461542-140461564 AAATGACTATAGGCCAGGCGTGG + Intronic
939558096 2:143701441-143701463 GAAACCCAGTGGGCCAGGCGTGG + Intronic
939880412 2:147624524-147624546 GAGTCAATAAGGGCCAGGCGCGG - Intergenic
941965708 2:171298540-171298562 GAATCAGTTACGGCCAGGCGCGG + Intergenic
942024197 2:171896466-171896488 GAATCTCTTGAGGCCAGGCACGG + Intronic
942028485 2:171935044-171935066 AAACCACTCTAGGCCAGGCGCGG - Intronic
942262416 2:174182232-174182254 AAATCTCTTTCGGCCGGGCGCGG + Intronic
942281649 2:174370338-174370360 CAGTCACTCTGGGCCAGGTGTGG - Intronic
942627712 2:177920770-177920792 AAATTGTTTTGGGCCAGGCGCGG + Intronic
942890525 2:180981121-180981143 GCATCACTTGGCGCCCGGCGCGG + Intronic
942927069 2:181446613-181446635 GAATCACTTTAACCCAGGCTTGG + Intergenic
943235244 2:185309333-185309355 GAGTAACTTGAGGCCAGGCGTGG - Intergenic
943933261 2:193882549-193882571 GAACTACTATGGGCCAGGTGCGG + Intergenic
944147167 2:196518363-196518385 GAATCCCTTTAGGCCAGGCGCGG + Intronic
944559868 2:200925447-200925469 TAATCTTTTTGGGCCAGGTGTGG + Intronic
944718339 2:202397788-202397810 GAAGCATTTTTGGCCAGGCATGG - Intronic
944735246 2:202557038-202557060 TAAACCATTTGGGCCAGGCGTGG + Intronic
944737599 2:202581916-202581938 AAAAAAATTTGGGCCAGGCGCGG + Intergenic
944810902 2:203327096-203327118 AAATCACTTTAGGACGGGCGCGG - Intergenic
944963469 2:204902377-204902399 GAATGAGTTTCAGCCAGGCGCGG + Intronic
945233737 2:207615405-207615427 GAACAACTTTAGGCCAGGCGTGG + Intronic
945255493 2:207799582-207799604 GAATAACTTCGGGCCGGGCGTGG + Intergenic
945785878 2:214236360-214236382 GTATAATTTTGGGCCAGGCTTGG + Intronic
945823529 2:214693447-214693469 GAATCAGTTTGGATTAGGCGTGG + Intergenic
946008306 2:216544125-216544147 GAATCACTTGAGGCCAGGCGCGG - Intronic
946242186 2:218363188-218363210 ACATCATTTTGGGCCAGGTGTGG + Intronic
946552901 2:220823008-220823030 GAATCACCTCAGGCCAGGCGCGG + Intergenic
946724384 2:222647762-222647784 AAAGCACATTGGGCCAGGCATGG + Intronic
947379960 2:229535932-229535954 AAATCAGTCTGGGCCAGGCGTGG - Intronic
947427746 2:229999090-229999112 AAATTATTTTTGGCCAGGCGCGG - Intronic
947452434 2:230220990-230221012 GTGTAACTTTGGGCCAGGCTCGG + Intronic
948677817 2:239609407-239609429 TGATCACTGTGAGCCAGGCGTGG + Intergenic
948721500 2:239903829-239903851 GAATCACTTTGGGCTGAGAGTGG + Intronic
1168824315 20:799141-799163 TAAGAACTTTTGGCCAGGCGCGG + Intergenic
1168916969 20:1497532-1497554 CCAGCACTTTTGGCCAGGCGTGG - Intergenic
1169439475 20:5622245-5622267 TATTGACTTTGGGCCAGGAGTGG + Intergenic
1169752391 20:9007431-9007453 ATCTCACTTTGGGCCAGGCATGG + Intergenic
1170017829 20:11801961-11801983 AAATAACTCTGGGCCAGGCAGGG + Intergenic
1170154138 20:13254143-13254165 GAATCACTTGAGCCCAGGAGGGG + Intronic
1170576008 20:17661970-17661992 AAATCACTCTCGGCCGGGCGCGG + Intronic
1170848737 20:19984474-19984496 GAATCTCATGGGGCCAGGCGTGG + Intronic
1171029860 20:21667888-21667910 AACTTACTTTGGGCCAGGCGCGG + Intergenic
1171209220 20:23304235-23304257 AAATAACTTTAGGCCAGGCACGG - Intergenic
1171971002 20:31565186-31565208 GAAACTCTTTGGGCTGGGCGTGG + Intronic
1172023425 20:31932179-31932201 AAATAAATTTGGGCCAGGCATGG + Intronic
1172087538 20:32398945-32398967 GAATAAGGTTGGGCCAGGGGTGG + Intronic
1172130917 20:32654550-32654572 GAATAATGGTGGGCCAGGCGTGG + Intergenic
1172172198 20:32944182-32944204 GAAATAATTAGGGCCAGGCGCGG + Intronic
1172439280 20:34954262-34954284 TAATCACCATGGGCCAGGTGTGG + Intronic
1172652420 20:36513256-36513278 GAATTAATCTGGGCCGGGCGCGG + Intronic
1172845266 20:37926382-37926404 GAAATATTTAGGGCCAGGCGCGG + Intronic
1173238806 20:41274863-41274885 GAATCAAACTGGGCCAGGTGCGG + Intronic
1173584166 20:44169466-44169488 GAATACCTGAGGGCCAGGCGTGG - Intronic
1173631074 20:44516011-44516033 GAGTAACCTAGGGCCAGGCGTGG + Intronic
1173644302 20:44624034-44624056 GAATCCCCCTGGGCCAGGCGTGG - Intronic
1173786020 20:45793270-45793292 AAAACACTTTGGGCCGGGCGCGG + Intronic
1173985971 20:47261779-47261801 AAAGCACTTTGGGCCAGGCATGG + Intronic
1174068168 20:47880491-47880513 AAAGTAGTTTGGGCCAGGCGCGG - Intergenic
1174440036 20:50544132-50544154 GAAACAATTTAGTCCAGGCGCGG - Intronic
1174452122 20:50626729-50626751 CAAGAATTTTGGGCCAGGCGCGG + Intronic
1174469084 20:50742332-50742354 AAATCACTTGGGGCCAGGCACGG - Intronic
1174809159 20:53631168-53631190 AAATAAGTTGGGGCCAGGCGCGG - Intergenic
1174903231 20:54522803-54522825 AAACAACTTTGGGCCAGGCGCGG - Intronic
1174939856 20:54914233-54914255 GAATCATTTCTGGCCGGGCGCGG - Intergenic
1175084459 20:56446915-56446937 AAGTCACTTTTGGCCAGGTGCGG + Intronic
1175120564 20:56713144-56713166 AAAACAATTTTGGCCAGGCGCGG + Intergenic
1175321588 20:58092087-58092109 GAACAACGTTGGGACAGGCGAGG - Intergenic
1175333552 20:58180376-58180398 GGATCACTTGAGGCCAGGAGTGG + Intergenic
1175438717 20:58974853-58974875 AAGTAACTTTGGGCCAGGTGCGG - Intergenic
1175480427 20:59306852-59306874 AAGTCACCCTGGGCCAGGCGCGG + Intronic
1175611046 20:60351660-60351682 GAATGTGTTTGGGCCGGGCGCGG + Intergenic
1175865401 20:62173417-62173439 AAATTACTTGAGGCCAGGCGTGG + Intronic
1176230703 20:64031384-64031406 GAAACAGTTTGGGACAGGTGCGG + Intronic
1176726464 21:10439518-10439540 GAATCACTTAGACCCAGGGGTGG - Intergenic
1177546459 21:22564416-22564438 AAAACACTTTTGGCCGGGCGTGG - Intergenic
1177605347 21:23370671-23370693 GAATAAATATGGGCCAGGCACGG + Intergenic
1177643862 21:23877518-23877540 AAATGACTTTTGGCCAGGCACGG + Intergenic
1177848390 21:26318340-26318362 GAAACACTCTGGGGCAGGCTAGG - Intergenic
1177930631 21:27278628-27278650 AAATGACTCTAGGCCAGGCGCGG - Intergenic
1178064694 21:28891434-28891456 AAAACACTATGGGCCGGGCGCGG + Intergenic
1178242221 21:30915961-30915983 AAAAAACTTTCGGCCAGGCGTGG + Intergenic
1178463271 21:32822778-32822800 AAATCATTTTTGGCCAGGTGCGG + Intergenic
1178789157 21:35682625-35682647 AAACCAATTTAGGCCAGGCGCGG - Intronic
1178827115 21:36026195-36026217 AAATCACTTGTGGCCAGGTGTGG + Intergenic
1179351706 21:40617412-40617434 GACTCATTCTGGGCCGGGCGCGG - Intronic
1180063291 21:45398501-45398523 AAATCAGTCTGGGCCAGGCGCGG + Intergenic
1180287919 22:10767566-10767588 GAATCACTTAGACCCAGGGGCGG + Intergenic
