ID: 964585679

View in Genome Browser
Species Human (GRCh38)
Location 3:158297633-158297655
Sequence TGTGAGTTATAGAATCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964585676_964585679 -8 Left 964585676 3:158297618-158297640 CCAAATATAATAAGATGTGAGTT 0: 1
1: 0
2: 2
3: 17
4: 245
Right 964585679 3:158297633-158297655 TGTGAGTTATAGAATCTGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 210
964585675_964585679 18 Left 964585675 3:158297592-158297614 CCATTGGTGGATGGATATTTGAG 0: 1
1: 0
2: 0
3: 24
4: 189
Right 964585679 3:158297633-158297655 TGTGAGTTATAGAATCTGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964585679 Original CRISPR TGTGAGTTATAGAATCTGGG TGG Intronic
900695459 1:4006746-4006768 TCTGAGCTCTAGAATCTAGGAGG + Intergenic
901158730 1:7158681-7158703 TGTTAATTATAGAATCCAGGTGG + Intronic
903314019 1:22486601-22486623 TGAGAGTTAAAAACTCTGGGGGG - Intronic
904543824 1:31252777-31252799 TTTGAATTATTGAATCTAGGTGG + Intergenic
906710045 1:47922662-47922684 TGTGTGTGATCGGATCTGGGAGG - Intronic
909141105 1:71866656-71866678 TGGTAGTTATAGATTCTGAGAGG + Intronic
910835741 1:91507684-91507706 TGTGAGTTATAGCAACTTGATGG + Intronic
911277806 1:95883402-95883424 TGTTAATTATAGAATCTAGGTGG - Intergenic
911521025 1:98930969-98930991 TGTGAATGGTAGAATCTGGTAGG - Intronic
914424952 1:147566986-147567008 TGTGGGAAATAGAGTCTGGGTGG + Intronic
916548030 1:165825276-165825298 TGTTAGTGATAGAGTCTAGGTGG + Intronic
916735025 1:167599792-167599814 TGTGATTTAAAGTATTTGGGAGG - Intergenic
918188439 1:182148355-182148377 TGTGAGTAACAGCATGTGGGGGG + Intergenic
918573032 1:186021328-186021350 TTTGAGTTTTAGATTTTGGGGGG + Intronic
918645415 1:186898713-186898735 TGGTAGTTATAGAATCTAGGTGG - Intronic
920802329 1:209201029-209201051 AGTGATTTAAAGAATATGGGAGG - Intergenic
923607486 1:235457657-235457679 TAAGAGTTTTAGAATCAGGGAGG + Intronic
924636909 1:245797114-245797136 TGTGAGATACAGAATATGAGGGG + Intronic
924764849 1:247022870-247022892 TGTGCTTTACAGAATCTGTGAGG - Intergenic
1062819246 10:521939-521961 TGTGAGCTATGGACTCTGGGTGG - Intronic
1063828512 10:9925649-9925671 TGTGAGTCTTCGAATCAGGGAGG - Intergenic
1065416560 10:25494416-25494438 TCTGAGTGATGGAATATGGGAGG - Intronic
1068789660 10:61013681-61013703 TATGAGTTAGAGAAAGTGGGAGG + Intergenic
1069166206 10:65163647-65163669 TGTTAGCTTTAGAATCTGGAGGG - Intergenic
1069745435 10:70712123-70712145 TGTGATTTGCAGAGTCTGGGTGG - Intronic
1069880109 10:71587197-71587219 TGTGAGTTTTAGAAGCAGGAAGG - Intronic
1070556819 10:77534317-77534339 TGTTTGTTATAGTAACTGGGAGG + Intronic
1071810589 10:89176779-89176801 TATGAGTTATAGGTTCTGGTGGG - Intergenic
1071982525 10:91018255-91018277 CTAGAGTTATAGAAGCTGGGTGG + Intergenic
1072203037 10:93178042-93178064 TCTGGGTTATAGATTATGGGAGG + Intergenic
1073122749 10:101132248-101132270 TCTGCGTTATAGAATCGGGCGGG - Intronic
1074842576 10:117369990-117370012 TCTGAGTAATAGTGTCTGGGTGG - Intronic
1074929974 10:118114756-118114778 TGTGAAGTACAAAATCTGGGTGG + Intergenic
