ID: 964584626

View in Genome Browser
Species Human (GRCh38)
Location 3:158283535-158283557
Sequence AGTTATGTATTTTCACGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964584626_964584628 19 Left 964584626 3:158283535-158283557 CCATTTCGTGAAAATACATAACT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 964584628 3:158283577-158283599 TGATATCGTTTTCTGTTGTATGG 0: 1
1: 0
2: 0
3: 5
4: 169
964584626_964584627 -4 Left 964584626 3:158283535-158283557 CCATTTCGTGAAAATACATAACT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 964584627 3:158283554-158283576 AACTATGTCACAATTTTTAATGG 0: 1
1: 0
2: 1
3: 46
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964584626 Original CRISPR AGTTATGTATTTTCACGAAA TGG (reversed) Intronic
903730728 1:25493243-25493265 ATTTATTTATTTTCAAGACAGGG + Intronic
906339886 1:44970153-44970175 AGTTATGTTTTTTCACTTAAAGG - Intronic
906493719 1:46287899-46287921 AGTTATTTATTTTGACGGATAGG + Intronic
908480864 1:64537576-64537598 AGCTATACATTTTCAGGAAATGG - Intronic
909765618 1:79352576-79352598 AGTTGTGGAGTTTCAGGAAATGG + Intergenic
909852538 1:80486587-80486609 AGTTCTTTGTTTTCACCAAAGGG + Intergenic
910555267 1:88524704-88524726 AGATATTTATGTTCATGAAATGG + Intergenic
910862090 1:91751703-91751725 AGTTTTGTATTTTCAAGAAGCGG - Intronic
911768197 1:101704677-101704699 TGTTATGTTTTTTCATAAAAAGG - Intergenic
911810555 1:102272666-102272688 ATTTATTTATTTTTAAGAAATGG + Intergenic
913973340 1:143433696-143433718 AGTTAGGTAGCTTCATGAAAAGG - Intergenic
914067727 1:144259303-144259325 AGTTAGGTAGCTTCATGAAAAGG - Intergenic
914111428 1:144707051-144707073 AGTTAGGTAGCTTCATGAAAAGG + Intergenic
916338365 1:163698797-163698819 AGGTGTGTATCTTCACGAGATGG + Intergenic
919429356 1:197473661-197473683 GGGTATGTCTTTTCAGGAAAAGG + Intronic
920236330 1:204508730-204508752 TGTTTTGTATTTTCAAGAAAAGG + Intergenic
920317539 1:205088935-205088957 GGTTATGTATTTTCTTAAAAAGG - Intronic
921211397 1:212902566-212902588 ATTTTTGTATTTTTAGGAAATGG + Intergenic
921367677 1:214389081-214389103 AATTATGTATTGCCAAGAAAAGG - Intronic
923553647 1:234983955-234983977 AGTCATGTATTTTTCTGAAAGGG + Intergenic
923937085 1:238774675-238774697 AATAATGTATTTTCAGGAAAGGG - Intergenic
1063734385 10:8735771-8735793 AGTTATGTTTTTTCCAGTAACGG - Intergenic
1064558077 10:16567392-16567414 AGTTGTGAATTTTGATGAAAAGG - Intergenic
1065829438 10:29601029-29601051 AGTTATGTATATTAATGACAGGG - Intronic
1067200156 10:44162066-44162088 TGTTTTGTTTTATCACGAAAGGG + Intergenic
1068261383 10:54587267-54587289 AATTATTTATTTTTAAGAAATGG - Intronic
1071073160 10:81718942-81718964 AGTTATGTAATTTCTTGACATGG - Intergenic
1071133158 10:82419161-82419183 AATTAACTATTTTCACAAAATGG + Intronic