1180418250 22:12789512-12789534 GAATGACATTTGGCCAGGTGCGG + Intergenic
1180652585 22:17390723-17390745 CAAGCACTTTGGGACCGGCGAGG - Intronic
1181017402 22:20079267-20079289 AAATAATTTTGGGCCCGGCGCGG + Intergenic
1181018061 22:20082655-20082677 GAACCACTCTGGGCCGGGCGCGG - Intronic
1181136814 22:20773093-20773115 AAAACACATAGGGCCAGGCGTGG + Intronic
1181342953 22:22197650-22197672 AGAACACTGTGGGCCAGGCGCGG + Intergenic
1181548642 22:23621621-23621643 GTCTCACTTTCGGCCAGGTGGGG + Intronic
1181577785 22:23806629-23806651 GAATCAGGATTGGCCAGGCGTGG + Intronic
1181691765 22:24566550-24566572 GAACAACTATGGGCCAGGTGTGG - Intronic
1181782698 22:25204706-25204728 GTGTCACTGTGGGCCGGGCGTGG - Intronic
1182162557 22:28137722-28137744 TAGTCACTATGGGCCAGGCACGG + Intronic
1182463237 22:30497046-30497068 AAATCACTCCCGGCCAGGCGTGG + Intronic
1182499541 22:30736202-30736224 GAATCACTTCAGGCCAGGGATGG - Intronic
1182790480 22:32948444-32948466 AAATCTCTTTGGGCCAGGCGCGG + Intronic
1182886982 22:33782574-33782596 GAATCAAATTGGGCTGGGCGCGG + Intronic
1183037883 22:35153797-35153819 ATATCACTCTGGGCCGGGCGCGG + Intergenic
1183209964 22:36444832-36444854 GATTCATTTTGGGCCAGGCGTGG + Intergenic
1183211138 22:36452097-36452119 ATATCACTTCTGGCCAGGCGCGG + Intergenic
1183220379 22:36508254-36508276 AAATGACATTCGGCCAGGCGCGG - Intergenic
1183494635 22:38135669-38135691 CACTTTCTTTGGGCCAGGCGGGG - Intronic
1183707978 22:39486789-39486811 GAATAAAATTAGGCCAGGCGTGG - Intronic
1183800570 22:40160184-40160206 GAGATATTTTGGGCCAGGCGCGG + Intronic
1184171105 22:42760320-42760342 AAAACATTTTTGGCCAGGCGAGG - Intergenic
1184367781 22:44063515-44063537 TATTCATATTGGGCCAGGCGCGG - Intronic
1184622420 22:45691603-45691625 AAAGCAGTCTGGGCCAGGCGCGG + Intronic
1184761743 22:46548802-46548824 GACTAAGTTTGGGCCGGGCGTGG - Intergenic
949635438 3:5976839-5976861 GAAGCATTTTCGGCCGGGCGTGG - Intergenic
949658258 3:6247132-6247154 GAATAAATGTGGGCCAGGTGCGG + Intergenic
950173777 3:10857224-10857246 GCATCACTTTGAGCAAGGGGAGG + Intronic
950222339 3:11205948-11205970 GAAAACCTGTGGGCCAGGCGCGG - Intronic
950730643 3:14953603-14953625 GATTCACGTATGGCCAGGCGTGG + Intronic
950750417 3:15123872-15123894 GCAGCACTTTTGGCCAGGGGGGG - Intergenic
951202971 3:19895189-19895211 GAATATGCTTGGGCCAGGCGCGG + Intronic
951215372 3:20019571-20019593 AAACCAATTTAGGCCAGGCGCGG + Intergenic
951227015 3:20132082-20132104 AAAACAATTTGGGCCAGGCGTGG + Intronic
952393939 3:32904529-32904551 GAACCATTTATGGCCAGGCGCGG + Intergenic
952394088 3:32905834-32905856 GTACCAGTTAGGGCCAGGCGTGG - Intergenic
952764072 3:36940173-36940195 GAATAATGGTGGGCCAGGCGCGG - Intronic
953117733 3:40009530-40009552 GTAGCAGTTGGGGCCAGGCGTGG - Intronic
953183741 3:40619737-40619759 GAATGAATTTGGGCCTGGCACGG - Intergenic
953278721 3:41531050-41531072 CATTCATTTTGGGCCGGGCGCGG - Intronic
953300130 3:41765978-41766000 GAATCCATTTAGGCCAGGCGTGG + Intronic
953408848 3:42676481-42676503 AAATGACTTTGAGCCAGGTGTGG - Intergenic
953715116 3:45310993-45311015 CAATGATTTTGTGCCAGGCGTGG - Intergenic
953761686 3:45692598-45692620 AACTCTCTTTGGGCCAGGCATGG - Intronic
953849110 3:46451883-46451905 CAATAACTTATGGCCAGGCGTGG - Intronic
954098005 3:48346542-48346564 GATGGACTTGGGGCCAGGCGTGG + Intergenic
954206884 3:49065992-49066014 GAATCACTTCTGGCCAGGAATGG + Intronic
954253032 3:49383141-49383163 TAATCTCTTTCGGCCAGGTGTGG + Intronic
954438189 3:50507040-50507062 GAGTCATTTGGGGCCAGGCATGG + Intergenic
954514936 3:51165215-51165237 GAATGACTCCTGGCCAGGCGTGG - Intronic
954703303 3:52464104-52464126 AAATCAGATTGGGCCGGGCGCGG + Intronic
954894186 3:53961907-53961929 GAATGGCTTTGGGGCAGGTGAGG + Intergenic
954936095 3:54328570-54328592 AAATAACTTGAGGCCAGGCGTGG - Intronic
955171316 3:56567978-56568000 AAACCACTTTTGGCCGGGCGTGG - Intronic
955286162 3:57643857-57643879 TTATCAGTCTGGGCCAGGCGTGG + Intronic
955367160 3:58320822-58320844 GAATTATTCTAGGCCAGGCGTGG + Intergenic
955432628 3:58864245-58864267 ATAACACTTTTGGCCAGGCGCGG - Intronic
956175817 3:66472012-66472034 CACTAACTTCGGGCCAGGCGTGG + Intronic
956226901 3:66970419-66970441 CATTCAATATGGGCCAGGCGCGG - Intergenic
956618820 3:71199785-71199807 ATATCACTTAGGGCCAGGCGCGG + Intronic
956695045 3:71911272-71911294 AAATCAATCTGGGCCAGGTGTGG - Intergenic
956806836 3:72822857-72822879 GAGTCACTATAGGCCGGGCGCGG + Intronic
956987325 3:74716573-74716595 AAATAACTTTAGGCCGGGCGCGG - Intergenic
957024053 3:75159504-75159526 GAATCATAATGGGCCAGGTGTGG - Intergenic
957094123 3:75762146-75762168 GAATGACATTTGGCCAGGTGTGG + Intronic
957370959 3:79293766-79293788 AAACTACTTTGGGCCGGGCGCGG + Intronic
957649053 3:82975592-82975614 AAGTCAATGTGGGCCAGGCGCGG - Intergenic
958429298 3:94019054-94019076 GAATGACTTCCAGCCAGGCGCGG - Intronic
958516314 3:95120597-95120619 GAATGTCTTTAGGCCAGGCGTGG - Intergenic
958562508 3:95765150-95765172 TAATAACTGTGGGCCAGGCGTGG - Intergenic
958903221 3:99912666-99912688 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
958981438 3:100725194-100725216 AATTCCCTTTTGGCCAGGCGTGG - Intronic
959703154 3:109316788-109316810 TAATCATTTTAGGCCGGGCGCGG + Intergenic
959827886 3:110821800-110821822 GATTTATTCTGGGCCAGGCGTGG + Intergenic
960090893 3:113637085-113637107 GAATGACAGTGGGCCGGGCGCGG + Intergenic
960548000 3:118939283-118939305 AAATCACTTCGGGCCAGGTGTGG + Intronic
960884650 3:122382202-122382224 TAAACACTTTAGGCCGGGCGTGG + Intronic
961018377 3:123484251-123484273 AAAACACTTTAGGCCAGGCTCGG - Intergenic
961042430 3:123686929-123686951 GAATAAATGTGGGCCAGGCGCGG + Intronic
961281005 3:125766042-125766064 GCATCTCTGTGGACCAGGCGTGG - Intergenic
961282062 3:125771759-125771781 GCAGCACTTTCGGCCAAGCGGGG - Intergenic
961369647 3:126421711-126421733 GCATCAGTTTGGGCCATGGGAGG - Intronic
961560672 3:127726718-127726740 GAACCCCTGTAGGCCAGGCGCGG - Intronic
961598291 3:128037626-128037648 AAAACACTCTTGGCCAGGCGAGG + Intergenic
961690489 3:128666001-128666023 GAGTCACTCTGGGCCGGGCGCGG - Intronic
962009135 3:131376686-131376708 GAATCCCTTTGGTCAAGGAGAGG - Intergenic
962131715 3:132685759-132685781 GAAACAATGTGGGCCAGGCGTGG + Intronic