1076685622 10:132197275-132197297 AGTGAGTTAGAGAGACTGGGGGG + Intronic
1080385085 11:31806110-31806132 TGTGAGTTACAGGATTTGGGGGG + Intronic
1081286648 11:41278725-41278747 TGTTGGTAAGAGAATCTGGGTGG - Intronic
1085418678 11:76337192-76337214 AGTGAGCTGCAGAATCTGGGTGG - Intergenic
1087442702 11:98207215-98207237 TGTCAGGCATAGGATCTGGGCGG - Intergenic
1087857284 11:103107618-103107640 TGTAAGTTATTTAATCTGTGAGG + Intergenic
1088815576 11:113418649-113418671 TGTGAATTAGAGAAACGGGGTGG - Intronic
1089098840 11:115942846-115942868 TGTAAGTTACAGCATCTCGGGGG + Intergenic
1089448669 11:118574474-118574496 TGTTAGTTATAGAATCTAGTTGG - Intronic
1089916170 11:122159145-122159167 CCTGGGTTATAAAATCTGGGAGG - Intergenic
1090637400 11:128698669-128698691 TATGAATTATAGAATCGTGGAGG + Intronic
1092959682 12:13584172-13584194 GGTGAGTTTTAGAAACTGCGAGG - Intronic
1093743801 12:22717126-22717148 TGTGAATTATAGAATCTAGGTGG - Intergenic
1096361331 12:50990278-50990300 TGTGATTTAGAGATTCGGGGTGG - Intronic
1096906526 12:54941840-54941862 TGTGAGTGACAGAAGCTGGGTGG - Intergenic
1097711572 12:62923310-62923332 TGTGAATTACAGAATCTAGATGG + Intronic
1102257857 12:111426522-111426544 AGTGAGTCATAGAAACTAGGCGG - Intronic
1102330925 12:112029699-112029721 TCTGAGAACTAGAATCTGGGGGG - Intronic
1105551323 13:21398601-21398623 ACTGAGGTATAGAATCAGGGTGG - Intronic
1106147772 13:27065880-27065902 TGAGAGTCATAGAATCTTAGAGG - Intergenic
1108063777 13:46556777-46556799 GTTGAGAGATAGAATCTGGGAGG + Intronic
1109160123 13:58962024-58962046 TTTGAGGTAAAGAATCTGTGTGG - Intergenic
1109878857 13:68444429-68444451 TGAGAGTTATATAATCTATGAGG + Intergenic
1110031592 13:70621475-70621497 TTTGAGTTTTAGATTCAGGGTGG + Intergenic
1111253400 13:85635518-85635540 TGTGAGTTAAAAATTCTGAGGGG - Intergenic
1112257685 13:97849912-97849934 TCCGTGTTCTAGAATCTGGGTGG + Intergenic
1112931749 13:104748660-104748682 TGTAAGCTTTAGAAACTGGGCGG - Intergenic
1114179512 14:20353822-20353844 TCTGAGTTGTAAAATGTGGGAGG + Intronic
1114555260 14:23558547-23558569 AGTGTGTTACAGAAGCTGGGTGG + Intronic
1115450174 14:33538873-33538895 TGTAAATTATAGAATGTTGGGGG - Intronic
1115816030 14:37165550-37165572 TATGAGTAAAAGATTCTGGGAGG + Intronic
1116921988 14:50588486-50588508 TGTTAATGGTAGAATCTGGGTGG - Intronic
1117053423 14:51885575-51885597 TGTGTGTTATAGAATACGGCAGG - Intronic
1117836446 14:59811689-59811711 TATAAGTTATACAATGTGGGAGG + Intronic
1118593041 14:67415174-67415196 TCTGAGTGATAGATTCAGGGTGG - Intergenic
1119663509 14:76467684-76467706 TGTGGGTTCTAGAATCAGGATGG + Intronic
1120952967 14:90060009-90060031 TGTTAATTGTAGAATCTAGGTGG + Intergenic
1124560948 15:30772675-30772697 TGTTAATTGTAGAATCTAGGTGG - Intronic
1124669584 15:31626376-31626398 TGTTAATTGTAGAATCTAGGTGG + Intronic
1127440881 15:59006571-59006593 TGTTAATCATAGAATCTAGGTGG - Intronic
1129965203 15:79728904-79728926 TGTGAGTTTTTGCATCTGGAAGG + Intergenic
1131155846 15:90074913-90074935 TGTGGGTTATAGTCTCTGGCAGG - Intronic