1071828874 10:89352433-89352455 AGTCATGAATATTCATGAAAGGG - Intronic
1074914294 10:117940590-117940612 AGATATTTCTTTTCACGAATGGG - Intergenic
1077449269 11:2626356-2626378 AGTGCTGTATTTTCAACAAATGG - Intronic
1079618036 11:22519116-22519138 ATTTATTTATTTTTTCGAAATGG - Intergenic
1080408662 11:32002623-32002645 GGTTATGTAATTTCATGAGATGG - Intronic
1080859759 11:36142991-36143013 TGTTATGTATATTAATGAAAAGG - Intronic
1081431196 11:42978368-42978390 AGCTGTGAATATTCACGAAAGGG - Intergenic
1084388545 11:68860293-68860315 AGTTTTGTATTTTTAAGAGATGG - Intergenic
1084877883 11:72147156-72147178 AGCTATGAATATTCATGAAAGGG - Intergenic
1084883439 11:72188403-72188425 AGCTATGAATGTTCATGAAAGGG - Intergenic
1085378515 11:76090349-76090371 AGTTATGAATATTCATGAAGGGG - Intronic
1086431733 11:86742829-86742851 AGATGTGGATTTTCAAGAAAAGG - Intergenic
1087321436 11:96664559-96664581 AGCTTTGTAATTTCACCAAAAGG - Intergenic
1087345844 11:96969876-96969898 AGTTATCAGTTTTCACCAAATGG + Intergenic
1087662954 11:101009123-101009145 AGTCATGTATACTCACCAAAAGG - Intergenic
1088071906 11:105797200-105797222 ATTTATTTATTTTCAAGACAGGG - Intronic
1088513605 11:110602673-110602695 AATTATCTATTCTCACTAAAAGG - Intronic
1088600950 11:111474633-111474655 AGTTATGTATCATCACCAGAAGG - Intronic
1089891089 11:121881708-121881730 GCTTAAGTATTTTCAAGAAAGGG + Intergenic
1091012457 11:132016100-132016122 AGTTTTTTTTTTTCACGCAAGGG + Intronic
1094028852 12:25987854-25987876 ATTTATTTATTTTTTCGAAATGG + Intronic
1094485158 12:30919867-30919889 CGTTAAGTATTTTCAGCAAAAGG + Intergenic
1094739222 12:33269571-33269593 TGGTATGTATTTTTAAGAAAAGG - Intergenic
1096932970 12:55236399-55236421 GGTTATGTATTATGACAAAATGG + Intergenic
1098547635 12:71729103-71729125 AGTTATGTTTGTTCTAGAAAAGG + Intergenic
1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG + Intronic
1099962076 12:89406590-89406612 ACTTATTTATTTTGAGGAAATGG - Intergenic
1102443981 12:112987177-112987199 AGTTCTGTCTGTTCACGAAGTGG + Exonic
1102743112 12:115225360-115225382 ATTTATGTATTTTCAAAATAAGG - Intergenic
1102980844 12:117239845-117239867 AGTTATGAATTAGCACAAAAAGG - Intronic
1105379074 13:19870160-19870182 ATTTATTTATTTTCAAGACAGGG + Intergenic
1107150189 13:37102066-37102088 AATTATGTTTTTCCACTAAAAGG - Intergenic
1107653446 13:42568201-42568223 AGCTATGAATATTCATGAAAGGG - Intronic
1108857635 13:54814597-54814619 GGTCATGTATATTCAAGAAATGG + Intergenic
1109444646 13:62418871-62418893 AGTTTTCCATTTTCACCAAAGGG + Intergenic
1109494832 13:63156326-63156348 ATTTATTAATTTTCACAAAAGGG - Intergenic
1109529283 13:63620053-63620075 ACATATGTATTTTCTCCAAATGG + Intergenic
1109830839 13:67785869-67785891 AATTATGTATTTTTACACAAAGG - Intergenic