962140262 3:132782874-132782896 GAATCCATTTGGGCCAGGTGTGG - Intergenic
962328935 3:134460546-134460568 GTATCACTTCTGGGCAGGCGTGG - Intergenic
962406135 3:135101670-135101692 GTGTCACTTCAGGCCAGGCGTGG - Intronic
962915377 3:139897479-139897501 GAATCACTGTAGGCTAGGCATGG + Intergenic
962923526 3:139971971-139971993 GAACAAGTTTGAGCCAGGCGTGG + Intronic
963141710 3:141951092-141951114 GAACCAATTTGGGCCATGCTTGG + Intergenic
963147240 3:142007062-142007084 AAGTCATTTAGGGCCAGGCGTGG - Intronic
963444301 3:145383936-145383958 AAAGCTTTTTGGGCCAGGCGTGG + Intergenic
963602713 3:147391732-147391754 GAAACAATTTGGGCCAGGATGGG - Intronic
963698083 3:148587801-148587823 TAATAAATTTGGGCCAGGCACGG + Intergenic
963891477 3:150640428-150640450 GAAAAAATTTTGGCCAGGCGCGG - Intergenic
964020221 3:152001038-152001060 GAGCTAATTTGGGCCAGGCGTGG + Intergenic
964281522 3:155071869-155071891 GAATCACTGTCGGCCGGGCGCGG + Intronic
964568091 3:158080550-158080572 GAAGAACATTGGGCCAGGTGTGG + Intergenic
964584424 3:158280935-158280957 GAATCACTTTGGGCCAGGCGCGG - Intronic
964728339 3:159838598-159838620 GAAACAACATGGGCCAGGCGCGG + Intronic
964744487 3:159999473-159999495 TAAACATTTTGGGCCGGGCGCGG + Intergenic
964846079 3:161045819-161045841 AAATCAATGAGGGCCAGGCGTGG + Intronic
964855703 3:161143314-161143336 TAATTATTTTAGGCCAGGCGCGG - Intronic
964857249 3:161159793-161159815 AAATCACTGTTGGCCGGGCGCGG - Intronic
965111791 3:164433857-164433879 GAATTCCTTTGGCCCAGGAGAGG + Intergenic
965168096 3:165222792-165222814 AAATAAATGTGGGCCAGGCGCGG + Intergenic
965368860 3:167835380-167835402 GAGTGAATTTGGGCCAGGCACGG - Intergenic
965528345 3:169745533-169745555 AACTGACTTTGGGCCGGGCGCGG - Intergenic
965862913 3:173168826-173168848 TGATCACTCTGGGCCAGGCGGGG + Intergenic
965913516 3:173812435-173812457 GTATAACTTTAGGCCAGGCGTGG + Intronic
966183765 3:177210256-177210278 ACATAACTTTTGGCCAGGCGCGG + Intergenic
966213401 3:177476224-177476246 AAATTACTCTGGGCCAGGCACGG - Intergenic
966274840 3:178152894-178152916 GAACAACTCTTGGCCAGGCGCGG - Intergenic
966309176 3:178574775-178574797 TAATAAATCTGGGCCAGGCGTGG + Intronic
966831239 3:184011030-184011052 GAATGAGTTTGGGCCGGGCACGG - Intronic
967094133 3:186162830-186162852 GATTGAGGTTGGGCCAGGCGCGG - Intronic
967280617 3:187819313-187819335 GAATCTCATTCGGCCAGGCGCGG - Intergenic
967363210 3:188655897-188655919 AAAACACTTTGGGCCAGTTGCGG + Intronic
967555258 3:190849353-190849375 GACTCCCTGTGGGCCAGGGGTGG + Intergenic
967749155 3:193094129-193094151 GAAACAAATTGGGCCAGGCGTGG - Intergenic
968000058 3:195199319-195199341 GAATCTTTTTGGGCCGGGCGCGG + Intronic
968124077 3:196145613-196145635 GAATCAATCAGAGCCAGGCGTGG - Intergenic
968499563 4:941777-941799 AAATCAATTTTGGCCAGGCGTGG + Intronic
968841816 4:3012848-3012870 GAATCTTTTTAGGCCAGGCGCGG + Intronic
969016682 4:4108032-4108054 GCATCACTGTGGACCAGGCGTGG + Intergenic
969295263 4:6266435-6266457 TAGTGACTTTTGGCCAGGCGTGG - Intergenic
969573833 4:8025216-8025238 AAATCACATGAGGCCAGGCGTGG - Intronic
969737276 4:9000283-9000305 GCATCTCTGTGGACCAGGCGTGG - Intergenic
969796478 4:9531871-9531893 GCATCACTGTGGACCGGGCGTGG - Intergenic
970156385 4:13145569-13145591 ACAACATTTTGGGCCAGGCGTGG - Intergenic
970822171 4:20230710-20230732 AAATAACATTGGGCCAGGCATGG + Intergenic
970942244 4:21648161-21648183 GTATCATTGTAGGCCAGGCGCGG - Intronic
971304630 4:25468905-25468927 TAATTGCTTAGGGCCAGGCGCGG - Intergenic
971304725 4:25469766-25469788 GAATAATTTTGGGCCAGAGGTGG + Intergenic
971352572 4:25866218-25866240 AAACCATTTTGGGCCAGGCATGG - Intronic
971367054 4:25985758-25985780 AAAGCACTTAGGGCCAGGCATGG - Intergenic
972497398 4:39646803-39646825 GAATAACTTTTGGCCAGGCTTGG + Intergenic
972709236 4:41577717-41577739 AAATCACTTGTGGCAAGGCGTGG - Intronic
973243002 4:47978114-47978136 AAATCACTTAGGGCTGGGCGCGG - Intronic
973244520 4:47996541-47996563 GACTCAATTTGTGCCAGGCCTGG - Intronic
973363537 4:49187776-49187798 GAATGACATTTGGCCAGGTGCGG - Intergenic
973768604 4:54186746-54186768 AAAACACTTCGGGCCGGGCGGGG + Intronic
973801983 4:54487323-54487345 GACTCACTTCCGGCCGGGCGCGG - Intergenic
973841661 4:54867381-54867403 AAATAACTTTGGGCCGAGCGTGG - Intergenic
973874352 4:55200988-55201010 GAATGATTCTGGGCCAGGCGTGG - Intergenic
973979817 4:56298640-56298662 GCAGGACTTGGGGCCAGGCGCGG + Intronic
974252485 4:59404644-59404666 AAATCACTTGAGGCCAGGAGTGG - Intergenic
974270176 4:59640406-59640428 AAATGACTTTTGGCCGGGCGCGG - Intergenic
974599189 4:64054097-64054119 AATTCACTTTTGGCCGGGCGCGG - Intergenic
975055610 4:69925681-69925703 GAATCACTTGGACCCAGGAGGGG - Intergenic
975117217 4:70693479-70693501 AAATCACACTGGGCCGGGCGCGG + Intergenic
975127320 4:70797552-70797574 GAACCACTCTAGGCCAGGCACGG + Intronic
975581027 4:75907116-75907138 GAATTATTTTGAGCTAGGCGGGG + Intergenic
975920671 4:79382574-79382596 TCATGACTTTTGGCCAGGCGAGG + Intergenic
975998266 4:80341064-80341086 GAAGCAGTCTGGGCCAGGCACGG - Intronic
976394636 4:84543007-84543029 ACAACATTTTGGGCCAGGCGCGG - Intergenic
976652254 4:87448432-87448454 GATTTGCTTTGGGCCAGGCGTGG - Intronic
976718183 4:88145642-88145664 GGAACACTCTGGGCCAGGCCAGG + Intronic
976973798 4:91141440-91141462 GAATGAAATTGGGCCAGGCATGG - Intronic
977597319 4:98897278-98897300 GAATGCCTTTGGGCCAGGCATGG + Intronic
977945361 4:102907011-102907033 AAATGACTTTAGGCCAGGCATGG - Intronic
978428339 4:108605460-108605482 AAGTCATTTAGGGCCAGGCGTGG + Intergenic
978520138 4:109607035-109607057 TAATAACTATGGACCAGGCGTGG - Intronic
978529225 4:109697555-109697577 AAATTACTTTTGGCCAGGTGTGG - Intronic
978745447 4:112189093-112189115 GAATTAGATTGGGCCGGGCGCGG + Exonic
978787094 4:112622016-112622038 AAATCATTTCAGGCCAGGCGCGG - Intronic
978860500 4:113442997-113443019 GAATGTCTGTGGGCCAGGCACGG - Intergenic
979116423 4:116829951-116829973 GAAGCATTCTGGGCCAGGAGTGG - Intergenic
979303524 4:119115113-119115135 ATATAACTGTGGGCCAGGCGCGG - Intergenic
979632481 4:122919503-122919525 GATTCAGTTTTGGCCAGGCGCGG - Intronic
980023620 4:127738376-127738398 TAAACAATTTGGGCCAGGCGTGG - Intronic
980042595 4:127956213-127956235 GAAATACTTTTGGCCAGGTGCGG + Intronic