1131741587 15:95398728-95398750 TGAGTGGTATAGAATCTAGGTGG + Intergenic
1134863776 16:17586010-17586032 TATGAGTGATAGGATTTGGGGGG + Intergenic
1135662012 16:24305092-24305114 TGTAAGTGATGGATTCTGGGTGG + Intronic
1136489331 16:30595969-30595991 TGTTAGTGATAGAATCTAGGTGG + Intergenic
1137515852 16:49143491-49143513 TGTGAGATATAGAATAAGGGTGG + Intergenic
1138446179 16:57065587-57065609 TGTGTGTTACTGCATCTGGGGGG - Intronic
1138466347 16:57194321-57194343 TGTTAGTAGTAGAATCTAGGTGG + Intronic
1138630204 16:58287862-58287884 TGTGAGTTATTGCACCTGGCTGG + Intronic
1139065530 16:63308756-63308778 TGTGAGTTTTGGTATCTGTGGGG + Intergenic
1139879352 16:70171494-70171516 TGTGAATCCTACAATCTGGGTGG + Intergenic
1140400765 16:74669528-74669550 TGTTAGTTGTAGAATTTAGGTGG + Intergenic
1140658871 16:77167950-77167972 TGTGTGTTGTATAATCTTGGAGG + Intergenic
1140854153 16:78963079-78963101 TGTTAATTGTAGAATCTAGGTGG - Intronic
1141906624 16:87030975-87030997 TCTGACTTAATGAATCTGGGGGG + Intergenic
1141921047 16:87135699-87135721 TGCCTGTTAGAGAATCTGGGAGG - Intronic
1147598506 17:41732104-41732126 TCTGAGGTATAAAATCTGGCAGG + Exonic
1150302876 17:64060710-64060732 TGTGAGTTAGAGAAAATGAGTGG + Intronic
1151519526 17:74618146-74618168 AGTGGGGTTTAGAATCTGGGAGG + Intronic
1153518763 18:5931998-5932020 TGTGAGTTGTAAAATCAGAGAGG + Intergenic
1155332512 18:24732283-24732305 TGTGTGTAATAGAGTCTGGCTGG - Intergenic
1159760294 18:72417321-72417343 TGTGAGTTACTGAAATTGGGTGG + Intergenic
1168446926 19:56426894-56426916 TGTGTATAATAGAATCTGGAGGG - Exonic
927374095 2:22393132-22393154 TATGAGATCTAGAATCAGGGAGG - Intergenic
927700073 2:25262466-25262488 TCTGAGGTAGAGAATCTTGGAGG - Intronic
930118049 2:47736759-47736781 TGTGAGTTATACAATTTGGCTGG + Intronic
931325430 2:61217038-61217060 TGTTAATTGTAGAATCTCGGTGG - Intronic
933649923 2:84842303-84842325 TGTGAGGAATAGAAGCTAGGAGG + Intronic
935749277 2:106216092-106216114 AGTGAATTATTGAATCTGAGGGG + Intergenic
935938645 2:108215164-108215186 GGTGAGTCATAGAATGAGGGAGG - Intergenic
936122027 2:109755267-109755289 AGTGAATTATTGAATCTGAGGGG - Intergenic
936222667 2:110616207-110616229 AGTGAATTATTGAATCTGAGGGG + Intergenic
938588744 2:132716921-132716943 TGTGATTTTTAGAAGCTGGCTGG + Intronic
938774410 2:134529048-134529070 TGTGAGCCATAGCATCTGGCCGG - Intronic
938791668 2:134681599-134681621 TGTGACTTATAGAAGCTGAGTGG - Intronic
940886920 2:158998300-158998322 TCTTAATTATAGAATCTAGGTGG - Intronic
943929018 2:193825797-193825819 TGTAAACTATAGAGTCTGGGTGG + Intergenic
945546685 2:211162786-211162808 TATTGATTATAGAATCTGGGTGG - Intergenic
946407512 2:219499585-219499607 TGTGAATTTCAGAATTTGGGAGG + Intronic
948001650 2:234572686-234572708 TCTGAGATAAAGAATCTGGATGG + Intergenic
948382331 2:237559464-237559486 TGTGGGTCATAGGATCTTGGTGG - Intergenic
1170269717 20:14511949-14511971 TTTGAGGTATAAAATCTGGAGGG + Intronic
1170411633 20:16098251-16098273 TGTTAATGATAGAATCTGGGTGG - Intergenic
1172278292 20:33693169-33693191 TGTGGCTAATAGAATGTGGGAGG - Intergenic