1110173211 13:72526884-72526906 TGTTATCTATTTTCAGGCAATGG + Intergenic
1110280695 13:73690503-73690525 AGTAATGTCTTTTCCTGAAAAGG - Exonic
1111185130 13:84724695-84724717 AGTTCTGCATTTTCAATAAAGGG + Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1111990562 13:95112496-95112518 AGTTAGGTATCTTCATAAAAAGG - Intronic
1114129532 14:19774207-19774229 AAATATGTATTTTAACAAAAAGG + Intronic
1116305603 14:43251016-43251038 AGTCATGTATTCTCACAGAATGG + Intergenic
1117625963 14:57638435-57638457 AGCTATGAATATTCACGAAGGGG - Intronic
1117680358 14:58197540-58197562 AGTTATGTATCTACAAGCAAAGG + Intronic
1119464166 14:74841145-74841167 AGATCAGTATTTTCAGGAAAAGG - Intronic
1120232268 14:81852817-81852839 AGTTATTTATTTTGCCAAAATGG + Intergenic
1120315325 14:82885550-82885572 AATTTCGTATTTTCAGGAAAGGG - Intergenic
1120381458 14:83785472-83785494 TTTTATTTATTTTCATGAAAAGG + Intergenic
1121016128 14:90550406-90550428 AGCTATGAATATTCACAAAAGGG - Intronic
1121610506 14:95275541-95275563 ATTTATGAGTTTTCAGGAAAGGG - Intronic
1122759166 14:104008470-104008492 AGTTAAGTTTTTTGACCAAATGG + Intronic
1123572817 15:21631967-21631989 AAATATGTATTTTAACAAAAAGG + Intergenic
1123609438 15:22074554-22074576 AAATATGTATTTTAACAAAAAGG + Intergenic
1123790280 15:23712563-23712585 AGTTATGTCTTTTCCAGAAATGG + Intergenic
1125372322 15:38991675-38991697 AGTCATGTATTTTCACCCACAGG - Intergenic
1125979667 15:43989012-43989034 AGTTAGGTTTTGTCAAGAAAGGG + Intronic
1127416931 15:58767284-58767306 AGTTATTTAAGTTCATGAAAAGG - Intergenic
1127753097 15:62065246-62065268 AGTTATTTATTTTTAAGACAGGG - Intergenic
1129579236 15:76788578-76788600 AGTTTTGTATTTTCAAAAACAGG - Intronic
1202981678 15_KI270727v1_random:366339-366361 AAATATGTATTTTAACAAAAAGG + Intergenic
1135650074 16:24198266-24198288 ATTCATGTATTGTCACGAATTGG + Intronic
1137781742 16:51103312-51103334 AGTTTTGTATTTACCCCAAATGG - Intergenic
1140353397 16:74283878-74283900 AGCTATGAATATTCACGAAGGGG - Intergenic
1140825493 16:78702122-78702144 ATTTATTTATTTTCAAGACATGG + Intronic
1141178497 16:81736578-81736600 ATTTATTTATTTTCAAGACAGGG + Intergenic
1142989592 17:3721446-3721468 ATTTATTTATTTTTAAGAAATGG + Intronic
1143793283 17:9315559-9315581 AGTTATGAATATTTATGAAAAGG - Intronic
1144691616 17:17269589-17269611 AGTTATTTATTTTTTTGAAATGG - Intronic
1150975578 17:70082572-70082594 AGGTAGGTATTTCCAAGAAATGG + Intronic
1151948725 17:77334869-77334891 AGGTATGTCTTTTCAACAAACGG - Intronic
1153022853 18:647056-647078 ATTGATGTATTTTTAAGAAAGGG - Intronic
1153043319 18:834074-834096 AGCTATGAATGTTCATGAAAGGG + Intergenic
1155777832 18:29790818-29790840 ATTTATTTATTTTTAAGAAAGGG + Intergenic
1155809386 18:30212391-30212413 AATTATGCATTTTCAAGAAAAGG - Intergenic