980122338 4:128740996-128741018 GAATCACTTGAGGCCAGCCTGGG + Intergenic
980154119 4:129083499-129083521 AAATCACTTTTGGCCAGGCATGG + Intronic
980773556 4:137409809-137409831 AAATCAGTGGGGGCCAGGCGCGG - Intergenic
980937562 4:139240873-139240895 GTATAACTTTAGGCCGGGCGCGG - Intergenic
980987350 4:139708710-139708732 AAACAACTATGGGCCAGGCGCGG + Intronic
981030688 4:140122500-140122522 AAACCATTTTGGGCCGGGCGCGG + Intronic
981258579 4:142692408-142692430 GTATCAAATTGGGCCAGGTGGGG + Intronic
981893812 4:149773059-149773081 GAATTACTATCGGCCGGGCGTGG + Intergenic
981977479 4:150748376-150748398 GAATGAAATTGAGCCAGGCGCGG + Intronic
982266850 4:153545575-153545597 GAAACAGTTTGGGCCTGGCACGG - Intronic
982603759 4:157486350-157486372 AAATACCTATGGGCCAGGCGCGG - Intergenic
983212542 4:164973877-164973899 AAAACACATTGGGCCAGGCGTGG + Intronic
983770975 4:171548472-171548494 AAATAACTTTTGGCCGGGCGCGG - Intergenic
984020484 4:174479010-174479032 GAATAACTTGGGGTCAGGGGTGG + Intergenic
984121468 4:175750346-175750368 GGCTCACTTAGGGCCAGGTGTGG - Intronic
984241400 4:177224559-177224581 CAATCAATGTAGGCCAGGCGTGG + Intergenic
984910225 4:184667598-184667620 GTCTCACTTTCGGCCAGGCACGG - Intronic
984962053 4:185107388-185107410 GAGTCACTCTGGGCTGGGCGCGG + Intergenic
985165740 4:187092324-187092346 GATGCACTTTTGGCCAGGCATGG + Intergenic
985344563 4:188989224-188989246 AAAGCACATTGGGCCAGGTGTGG - Intergenic
985358768 4:189149269-189149291 AAAGAATTTTGGGCCAGGCGTGG + Intergenic
985942362 5:3147735-3147757 AACTCACTTTTGGCCAGGCATGG - Intergenic
986134449 5:4961092-4961114 GAATATTTTTGGGCCAGGTGTGG - Intergenic
986413490 5:7505172-7505194 AAATCACTTCAGGCCAGGCACGG - Intronic
986699790 5:10395087-10395109 GAATTAGTTTTGGCCGGGCGCGG - Intronic
987435069 5:17884263-17884285 GAAACAGTGTGGGCCAGGCATGG - Intergenic
987731000 5:21772562-21772584 GATTCTATTTGGGCCAGGCACGG - Intronic
987968643 5:24911499-24911521 GAATCACTTGAGCCCAGGGGTGG - Intergenic
988677666 5:33449743-33449765 GAATCATTTTTGGCTGGGCGCGG - Intronic
988736128 5:34023143-34023165 AACTGACTTTGAGCCAGGCGCGG - Intronic
989082383 5:37637049-37637071 GAAGAATTTTAGGCCAGGCGTGG + Intronic
989321906 5:40144550-40144572 GAAACACCTGGGGCCGGGCGTGG - Intergenic
989381626 5:40814482-40814504 AAATCATTTTGGGCTGGGCGTGG - Intergenic
990247588 5:53878836-53878858 TAAAAAATTTGGGCCAGGCGCGG + Intergenic
990406869 5:55500367-55500389 AAATAATTTTAGGCCAGGCGTGG - Intronic
990648985 5:57877265-57877287 GAGTGACTGGGGGCCAGGCGCGG - Intergenic
990651525 5:57905765-57905787 AAATTATTTTAGGCCAGGCGCGG + Intergenic
990807441 5:59681608-59681630 GAATGAGTTTGGGCCAGGTGCGG + Intronic
991109316 5:62880398-62880420 AAATCACATCAGGCCAGGCGCGG - Intergenic
991285486 5:64970500-64970522 AAATTACTTTCGGCCGGGCGTGG - Intronic
991349257 5:65703745-65703767 GAATAAATTTAGGCCGGGCGCGG + Intronic
991389839 5:66130914-66130936 AAACAACTTTGGGCCAGGTGCGG + Intergenic
991435862 5:66596631-66596653 GAGGCACTTTGGGCCAGACAGGG + Exonic
991674375 5:69076469-69076491 AAAGTACTATGGGCCAGGCGCGG + Intergenic
991679691 5:69126428-69126450 AAAATACTTTAGGCCAGGCGCGG - Intronic
991963515 5:72068597-72068619 AAATCATTCTTGGCCAGGCGTGG + Intergenic
992164359 5:74034570-74034592 GAGTCACTTGGGGCAAGGCAGGG - Intergenic
992231018 5:74663963-74663985 AAAAAACTTTAGGCCAGGCGTGG + Intronic
992930907 5:81643891-81643913 GTAAAAATTTGGGCCAGGCGCGG - Intronic
992964785 5:81988722-81988744 AAAATACTTTGGGCCAGGCGTGG - Intronic
993164480 5:84334352-84334374 GCATCTCTTCTGGCCAGGCGCGG - Intronic
993296696 5:86149814-86149836 TAATAATTTTGGGCCAGGCGCGG - Intergenic
993666523 5:90705096-90705118 GACTCAATTTGGGCCGGGTGTGG - Intronic
993710112 5:91216188-91216210 GGACCAGTTAGGGCCAGGCGTGG + Intergenic
993728417 5:91394677-91394699 AAATAATTTTAGGCCAGGCGTGG - Intergenic
993803705 5:92377016-92377038 GAATCACTTGAGCCCAGGAGTGG + Intergenic
993970098 5:94408661-94408683 GATTCACTCTGGGCCAGGCGTGG - Intronic
994198139 5:96942361-96942383 GAATCACTCTAGGCCCAGCGCGG + Intronic
994371520 5:98972674-98972696 TAATGACTTAGGGCCAGGGGTGG - Intergenic
994629243 5:102262623-102262645 GGATCACTTGAGGCCAGGAGTGG - Intronic
994747327 5:103694856-103694878 GAATCAATTGTGGCCGGGCGCGG + Intergenic
994796480 5:104307137-104307159 GTATCACTATGGGCAGGGCGAGG + Intergenic
995340069 5:111048531-111048553 GAATCATTTATGGCCGGGCGCGG + Intergenic
995545481 5:113225880-113225902 GAAACGTCTTGGGCCAGGCGTGG + Intronic
995612594 5:113926034-113926056 GGATGAGTTTGGGCTAGGCGCGG + Intergenic
995722331 5:115150047-115150069 TAAGCACATTGGGCCAGGCACGG - Intronic
995858517 5:116618301-116618323 GAAATAATTTGGGCCGGGCGCGG + Intergenic
995998563 5:118330149-118330171 GGATTACTATGGGCCAGGCATGG + Intergenic
996103675 5:119472722-119472744 CAATTACGTTGGGCCGGGCGCGG - Intronic
996601233 5:125266102-125266124 AAAACACTTTGGGCCAGGCGCGG - Intergenic
996699879 5:126439607-126439629 CAATCAATTTTGGCCAGGTGCGG - Intronic
996700139 5:126442580-126442602 AAAGCATTTTAGGCCAGGCGCGG - Intronic
996883510 5:128327926-128327948 AACTCAGTTTGGGCCAGGCGTGG - Intronic
997259469 5:132454920-132454942 AAATCAAATGGGGCCAGGCGCGG - Intronic
997328600 5:133042886-133042908 AGATCACTTTTGGCCGGGCGCGG - Intergenic
997917948 5:137947873-137947895 AAATTTCTTTTGGCCAGGCGCGG - Intronic
998123524 5:139599444-139599466 AAAACAATTTTGGCCAGGCGCGG + Intronic
998492930 5:142562862-142562884 AAATCAATTTTGGCCAGGCGCGG + Intergenic
998542124 5:142992714-142992736 AAATCACTACTGGCCAGGCGTGG - Intronic
998862571 5:146458767-146458789 AAATAACGTAGGGCCAGGCGTGG - Intronic
999250869 5:150181567-150181589 GAGTCATGTAGGGCCAGGCGCGG - Intronic
999395910 5:151227679-151227701 TAATAACTTGGGGCCAGGCATGG + Intronic
999907902 5:156163728-156163750 AAATCATTTTCGGCCGGGCGCGG + Intronic
1000701551 5:164457498-164457520 GAATGACCCTGGGCCAGGCATGG + Intergenic
1000760972 5:165223911-165223933 TAAGCACTTTAGGCCAGGCGTGG - Intergenic
1000938418 5:167330945-167330967 AAAGCATTATGGGCCAGGCGTGG + Intronic
1001151056 5:169227513-169227535 GAATCACTTGAGCCCAGGAGGGG - Intronic