1172355044 20:34273946-34273968 TACGAGTTGTAGAGTCTGGGAGG + Intergenic
1172431282 20:34894192-34894214 AGTGAGTTAGAGAATCTGCCAGG + Intronic
1172830128 20:37826689-37826711 TGTTAATTGTAGAATCTGGGTGG - Intronic
1175119319 20:56706187-56706209 TGTGTGTTATAGGAGCAGGGAGG + Intergenic
1177171291 21:17658998-17659020 TGTGTGTTACAAATTCTGGGTGG - Intergenic
1181999514 22:26908860-26908882 TGTGAGTTGTACAAGATGGGAGG - Intergenic
1183322066 22:37170957-37170979 CGTGAGTCCTAGAATTTGGGAGG - Intronic
951207315 3:19938492-19938514 TGCTAATTGTAGAATCTGGGTGG + Intronic
952284457 3:31954937-31954959 TGTCAGTTGTAGAATCCAGGTGG + Intronic
952699264 3:36308503-36308525 TGTTAATGATAGAATCTAGGTGG - Intergenic
953626149 3:44573345-44573367 TGCGAGTTATATAATCTGGAGGG + Intronic
955018375 3:55093930-55093952 TGTGTTTGACAGAATCTGGGGGG - Intergenic
955296539 3:57740460-57740482 TGTTAATAATAGAATCTAGGTGG - Intergenic
956585384 3:70859086-70859108 TTTGAGTTACAGAATGTGGTAGG + Intergenic
959202805 3:103270755-103270777 TGTGAGGTATTGAATCATGGGGG - Intergenic
961317998 3:126053718-126053740 TCTGAGTCATAGACACTGGGAGG - Intronic
962627661 3:137242669-137242691 TGTTAGTTGTAGAATCTGCATGG + Intergenic
963074795 3:141335732-141335754 TGTGATTGATAGAAACTGGTGGG - Intronic
963173865 3:142278784-142278806 TGTAAGTGGTAGAATCTAGGTGG + Intergenic
963822450 3:149912623-149912645 TGTTAATTATAGAATCCAGGTGG + Intronic
963846565 3:150164626-150164648 TGTTAATTGTAGAATCTAGGTGG + Intergenic
964585679 3:158297633-158297655 TGTGAGTTATAGAATCTGGGTGG + Intronic
964855045 3:161137779-161137801 TGTGAGTTATCCAATCTTAGTGG - Intronic
966048197 3:175578982-175579004 TGTCACTTATAGTATCTGTGTGG + Intronic
966239123 3:177736157-177736179 TGTCAGTTATATAATCTGGTTGG + Intergenic
966665742 3:182469153-182469175 TGTTAATTATAAAATCTAGGTGG - Intergenic
967348056 3:188480704-188480726 TGTAGGTCAGAGAATCTGGGAGG + Intronic
967348062 3:188480743-188480765 TGTAGGTCACAGAATCTGGGAGG + Intronic
967645010 3:191912089-191912111 TTTGATTTATTGAATCTAGGTGG - Intergenic
970349799 4:15190909-15190931 TGATAATTATAGAATCTAGGTGG + Intergenic
972249974 4:37289460-37289482 TGTTAATTGTAGAATCTTGGGGG - Intronic
974065701 4:57074908-57074930 TATGAGTTATTAAATCTGGTTGG + Intronic
975413395 4:74080941-74080963 TGTGAGGTATAATTTCTGGGGGG + Intergenic
975694391 4:76997435-76997457 TGTCAGTTATGGAAGTTGGGGGG + Intronic
977616364 4:99091121-99091143 TGAGAGTTAAAGATTCTTGGGGG + Intergenic
978570953 4:110136808-110136830 TCTGTGTTATAGGATATGGGTGG - Intronic
979847555 4:125535263-125535285 TTTGAGTTATAGTATGTGGTGGG + Intergenic
980015429 4:127645195-127645217 TCTGTGTCATTGAATCTGGGTGG + Intronic
982246134 4:153353359-153353381 TGTGAATGGTAGAATCTAGGTGG - Intronic
984797272 4:183673898-183673920 TGTAAGTTATAGAATGATGGAGG + Intronic
985044068 4:185922438-185922460 TGTGAGTTATAAGAGCTGGAAGG - Intronic
986214076 5:5701768-5701790 TGTTAGTAATAGACTCTAGGAGG + Intergenic
986282938 5:6338175-6338197 TATGGGTTGCAGAATCTGGGTGG + Intergenic