1155936615 18:31761301-31761323 AGTACTGTATTTTCTTGAAAGGG + Intergenic
1156282850 18:35657903-35657925 ATTTATGTATGTTCAGGAAGAGG + Intronic
1156703204 18:39849199-39849221 ATGTATGTATTTTCAAGATAGGG + Intergenic
1156934755 18:42690171-42690193 AGCAATGTTTTCTCACGAAAAGG - Intergenic
1159580345 18:70228773-70228795 ATTTATGCATTTTCATTAAAAGG + Intergenic
1163141545 19:15352495-15352517 AATTATGTAGTTTCACCAAGAGG + Intergenic
1165796356 19:38522265-38522287 ATTTATGTATTTCGATGAAAAGG + Intronic
1166088655 19:40493714-40493736 TGTTATTTATTTTCAAGACAGGG - Intronic
1167404633 19:49297090-49297112 AATTATGTCTTTTCATCAAAAGG + Intronic
925060630 2:887221-887243 AGTCATTTATTTTCAGGAAAAGG - Intergenic
925524515 2:4785249-4785271 AGTTATGTATTGTAACAAAATGG + Intergenic
927832706 2:26366875-26366897 AATTATTTATTTTCAAGTAAAGG + Intronic
930623964 2:53675694-53675716 AGTTTTGCATTTTTACTAAATGG + Intronic
932056824 2:68454147-68454169 AGCTATGAATATTCACAAAAGGG - Intergenic
933681020 2:85100935-85100957 AAGTATGTTTTGTCACGAAAGGG - Intergenic
934025095 2:87995955-87995977 AGCTATGAATATTCATGAAAAGG + Intergenic
934178034 2:89594663-89594685 AGTTAGGTAGCTTCATGAAAAGG - Intergenic
934288333 2:91668954-91668976 AGTTAGGTAGCTTCATGAAAAGG - Intergenic
935288805 2:101591309-101591331 AGTTTTGTATTTTTAGGAGATGG - Intergenic
941690714 2:168498520-168498542 AGCTATGAATATTCACGAGAGGG + Intronic
943021437 2:182579020-182579042 AGTTATCTATTCACACAAAAGGG + Intergenic
943711718 2:191104095-191104117 AGATATATTTTTTCACAAAACGG - Intronic
944366198 2:198922835-198922857 AGCTATGAATATTCACGAAGAGG + Intergenic
945622905 2:212164583-212164605 ATTTATTTATTTTCCCAAAATGG - Intronic
948539064 2:238673501-238673523 TGGTATGTATTTTCATGAAGAGG + Intergenic
1169148626 20:3271425-3271447 ACTTCTGTATTTTCACCAAAAGG - Intronic
1170269539 20:14508979-14509001 ATTTATGTATTTGCACTCAATGG + Intronic
1171216931 20:23359107-23359129 AGCTATGAATATTCATGAAACGG + Intergenic
1174438945 20:50533351-50533373 AGTTATGTACTGCCATGAAAAGG - Intronic
1174521508 20:51134404-51134426 AGCTATGAATATTCATGAAAGGG + Intergenic
1178136999 21:29638758-29638780 AGTTTTCCATTTTCAAGAAAAGG - Intronic
1178345748 21:31826550-31826572 AGCTATGAATATTCATGAAAGGG + Intergenic
1185026375 22:48415888-48415910 ATTTATGTTTTTACACGAAGTGG + Intergenic
951050978 3:18093085-18093107 TGTTCTGTATTTTAACTAAATGG + Intronic
951059523 3:18188799-18188821 TAATATATATTTTCACGAAATGG - Intronic
952009237 3:28880936-28880958 AGTTATGAATATTCAGCAAATGG + Intergenic
952230543 3:31425056-31425078 ACTTAGGTATTTTCAAGAAAAGG - Intergenic
952483401 3:33785545-33785567 ATTTATGTATTTTTATGAGATGG + Intergenic
955441839 3:58964412-58964434 AGCTATGAATATTCATGAAAAGG - Intronic