1001360135 5:171075660-171075682 TAAACACTTTAGGCCAGGCGTGG + Intronic
1001482949 5:172101178-172101200 AAGTCAATTTTGGCCAGGCGTGG + Intronic
1001511136 5:172322804-172322826 GAAACACTATGGGGCAGGCGTGG - Intergenic
1001999657 5:176190607-176190629 GGATAACTTTGGGCCGGGCGCGG + Intergenic
1002744783 5:181461581-181461603 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1002843992 6:929841-929863 AACTCACTTGGGGCCTGGCGCGG + Intergenic
1002980852 6:2136424-2136446 GAACTGATTTGGGCCAGGCGTGG + Intronic
1003468466 6:6404988-6405010 GAAATACTATGGGCCGGGCGCGG - Intergenic
1003950672 6:11112541-11112563 AAAGCAGTTTGGGCCAGGTGTGG - Intronic
1004063421 6:12220219-12220241 GAATATGTGTGGGCCAGGCGTGG + Intergenic
1004137006 6:12977240-12977262 AGATCATTTTTGGCCAGGCGCGG - Intronic
1004377786 6:15105561-15105583 GACTGACTCTGGGCCAGGCACGG - Intergenic
1004615478 6:17283705-17283727 TTACCATTTTGGGCCAGGCGCGG - Intronic
1004923670 6:20399992-20400014 GTGTCACTTCTGGCCAGGCGCGG + Intergenic
1004999952 6:21230450-21230472 GAAACACCATGGGCCAGGTGTGG - Intronic
1005037182 6:21567568-21567590 AAATCACTTGAGGCCAGGCGTGG - Intergenic
1005254138 6:23981807-23981829 TACTCAGGTTGGGCCAGGCGCGG + Intergenic
1005333118 6:24768085-24768107 TAACCATTTTGGGCCAGGCGTGG + Intergenic
1005341116 6:24844765-24844787 TAACCATTTTGGGCCAGGCGCGG - Intronic
1005357220 6:24996090-24996112 ATATCACTCTAGGCCAGGCGTGG - Intronic
1005511198 6:26513015-26513037 GAATTTATGTGGGCCAGGCGCGG + Intergenic
1005703371 6:28427081-28427103 AAATACTTTTGGGCCAGGCGCGG - Intergenic
1006002413 6:30975625-30975647 AAAACACTGTGGGCCAGGTGCGG - Intergenic
1006120425 6:31801502-31801524 AAAGAACTTTTGGCCAGGCGTGG + Intronic
1006433330 6:34011923-34011945 AAATTACTTGGGGCCAGGCGTGG + Intergenic
1006621133 6:35364997-35365019 GTAACACTTGGGGCCGGGCGCGG - Intronic
1006749967 6:36371000-36371022 CATTCACTATGTGCCAGGCGTGG - Intronic
1006770458 6:36548376-36548398 AAATCACTTCTCGCCAGGCGCGG + Intergenic
1006869244 6:37235654-37235676 GAAATACATTAGGCCAGGCGTGG - Intronic
1006903947 6:37520796-37520818 GAAGCAATTTGGATCAGGCGCGG - Intergenic
1007411222 6:41662996-41663018 GAATCACTTGGGGCCGGGCACGG - Intergenic
1007454130 6:41963039-41963061 AAATTATTTTTGGCCAGGCGTGG - Intronic
1007460347 6:42013781-42013803 GAATGACTCAGGGCCGGGCGTGG + Intronic
1007522798 6:42465198-42465220 GAATAACATTTGGCCAGGTGCGG - Intergenic
1007930116 6:45683072-45683094 GAATTACAATGGGCCAGGCATGG - Intergenic
1008094632 6:47327350-47327372 GGATCACTTGAGGCCAGGAGTGG + Intergenic
1008114450 6:47531780-47531802 GAATCCTTTTCGGCCGGGCGTGG + Intronic
1008298473 6:49805856-49805878 GAAGCAGTCTGGGCCTGGCGTGG - Intergenic
1008526470 6:52412465-52412487 TAATGACTGTGGGCCAGGTGCGG - Intergenic
1009478056 6:64120055-64120077 GTATATCTTTTGGCCAGGCGTGG + Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1009561131 6:65244810-65244832 AAATAAGTTCGGGCCAGGCGCGG - Intronic
1009891202 6:69685508-69685530 CAAAAACTTTGGGTCAGGCGTGG + Intronic
1010142662 6:72628901-72628923 AGATCACTTTGGGCCAGGTGTGG - Intronic
1010224034 6:73472983-73473005 AAATGACTTTAGGCCGGGCGCGG + Intronic
1010539341 6:77071344-77071366 GTGTGACTTTGGGCCAGGCACGG - Intergenic
1010761220 6:79725433-79725455 TTAGCAGTTTGGGCCAGGCGTGG + Intergenic
1011600781 6:89058233-89058255 TAATGAATTTGGGCCAGGTGCGG + Intergenic
1011637076 6:89384524-89384546 GTATAACTTTAGGCCAGGCGTGG + Intronic
1011694195 6:89897430-89897452 GAATAACTTGAGGCCAGGCATGG + Intergenic
1013132050 6:107242532-107242554 TAATAATTTTTGGCCAGGCGTGG - Intronic
1013136652 6:107289055-107289077 ATATCAATTTCGGCCAGGCGCGG - Intronic
1014384371 6:120781998-120782020 GAATTACTTTGCCCCAGGGGAGG - Intergenic
1014850654 6:126336366-126336388 GAATGCTTTTTGGCCAGGCGGGG - Intergenic
1014981647 6:127952552-127952574 TACCCACTTTAGGCCAGGCGTGG + Intergenic
1015193962 6:130504911-130504933 AAATCAGATTGGGCCGGGCGCGG - Intergenic
1015672314 6:135704506-135704528 AAGGCATTTTGGGCCAGGCGTGG + Intergenic
1015840215 6:137468600-137468622 AAATCATTTTAGGCCAGGCACGG + Intergenic
1015936576 6:138410774-138410796 GAAACATTTTGGGCCAGGCATGG - Intronic
1015976060 6:138792236-138792258 AAATAACTCTGGGCCAGGTGTGG + Intronic
1016150528 6:140735758-140735780 GATTTACTTTTGGCCAGTCGCGG - Intergenic
1016318501 6:142816683-142816705 GATTGACTTTGAGCCAGGGGAGG - Intronic
1016508546 6:144813476-144813498 GAAAAACTCTGGGCCAGGTGTGG - Intronic
1016706220 6:147111119-147111141 AAATCACTGTGTGCCAGGCTTGG + Intergenic
1016873156 6:148838602-148838624 TGATCACTTTGGGCCAGGCATGG + Intronic
1017125269 6:151058964-151058986 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
1017183200 6:151573951-151573973 GCATCACTTAAGGCCAGGCCTGG + Intronic
1017385340 6:153876347-153876369 GGAGTACTATGGGCCAGGCGTGG + Intergenic
1017423552 6:154297328-154297350 TAATGACTTTGGGCTGGGCGCGG - Intronic
1017475719 6:154789833-154789855 GAAGCATTCTAGGCCAGGCGCGG - Intronic
1017697530 6:157032085-157032107 TATTCATTTTGGGCCGGGCGTGG - Intronic
1018108521 6:160512324-160512346 TAATCACTTGAGGCCAGGCATGG - Intergenic
1018162069 6:161054443-161054465 AAATTAGTTTGGGCCGGGCGCGG - Intronic
1018562957 6:165121259-165121281 GAATAAAATTCGGCCAGGCGTGG + Intergenic
1018756432 6:166853482-166853504 CAATGGCTTTGGGCCAGGAGAGG - Intronic
1018776090 6:167017283-167017305 GTATCATTATTGGCCAGGCGCGG - Intronic
1018892518 6:167992074-167992096 GTAACAATTTTGGCCAGGCGAGG - Intergenic
1019249694 6:170735122-170735144 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1019932391 7:4232751-4232773 GAATCACGATGAGCCAGGCATGG - Intronic
1020019494 7:4854401-4854423 TTACCACTTTGGGCCGGGCGCGG + Intronic
1020054955 7:5111316-5111338 TCATCTATTTGGGCCAGGCGTGG + Intergenic
1020081646 7:5289307-5289329 GAATCACTTGAGCCCAGGAGGGG + Intronic
1020308354 7:6851798-6851820 AAGTTGCTTTGGGCCAGGCGTGG - Intergenic
1020559866 7:9717548-9717570 AAATCATTTTGGGCCGGGCGCGG + Intergenic
1020611950 7:10409096-10409118 GAATCACTTGAGCCCAGGAGGGG - Intergenic
1020650543 7:10869876-10869898 AAATCTCTTTGGGCCAAGCATGG + Intergenic
1020652321 7:10890356-10890378 GAATTACTGTAGGCCAGGTGTGG + Intergenic