955813423 3:62816511-62816533 AGTAATGTGTTTTCTCTAAATGG - Intronic
956490109 3:69762163-69762185 AGTTAAATATTTTCAATAAAAGG + Intronic
956547248 3:70418390-70418412 ACTTATGTATTATCTCGGAATGG + Intergenic
957357644 3:79112991-79113013 AGTCATGTTTTATCACCAAATGG + Intronic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
957743523 3:84305804-84305826 AGTTATTTATTTTATCTAAATGG + Intergenic
959185452 3:103041123-103041145 GGTTATGAATTTTGAAGAAATGG - Intergenic
960112052 3:113854747-113854769 AGTTATGTTTTTCCCCAAAAAGG - Intronic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
962826884 3:139106868-139106890 AGAGATGTATTTTCAAGTAATGG - Intronic
964347093 3:155764849-155764871 ATTTATTTATTTTCCCGAGATGG - Intronic
964583549 3:158268947-158268969 AATTATGTATTTTCAATGAAAGG - Intronic
964584626 3:158283535-158283557 AGTTATGTATTTTCACGAAATGG - Intronic
964617606 3:158685376-158685398 ACTAATGTATTTTCACATAAAGG - Intronic
966252788 3:177885488-177885510 AGTTATGTATTTGAAGGAAATGG - Intergenic
966995510 3:185276212-185276234 AAATATGTATTCTCACAAAAGGG - Intronic
967251857 3:187547913-187547935 AGTCATGTATTTTCAACAAAAGG + Intergenic
967673862 3:192272393-192272415 AGTTTTTTATCTTCATGAAATGG - Intronic
968840386 4:3000274-3000296 AGTTATTTATTCTCACACAAAGG - Intronic
969466377 4:7359436-7359458 AGTAATTTATTTTCAGGAAAAGG + Intronic
970056675 4:11981350-11981372 AGTTATGGTTTTCCAAGAAAGGG - Intergenic
971036912 4:22703735-22703757 AGTCATGTATATTCAAGCAAAGG - Intergenic
971581674 4:28349144-28349166 AGTTATGAATATTCATGAATGGG - Intergenic
977535005 4:98247382-98247404 ATTTTTGTATTTTTAAGAAATGG - Intergenic
978237758 4:106480432-106480454 ATTTATGTATTTTCAAGATAAGG + Intergenic
978451835 4:108842637-108842659 AGATAAGGATTTTCAGGAAATGG + Intronic
979309660 4:119187781-119187803 AATTATGCATTTTGATGAAATGG + Exonic
980656097 4:135788584-135788606 AGATATGTATCTTCAAGTAAAGG + Intergenic
983309385 4:166038291-166038313 CCTTTTGTATTTTCACAAAAGGG + Intronic
983566446 4:169157907-169157929 ATTTTTGTATTTTTACAAAATGG + Intronic
983779046 4:171644970-171644992 AGTTTTGTTTTTTCACCTAAGGG - Intergenic
983982832 4:174019980-174020002 AGTCATGCATTTTCACTGAAGGG - Intergenic
984305173 4:177980012-177980034 TGTTATGTATCTTTACAAAAAGG - Intronic
984994416 4:185415072-185415094 AATTATATATTTCCACTAAATGG - Intronic
986513711 5:8538419-8538441 ATATATATATTTTCACCAAATGG + Intergenic
988387299 5:30581547-30581569 ATTTCTTTATTTTCACGAACAGG + Intergenic
989327908 5:40221680-40221702 AGTTATTTGTCTTCACCAAAAGG - Intergenic
990452864 5:55952890-55952912 ATTTTTGTATTTTCAGTAAAGGG - Intronic
990542816 5:56791356-56791378 AGGTATGTATGTATACGAAAAGG - Intergenic
992543401 5:77786035-77786057 AGTTAGGTTTTGTCAAGAAAAGG - Intronic
993049147 5:82905951-82905973 AGTTATGTTTTTTCTCTTAATGG - Intergenic
994088832 5:95790500-95790522 AGTTATGAATTTTCATTATATGG + Intronic
994219195 5:97175049-97175071 ATTTATTTATTTTCAAGACAAGG - Intronic
994316579 5:98339859-98339881 AGTTAGGTTTTGTCAAGAAAGGG - Intergenic
994523392 5:100871958-100871980 AGTTCTGTATTTTCTTGTAAAGG + Intronic
995482520 5:112607442-112607464 AGCTATGAATATTCACGAAGGGG + Intergenic
995615825 5:113962192-113962214 ATTTATGTGTTTTCAAAAAAAGG + Intergenic
995899832 5:117052618-117052640 TGTTATGTATTTTGGGGAAATGG + Intergenic
996869795 5:128177317-128177339 AGTTAAATATTCTCAGGAAATGG + Intronic
997165738 5:131658997-131659019 AGTTAGGTTTTGTCAAGAAAGGG + Intronic
998431128 5:142071081-142071103 ATTTATTTATTTTTAAGAAATGG + Intergenic
998581337 5:143379264-143379286 CTTTATGTATTTTAAAGAAAGGG - Intronic
1000107440 5:158073602-158073624 AGTTAACTATTTTTAAGAAATGG - Intergenic
1001916229 5:175563128-175563150 AGTTATCTAATTCCATGAAAGGG + Intergenic
1002864827 6:1111849-1111871 CGTTATGTAATTTCCAGAAAAGG - Intergenic
1010854196 6:80816609-80816631 ACTTTTCTATTTTCACCAAATGG + Intergenic
1011526916 6:88275833-88275855 AGTTAGGTTTTGTCAAGAAAGGG + Intergenic
1012288993 6:97427537-97427559 GGTGATTTATTTTCAAGAAATGG + Intergenic
1013446167 6:110229952-110229974 AGTTATGTGATTTCAGGAGATGG + Exonic
1013592575 6:111631848-111631870 ATTGATGTATGTGCACGAAAGGG + Intergenic
1013905193 6:115208295-115208317 AGTTATCTATTTTTATGAATAGG - Intergenic
1014831448 6:126107209-126107231 ATTTATGTTTTTTCACAAGATGG + Intergenic
1014962159 6:127700157-127700179 AGTTAATTATTTTCATGTAATGG + Intergenic
1015163933 6:130182499-130182521 TTTTTTGTATTTTCAAGAAAAGG - Intronic
1020124829 7:5527699-5527721 AGTTAGGTTTTGTCAAGAAAGGG + Exonic
1020384417 7:7582270-7582292 AATTATGTTTTTTAACAAAAAGG - Intronic
1023706623 7:42947936-42947958 AATTATTTATTTTCACCACAGGG - Intronic
1023748394 7:43345162-43345184 AGTTATGAATATTCACAAAGGGG + Intronic
1026221594 7:68402769-68402791 AGTCATGTATTTTCTGGGAATGG - Intergenic
1026323037 7:69284060-69284082 AGGTATATATTTTCACGACTTGG + Intergenic
1029912411 7:104167842-104167864 AGTTGTGTGTTTTTAGGAAAAGG - Intronic
1030375506 7:108748773-108748795 AGTTATGTCTTTTTGCTAAATGG + Intergenic
1032251146 7:130258650-130258672 AGTTATTTATTTTGTCAAAATGG - Intergenic
1034606544 7:152321224-152321246 ATTTATTTATTTTCTTGAAAGGG - Intronic
1036064176 8:5359194-5359216 AGTTAGGTACTTTCTCTAAATGG - Intergenic
1037036248 8:14171074-14171096 AGTAAAATATTTTCAAGAAATGG - Intronic
1037100893 8:15044438-15044460 AGTGAAATATTTTCACCAAAAGG - Intronic
1037190432 8:16118364-16118386 AATTATGTATTTTAAATAAATGG + Intronic