1020829371 7:13074927-13074949 GGATCACTTGAGGCCAGGAGTGG - Intergenic
1021698560 7:23296419-23296441 AACTAACTTTGGGCCAGGTGCGG + Intergenic
1021715987 7:23462650-23462672 AAATATCCTTGGGCCAGGCGAGG - Intronic
1021720074 7:23496336-23496358 AAAAAACTTTGGGCCAGGCGTGG - Intergenic
1021722423 7:23517190-23517212 AAATCACTTGGGGCCGGGCACGG + Intronic
1021870881 7:25004983-25005005 GAGAAACTTTGGGCCGGGCGCGG + Intergenic
1021999319 7:26209997-26210019 GAAGCAGTTTTGGCCAGGCACGG + Intronic
1022077008 7:26981778-26981800 CAAACAGTTTAGGCCAGGCGTGG + Intronic
1022083805 7:27047669-27047691 AAAACACTTTGGGCCGGGCGTGG + Intergenic
1022733952 7:33058639-33058661 GTACTACTCTGGGCCAGGCGCGG - Intronic
1023283080 7:38591575-38591597 GAGCCATTTGGGGCCAGGCGTGG - Intronic
1023560803 7:41471470-41471492 GAAAAAGTCTGGGCCAGGCGCGG + Intergenic
1023660793 7:42469121-42469143 GGGTGACTTTTGGCCAGGCGTGG + Intergenic
1023735400 7:43231724-43231746 GAACCTCTTGGGGCCAGGCGCGG + Intronic
1023796195 7:43794442-43794464 AAATCACTTTAGGCCAGGCACGG + Intronic
1023900939 7:44478258-44478280 TATTTACTTTGGGCCGGGCGCGG + Intronic
1024903669 7:54351958-54351980 CAATTACTATGGGCCGGGCGCGG + Intergenic
1025124008 7:56330325-56330347 TATTCACTCTGGGCCAGGCGCGG - Intergenic
1025191270 7:56897741-56897763 GAGTCCCTCTGGGCCAGGCACGG - Intergenic
1025197256 7:56942855-56942877 GAATCACTTGAGCCCAGGAGGGG - Intergenic
1025674693 7:63634084-63634106 GAATCACTTGAGCCCAGGAGGGG + Intergenic
1025680676 7:63679193-63679215 GAGTCCCTCTGGGCCAGGCACGG + Intergenic
1025766964 7:64464542-64464564 AAGTCATTTTAGGCCAGGCGCGG + Intergenic
1025869085 7:65414043-65414065 CATTCACTTTGGGCCAGGCGCGG - Intergenic
1025950900 7:66144766-66144788 AAATCACCTTAGGCCAGGTGTGG - Intronic
1025969263 7:66307004-66307026 TAACTACCTTGGGCCAGGCGCGG - Intronic
1026352241 7:69527432-69527454 GAAGGAATTCGGGCCAGGCGTGG - Intergenic
1026436388 7:70402639-70402661 GAATCACTTGGGGATGGGCGTGG + Intronic
1026453095 7:70546486-70546508 AAATCATTCAGGGCCAGGCGTGG + Intronic
1026907861 7:74073126-74073148 GAATTGCTTTGGGCCAGATGTGG - Intergenic
1026944959 7:74309906-74309928 ATACCACTTTGGGCCAGGCATGG + Intronic
1027010815 7:74743028-74743050 GAATCACTGCAGGCCGGGCGTGG + Intronic
1027077227 7:75203012-75203034 GAATCACTGCAGGCCGGGCGTGG - Intergenic
1027166892 7:75841066-75841088 GAATTGGTTTAGGCCAGGCGTGG + Intergenic
1027259377 7:76453721-76453743 CAATCAATTTGGGCTGGGCGCGG + Intergenic
1027310748 7:76951802-76951824 CAATCAATTTGGGCTGGGCGCGG + Intergenic
1027489388 7:78804456-78804478 AAAAAACTTTGGGCCAGGCACGG + Intronic
1027828872 7:83152252-83152274 AAGTAACTTTGGGCCGGGCGTGG - Intronic
1027975986 7:85156388-85156410 GAATCACTTGTGGCCAGGTGTGG - Intronic
1028071817 7:86459952-86459974 AAATTACTATAGGCCAGGCGTGG - Intergenic
1028406091 7:90475668-90475690 AAATATCTTTGGGCCAGGCGTGG + Intronic
1028553986 7:92103098-92103120 AAAACAATCTGGGCCAGGCGTGG + Intronic
1028927006 7:96369162-96369184 GAATTACTTTTGGCCGGGTGTGG + Intergenic
1029005813 7:97207791-97207813 ATATCACTTTGGGCCAGGCATGG - Intergenic
1029074338 7:97924283-97924305 GTAGCACTTTCGGCCAGGGGGGG + Intergenic
1029075155 7:97928832-97928854 GCATCACTGTGGACCAGTCGTGG + Intergenic
1029282558 7:99445591-99445613 GTATCACTAGGGGTCAGGCGTGG + Intronic
1029351933 7:100019494-100019516 GAATCAATCAGGGCCAGGCACGG - Intronic
1029358918 7:100073863-100073885 GTATCAGATTTGGCCAGGCGCGG + Intronic
1029478308 7:100798379-100798401 ACATAATTTTGGGCCAGGCGTGG - Intergenic
1029628935 7:101738362-101738384 AAATTACTCTGGGCCAGGTGCGG + Intergenic
1029865255 7:103620762-103620784 GGATCAGGTTAGGCCAGGCGCGG - Intronic
1030302418 7:107987790-107987812 GATCCAGTTTGGCCCAGGCGCGG - Intronic
1030619483 7:111773724-111773746 ACATCACTGTGGGCCAGGTGCGG + Intronic
1030973721 7:116094388-116094410 GAATACATTTTGGCCAGGCGTGG + Intronic
1031398020 7:121295925-121295947 GAACCACTGTGGGCCAGGTATGG + Exonic
1031476341 7:122227256-122227278 TAATCACTTTGGCCCAGGATGGG + Intergenic
1031889978 7:127282766-127282788 AATTTATTTTGGGCCAGGCGTGG + Intergenic
1032769692 7:135038669-135038691 AAATCTTTTTGGGCCAGACGTGG + Intronic
1032788072 7:135217140-135217162 ATATCACTCTGGGCCAGGCACGG - Intergenic
1032788593 7:135222803-135222825 AAATAATTTTAGGCCAGGCGCGG + Intergenic
1033046162 7:137964022-137964044 GAAACACTTGCGGCCAGGCGCGG + Intronic
1033074624 7:138237007-138237029 TAATTACTTTTGGCCAGGCGTGG + Intergenic
1033152845 7:138931459-138931481 GTCTCAATTTTGGCCAGGCGTGG + Intronic
1033206649 7:139429024-139429046 TAATCACTTTAGGCCAGGCGTGG + Intergenic
1033330503 7:140413416-140413438 GAATGTCTTTGGGCCAGGCACGG + Intronic
1033470910 7:141647959-141647981 AAATAATTTTTGGCCAGGCGCGG - Intronic
1033965747 7:146973316-146973338 TAACCAGTGTGGGCCAGGCGCGG - Intronic
1034248429 7:149667693-149667715 GTATGAGTTTGGGCCAGGTGTGG + Intergenic
1034603642 7:152288444-152288466 GAATCACTTAGACCCAGGGGCGG + Intronic
1034657758 7:152742893-152742915 GAATCCGTCTCGGCCAGGCGCGG + Intergenic
1035084983 7:156250520-156250542 GAATCACTTGAGCCCAGGAGGGG + Intergenic
1035190936 7:157167824-157167846 GAGGCACTTTAGGCCAGGCATGG - Intronic
1035218184 7:157386896-157386918 AAATCACTTTGGGACAGTCAAGG + Intronic
1035349344 7:158235050-158235072 GAGCCATTTTGGGCCAGGCCCGG - Intronic
1035498402 8:72534-72556 GAATCCCTTTGGCCCAGAGGCGG + Intergenic
1036200051 8:6763080-6763102 CAAATACATTGGGCCAGGCGCGG - Intergenic
1036242370 8:7091546-7091568 GCATCACTGTGGACCAGGCGTGG - Intergenic
1036243367 8:7097007-7097029 GCAGCACTTTTGGCCAGGGGAGG - Intergenic
1036258419 8:7222466-7222488 GCATCACTGTGGACCAGTCGTGG + Intergenic
1036259479 8:7228610-7228632 GCATCACTGTGGACCAGTCGTGG + Intergenic
1036307146 8:7610914-7610936 GCATCACTGTGGACCAGTCGTGG - Intergenic
1036308203 8:7617042-7617064 GCATCACTGTGGACCAGGTGTGG - Intergenic
1036310472 8:7681062-7681084 GCATCACTGTGGACCAGTCGTGG + Intergenic
1036311521 8:7687180-7687202 GCATCACTGTGGACCAGTCGTGG + Intergenic
1036357991 8:8058901-8058923 GCATCACTGTGGACCAGTCGTGG - Intergenic
1036359060 8:8065043-8065065 GCATCACTGTGGACCAGGTGTGG - Intergenic