1038613331 8:29072512-29072534 ATTTATTTATTTTGTCGAAACGG - Intronic
1038815575 8:30899966-30899988 TGCTATGCATTTTCAAGAAAAGG + Intergenic
1041496452 8:58490800-58490822 AGTTATGTCTTTTAATAAAAAGG - Exonic
1041975319 8:63793169-63793191 ATTTACTTATTTTCACGCAAAGG + Intergenic
1043827790 8:84949711-84949733 AGTTAGGTTTTATCAAGAAACGG - Intergenic
1045099734 8:98832235-98832257 ATTTTTTTTTTTTCACGAAAAGG - Intronic
1045958499 8:107938474-107938496 ATTTATTTATTTTCACTAAGTGG - Intronic
1050250388 9:3737517-3737539 AGTAATATATTTTCAGCAAAAGG + Intergenic
1054108044 9:61074818-61074840 ACTTATGTATTTTCAGAATAAGG + Intergenic
1054612813 9:67256307-67256329 ACTTATGTATTTTCAGAATAAGG - Intergenic
1054760018 9:68996108-68996130 ACTTATGTATTTTTACACAAAGG - Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055228337 9:74028877-74028899 AGTTATGCATTTTCTAGAACAGG - Intergenic
1056687532 9:88778725-88778747 ATACATGTATTTTCACAAAAAGG + Intergenic
1056986457 9:91367804-91367826 AGGTTTGTATTTTCAGGACATGG - Intergenic
1057703435 9:97380605-97380627 AGATCAGTATTTTCAAGAAATGG - Intergenic
1057765536 9:97914538-97914560 ACTTATGTATTTTTATGAACAGG - Intronic
1058084339 9:100732378-100732400 AGTTAGGTTTTATCAAGAAAGGG - Intergenic
1058524315 9:105841604-105841626 AACTATGTATTTTCATGCAATGG + Intergenic
1185673990 X:1833728-1833750 AGTTATGCATTGTCACGTATGGG + Intergenic
1186064956 X:5753190-5753212 ATTTAAGTATTTTCAGGCAATGG - Intergenic
1187509480 X:19904627-19904649 AGTTACTTCTTTACACGAAATGG - Intergenic
1187791589 X:22956138-22956160 AGCTATGAATATTCACGAAGGGG - Intergenic
1188376474 X:29435968-29435990 AGTTATGTTTTTTCCCCTAATGG - Intronic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1188969942 X:36602708-36602730 ATTTATGTAATTTAATGAAATGG + Intergenic
1189812540 X:44794008-44794030 AGTTAGGTTTTGTCAAGAAAGGG - Intergenic
1189849631 X:45165674-45165696 AGCTATGTATTGTCACACAATGG - Intronic
1189943622 X:46154049-46154071 AGAGATGTATTTTAAGGAAAGGG + Intergenic
1190424533 X:50321023-50321045 ATTTATGTATATTCACTACAGGG - Intronic
1194878828 X:99224713-99224735 AGATATGTATTTCCCCAAAAAGG + Intergenic
1194887153 X:99330720-99330742 ATTTATGTCTTTTCTAGAAATGG + Intergenic
1195312538 X:103645557-103645579 TGTTATGTTTTTTCAAGACAAGG - Intergenic
1196075127 X:111568018-111568040 AGCTATGAATATTCATGAAAAGG - Intergenic
1196911656 X:120489995-120490017 AGTTATGTTATTTCTGGAAAGGG - Intergenic
1198458573 X:136841565-136841587 AGTTTTGTATTTCCTCAAAATGG + Intergenic
1199152150 X:144499521-144499543 AGCTATGTATATTCACAAAGAGG + Intergenic
1199775692 X:151009455-151009477 TGTTATGCATTTTATCGAAAAGG + Intergenic
1200767809 Y:7095253-7095275 AGTTCTGTATTTTCTCCAGAAGG + Intergenic