1036508559 8:9379319-9379341 GTGTGTCTTTGGGCCAGGCGTGG + Intergenic
1036604548 8:10293911-10293933 GAATCATCTTGGGCCAGGCATGG + Intronic
1036830365 8:12015584-12015606 GCATCACTGTGGACCAGGCGTGG + Intergenic
1036891898 8:12601909-12601931 GCATCACTGTGGACCAGGTGTGG + Intergenic
1036892958 8:12608045-12608067 GCATCACTGTGGACCAGTCGTGG + Intergenic
1036898463 8:12654423-12654445 GCAGCACTTTTGGCCAGGGGAGG + Intergenic
1036899445 8:12659884-12659906 GCATCACTGTGGACCAGGTGTGG + Intergenic
1036900512 8:12666031-12666053 ACATCACTGTGGACCAGGCGTGG + Intergenic
1036983393 8:13497088-13497110 GAATTTGTTTAGGCCAGGCGCGG - Intronic
1037361459 8:18078984-18079006 GAAACTCTCTGGGCCAGGCATGG + Intronic
1037434682 8:18850220-18850242 CAATCCCTTTGGGACAGGGGAGG - Intronic
1037555375 8:20017278-20017300 AAATCACTTTTGGCCAAGCGTGG - Intergenic
1037563792 8:20099029-20099051 AAATTATTTTTGGCCAGGCGTGG + Intergenic
1037981802 8:23259646-23259668 CACTCACCTTGGGCCAGGTGTGG - Intronic
1038503640 8:28065448-28065470 GATCCAATTTCGGCCAGGCGCGG - Intronic
1038669470 8:29570838-29570860 GAATCACTTAAGGCTAGGCACGG - Intergenic
1038748650 8:30276144-30276166 AAATAATTTTAGGCCAGGCGTGG - Intergenic
1038801545 8:30753949-30753971 AAAAAATTTTGGGCCAGGCGTGG + Intronic
1038818844 8:30933525-30933547 ATGCCACTTTGGGCCAGGCGCGG - Intergenic
1038819535 8:30939687-30939709 GAATCATAGGGGGCCAGGCGAGG + Intergenic
1038930782 8:32191368-32191390 TAATAACTTTGGGCCAGGTGTGG - Intronic
1039060063 8:33566141-33566163 GAGTCGCTTTCGGCCAGGCGCGG - Intronic
1039180610 8:34861895-34861917 GAATGACTTTTGGCCAGGTGTGG + Intergenic
1039189991 8:34962766-34962788 GAATAAAGTGGGGCCAGGCGTGG - Intergenic
1039290869 8:36093130-36093152 AAATAAATTTGTGCCAGGCGAGG + Intergenic
1039318213 8:36396705-36396727 GAATTACGTTGGGCCACTCGTGG - Intergenic
1039621688 8:39002923-39002945 GAACCACTTTAGCCCAGGAGGGG - Intronic
1039975235 8:42358210-42358232 TATTAACTTTTGGCCAGGCGCGG + Intronic
1040056289 8:43060382-43060404 TTAACATTTTGGGCCAGGCGCGG + Intronic
1040449731 8:47532357-47532379 AATCCACTCTGGGCCAGGCGTGG - Intronic
1041479642 8:58305827-58305849 GAATAAACTTGGGCCAGGCACGG + Intergenic
1041662758 8:60415081-60415103 GAATAGGTTTGGGCCAGGTGCGG + Intergenic
1041665274 8:60438417-60438439 TAAAAACTTTGGGCCAGGCATGG - Intergenic
1041710107 8:60886705-60886727 TAAATACTTTAGGCCAGGCGCGG + Intergenic
1042088110 8:65130943-65130965 GAATGAATTTGGGCCATCCGTGG + Intergenic
1042141584 8:65684673-65684695 GACTCAGTATGGGCCAGGTGCGG - Intronic
1043732127 8:83695664-83695686 AAATCAGGTTGGGCCAGGCGCGG - Intergenic
1044004334 8:86923327-86923349 GAATGGCTGTGGGCCAAGCGGGG - Intronic
1044346180 8:91107090-91107112 GAATCACTATGGGCTAGGTGGGG - Intronic
1044346232 8:91107425-91107447 GAATCACTATGGGCCGGGCGTGG - Intronic
1044892681 8:96854239-96854261 GAAACAATGTGGGCCGGGCGCGG + Intronic
1045201052 8:99981850-99981872 ATATCCTTTTGGGCCAGGCGTGG - Intronic
1045425522 8:102062179-102062201 GGATCACTTGAGGCCAGGAGAGG + Intronic
1045456974 8:102390228-102390250 GCAACACTTTGGGCCAGGCATGG + Intronic
1045808573 8:106194407-106194429 TAACCATTTTAGGCCAGGCGCGG - Intergenic
1046173099 8:110538353-110538375 AAAGCACTTTCGGCCAGGTGTGG + Intergenic
1046529636 8:115426979-115427001 AAAGCATTTTTGGCCAGGCGTGG + Intronic
1046596413 8:116266580-116266602 AAAAAACTTTTGGCCAGGCGCGG + Intergenic
1046891056 8:119421297-119421319 GAACCACTGTCGGCCGGGCGCGG - Intronic
1046932172 8:119852643-119852665 GAAGAAATTTGGGCCAGGTGTGG - Intronic
1046935185 8:119878817-119878839 GATGCATTTGGGGCCAGGCGCGG + Intronic
1047205521 8:122800144-122800166 AAATAAATTTAGGCCAGGCGCGG - Intronic
1047507156 8:125488966-125488988 GAATCAACCTGGGCCAGGTGCGG + Intergenic
1047888478 8:129279560-129279582 AGATCACTTTTGGCCAGGTGCGG - Intergenic
1048055785 8:130862701-130862723 AAAATATTTTGGGCCAGGCGCGG - Intronic
1049125523 8:140783866-140783888 GTATCACAAAGGGCCAGGCGTGG + Intronic
1049506120 8:142999709-142999731 GAATCAGATTTGGCCTGGCGTGG - Intergenic
1049609540 8:143547752-143547774 TAATAACATTAGGCCAGGCGCGG + Intergenic
1049753252 8:144295850-144295872 GAATGCCTCAGGGCCAGGCGCGG - Intronic
1049918838 9:344755-344777 TTATCATTTTGGGCCAGGTGTGG + Intronic
1049992094 9:1000059-1000081 GACTCTCTTTGGGCAAAGCGGGG + Intergenic
1050010578 9:1182167-1182189 GGCTCACTGTGGGCCAGACGCGG + Intergenic
1050152430 9:2630082-2630104 GAACCAGTTTGGGCCAGGCACGG - Intronic
1050229300 9:3501959-3501981 AAATCACTTTCGGCCAGGCGCGG + Intronic
1050306536 9:4311116-4311138 GTATACCTTTTGGCCAGGCGCGG + Intronic
1051112495 9:13655413-13655435 AAAACACTTGGGGCCGGGCGCGG + Intergenic
1051426272 9:16934748-16934770 TATTCACTTTGGGCTGGGCGTGG - Intergenic
1051426979 9:16942039-16942061 TAATCACAATGGGCCAGGCACGG + Intergenic
1051428199 9:16955592-16955614 TAGTCACTTTCGGCCAGGCACGG - Intergenic
1051659784 9:19415198-19415220 GAAACTGTTTGGGCCAGGTGTGG + Intronic
1052517807 9:29505515-29505537 TTAGCACTTTGGGCCGGGCGCGG - Intergenic
1053092772 9:35294594-35294616 GATTATCTTGGGGCCAGGCGCGG - Intronic
1053252717 9:36588358-36588380 GAGGGACTCTGGGCCAGGCGCGG - Intronic
1053599251 9:39593616-39593638 AAATCACTTGAGGCCAGGTGCGG + Intergenic
1054254273 9:62748770-62748792 AAATCACTTGAGGCCAGGTGCGG - Intergenic
1054782673 9:69179787-69179809 GATTCACTTTCAGCCGGGCGCGG - Intronic
1054906441 9:70418212-70418234 AATTTACCTTGGGCCAGGCGCGG - Intergenic
1054953351 9:70879230-70879252 CAGTCACTTTGGGCCAGGAGAGG + Intronic
1055167281 9:73212247-73212269 AGAAAACTTTGGGCCAGGCGCGG + Intergenic
1055221632 9:73940598-73940620 AAATGAATTTGGGCCAGGCATGG + Intergenic
1055322156 9:75092898-75092920 GAATCACTTTTGGCCACACAAGG + Intronic
1055531749 9:77191587-77191609 GAAATTCTTTGGGCCAGGCACGG - Intronic
1055610153 9:78014332-78014354 CAAAAACTTTAGGCCAGGCGTGG + Intronic
1056214597 9:84395291-84395313 GAAAAAGTTTGGGCCAGGTGTGG - Intergenic
1056889113 9:90473428-90473450 AAATCACTATAGGCCAGGCGTGG + Intergenic
1057177749 9:93011866-93011888 GAATCACTCTAGGCCAGGCGCGG + Intronic
1057345566 9:94247565-94247587 GAATGTCTTGGGGCCAGGTGCGG - Intergenic
1057787892 9:98101614-98101636 GAGTCACTGTTGGCCAGGCTGGG + Intronic
1057804878 9:98212792-98212814 GATGTACTTGGGGCCAGGCGTGG - Intronic
1057947233 9:99340285-99340307 AAGATACTTTGGGCCAGGCGCGG - Intergenic
1058013140 9:100000207-100000229 GGATCACTTCAGGCCAGGCCAGG + Intronic
1058044217 9:100338598-100338620 AAATCACTGTCGGCCAGGCACGG + Intronic
1058433996 9:104945482-104945504 AGATCTCTTTAGGCCAGGCGCGG + Intergenic
1058443720 9:105034700-105034722 ACTTCATTTTGGGCCAGGCGCGG + Intergenic
1058617361 9:106845600-106845622 GAGACACTATTGGCCAGGCGCGG - Intergenic
1058696897 9:107566320-107566342 GAAGCACTGGGGGCCGGGCGCGG - Intergenic
1058844932 9:108947401-108947423 CTATCACTTTAGGCCAGGCGCGG - Intronic
1058883617 9:109306319-109306341 AAAACATTCTGGGCCAGGCGTGG + Intronic
1059150344 9:111943845-111943867 AAATGACTTTGGGCCAGGCATGG - Intergenic
1059250021 9:112880038-112880060 GAATCTCTGGGGGCCAGGCATGG + Intronic
1059325338 9:113500978-113501000 AAGTCAGTTTCGGCCAGGCGTGG - Intronic
1060377394 9:123129064-123129086 AAATTACTTGGGGCCAGGTGTGG + Intronic
1060696869 9:125716836-125716858 GCCTTACTTTGGGCCAGGCCTGG + Intergenic
1061031564 9:128087226-128087248 GAATGACTGGGGGCCGGGCGCGG - Intronic
1061126815 9:128682336-128682358 GTCTCACTCTGGGCCAGGTGCGG - Intergenic
1061513542 9:131075474-131075496 GAATCACTTGAGCCCAGGAGGGG + Intronic
1061978001 9:134082101-134082123 GAATGAAGTTGGGCCAGGTGAGG + Intergenic
1062208389 9:135349651-135349673 GAATGAATATGGGCCAGGCTCGG + Intergenic
1062454593 9:136629591-136629613 CCATCACTCTGGGCCAGCCGAGG + Intergenic
1203583217 Un_KI270746v1:34163-34185 GAATCATGGTGGGCCGGGCGCGG + Intergenic
1203610594 Un_KI270748v1:92060-92082 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1185487762 X:496314-496336 AAATCACTTTGGGCTGGGCACGG - Intergenic
1185507403 X:641269-641291 AAATCAGGCTGGGCCAGGCGGGG + Intronic
1185608826 X:1382237-1382259 CCAGCACTTTGGGCCAGGCGCGG - Intronic
1185696792 X:2201000-2201022 GAACCATTTTAGGCCGGGCGCGG + Intergenic
1186192455 X:7078581-7078603 AAATAATTTTAGGCCAGGCGTGG - Intronic
1186272219 X:7901289-7901311 AAATTGCTCTGGGCCAGGCGTGG + Intronic
1186439226 X:9570965-9570987 GAGTCACTTTGGGCCGGGCGCGG - Intronic
1186469027 X:9807012-9807034 GATTAAAGTTGGGCCAGGCGTGG - Intronic
1186809801 X:13177078-13177100 AAATGGCTTTGGGCCAGGCATGG + Intergenic
1186834674 X:13425879-13425901 GAATAAATTCTGGCCAGGCGTGG + Intergenic
1187031769 X:15495324-15495346 GAAGTACATGGGGCCAGGCGCGG + Intronic
1187333028 X:18357967-18357989 GAAACAATATCGGCCAGGCGCGG + Intergenic
1187452435 X:19410888-19410910 AAATCCATTTGGGCCAGGCGTGG + Intronic
1187985188 X:24802705-24802727 AAACCATTTGGGGCCAGGCGTGG + Intronic
1188105554 X:26143707-26143729 AGATTACTTTGGGCCAGGCGCGG - Intergenic
1188173944 X:26964646-26964668 TTATCATTTTGGGCCAGGGGCGG - Intergenic
1188474055 X:30571326-30571348 GAAACCCATTTGGCCAGGCGTGG + Intronic
1188682907 X:33033418-33033440 AAGTAACTTTTGGCCAGGCGCGG + Intronic
1189434429 X:40979217-40979239 GAATCACTTGAGGCTGGGCGCGG + Intergenic
1189495130 X:41501649-41501671 GAATTTATTTGGGCCAGGCACGG + Intergenic
1189906353 X:45764203-45764225 GAATTAGTCTAGGCCAGGCGCGG + Intergenic
1190095183 X:47474174-47474196 CACACACATTGGGCCAGGCGCGG + Intronic
1190295596 X:49025454-49025476 AAATAACATTGGGCCGGGCGTGG - Intergenic
1190545805 X:51525109-51525131 GTATGACCTTGGGCCAGGCATGG - Intergenic
1190816493 X:53934350-53934372 GGATCCCTTTGGGCCGGGTGCGG - Intergenic
1190854176 X:54277005-54277027 GAATTAATGTTGGCCAGGCGCGG - Intronic
1192257738 X:69479308-69479330 GAAACAATTTCGGCCAGGCGTGG + Intergenic
1192349746 X:70347683-70347705 GAATGATTTAGGGCCGGGCGCGG + Intronic
1192601795 X:72472355-72472377 GAATAAAGTTGGGCCGGGCGCGG - Intronic
1193546138 X:82832074-82832096 AAATAAATTTGGGCCGGGCGCGG - Intergenic
1193842873 X:86429851-86429873 AATGCACTTTAGGCCAGGCGCGG - Intronic
1194000787 X:88426384-88426406 GAAACCTTTTGGGCCGGGCGCGG + Intergenic
1194355635 X:92881048-92881070 GGATCACTTGAGGCCAGGCCAGG + Intergenic
1194664660 X:96664280-96664302 GTTTCACTTTGAGCCAGGTGTGG + Intergenic
1195066134 X:101239865-101239887 AAAAAATTTTGGGCCAGGCGTGG - Intronic
1195285798 X:103382415-103382437 AAATCATTTTTGGCCAGGTGTGG + Intergenic
1195372868 X:104197269-104197291 AAAACACTTTGGGCCGGGTGCGG - Intergenic
1195572710 X:106414324-106414346 GATTCACTTTTGGCCAGGCCCGG - Intergenic
1195854861 X:109320141-109320163 GAAAAATTGTGGGCCAGGCGTGG + Intergenic
1196200609 X:112882001-112882023 AAATCACTCTAGGCCGGGCGCGG - Intergenic
1196212721 X:113013274-113013296 GAGCCATTTTGGGCCAGGTGCGG - Intergenic
1196779396 X:119369272-119369294 AAACCACTTTGGGCCGGGTGCGG + Intergenic
1197080371 X:122406180-122406202 AAATATCTTTAGGCCAGGCGCGG + Intergenic
1197289425 X:124637376-124637398 ATAGCACTTGGGGCCAGGCGCGG - Intronic
1197670397 X:129270811-129270833 TACACACATTGGGCCAGGCGTGG - Intergenic
1197732001 X:129818880-129818902 ACATCAATTTGGGCCAGGCGTGG + Intronic
1198236880 X:134743991-134744013 GATACATTTTGGGCCGGGCGCGG + Intronic
1198259403 X:134952407-134952429 AAATCTCTTTTGGCCAGGCTCGG + Intergenic
1198413663 X:136397077-136397099 GAATTATTTGGGGCCGGGCGGGG - Intronic
1198451679 X:136772646-136772668 GGATCACTTGAGGCCAGGAGAGG + Intronic
1199781136 X:151061114-151061136 GAATCACTTGAACCCAGGCGGGG - Intergenic
1199830578 X:151545557-151545579 GAACAAGTTTAGGCCAGGCGAGG - Intergenic
1199902782 X:152193706-152193728 TAATAACTTTAGGCCGGGCGTGG + Intronic
1200409950 Y:2851131-2851153 GAAACCCTCTGGGCCGGGCGCGG - Intronic
1200663982 Y:5998039-5998061 GGATCACTTGAGGCCAGGCCAGG + Intergenic
1200770932 Y:7124799-7124821 AATGCACTTTGGGCCAGGCATGG - Intergenic
1201225286 Y:11812719-11812741 AAATCACTATGGGCAGGGCGCGG + Intergenic
1201292681 Y:12437219-12437241 GAAAATATTTGGGCCAGGCGCGG + Intergenic
1201355169 Y:13089654-13089676 AGTTCACTTTGGGCCAGACGTGG + Intergenic
1201505319 Y:14693080-14693102 GGATCACTTGAGGCCAGGAGTGG - Intronic
1201543368 Y:15133356-15133378 AAATAATTTTCGGCCAGGCGCGG + Intergenic
1202376314 Y:24240799-24240821 GAATAGCATTGGGCCAGGCACGG - Intergenic
1202494466 Y:25429320-25429342 GAATAGCATTGGGCCAGGCACGG + Intergenic