986413840 5:7508618-7508640 ATTGAGTAATAGAATATGGGTGG - Intronic
987120519 5:14762550-14762572 TGGAAGTTAGAAAATCTGGGAGG - Intronic
987883670 5:23783519-23783541 TGTGAGATACAGAATTTGTGGGG + Intergenic
988623199 5:32844535-32844557 TGTGAGGTATAGAATGAGGAGGG + Intergenic
989490415 5:42046476-42046498 TGTGAGTCTTAGAACCTGTGTGG + Intergenic
989604481 5:43230783-43230805 TGTGAGGTACAGAATTGGGGAGG - Intronic
990518886 5:56558322-56558344 TGAGCGTTTGAGAATCTGGGTGG + Intronic
992221453 5:74577641-74577663 TGTGAGTTTTGGTATCTGTGGGG - Intergenic
995272191 5:110234214-110234236 TGTGAGCTATGGACTCTTGGGGG + Intergenic
996221309 5:120936488-120936510 TGTGAGTTTTTCAATCTGGCAGG + Intergenic
996931820 5:128897817-128897839 TGTGGCTTAGGGAATCTGGGAGG + Intronic
998777953 5:145624008-145624030 AGTGAGTTATTAAATCTGGGTGG - Intronic
999052954 5:148543717-148543739 TGTGACTTAAAAAATCTGTGAGG + Intronic
1000194372 5:158943608-158943630 TCTGGGTTCTAGAATCAGGGAGG + Intronic
1001026219 5:168226333-168226355 TGTGAGTTATGCAGCCTGGGAGG + Intronic
1001228753 5:169967857-169967879 TGTGATTTATTGAATGTGGGAGG + Intronic
1001341322 5:170848601-170848623 TGATAATTATTGAATCTGGGTGG - Intergenic
1001667963 5:173449051-173449073 TGGGAGTCATGGACTCTGGGTGG + Intergenic
1005084908 6:21995310-21995332 TGTGAGTTATAAAAACTCTGGGG - Intergenic
1005704467 6:28437936-28437958 TGTGGGTTATAAAATCTATGTGG + Intronic
1006173159 6:32107091-32107113 TGTGAGTGAAAGAACCTGGATGG + Intronic
1006335257 6:33417229-33417251 TGTGAGTCATAGGAGTTGGGGGG - Exonic
1007572777 6:42905237-42905259 AGTGACTTATTGAATCTGAGGGG + Intergenic
1010623021 6:78100353-78100375 TTTGAGTCATTTAATCTGGGTGG - Intergenic
1012650139 6:101742339-101742361 TGTGGGATAAAGAATCAGGGTGG + Intronic
1014678880 6:124403012-124403034 TATAAGTTATAGAATCAGGTTGG + Intronic
1016024304 6:139270356-139270378 TGTGAATTTTAGAATCAGAGAGG - Intronic
1016901043 6:149102559-149102581 TGTGGGTGATTGAATCAGGGGGG - Intergenic
1017684505 6:156898475-156898497 TTTGAGTTCTGGCATCTGGGCGG - Intronic
1018410965 6:163548015-163548037 TGTGAGTTATTTAATATGTGTGG - Intronic
1020362838 7:7348107-7348129 AGTGAGTTATAGAAAGGGGGAGG + Intergenic
1020428376 7:8094950-8094972 TGTGGGTTCCAGAATGTGGGAGG - Intergenic
1021885944 7:25139357-25139379 TGTTAGTGGTAGAATCTAGGTGG + Intronic
1028718060 7:93997302-93997324 TCTGAGTTGTTAAATCTGGGAGG - Intronic
1030447403 7:109664442-109664464 TGTTAATTGTAGAATCTAGGTGG - Intergenic
1031018806 7:116604497-116604519 AGTGAATTATAGAACCTGAGAGG + Intergenic
1032398320 7:131606675-131606697 GGTGAGTTGTAGAGGCTGGGAGG - Intergenic
1034320065 7:150172103-150172125 TAATAGTTATAGAATCTGGCCGG - Intergenic
1035410244 7:158634175-158634197 TGTGGATTTTAGTATCTGGGGGG - Intronic
1038702759 8:29864677-29864699 TGAGAGTTAAAAACTCTGGGAGG + Intergenic
1039121782 8:34156318-34156340 TGGGAGTTATAACATGTGGGTGG - Intergenic
1039691537 8:39870094-39870116 TGTGAGTTATAGAAATTGCTTGG - Intergenic
1041901717 8:62989536-62989558 TGGGAGTTATAGAATCATGGGGG - Intronic
1042745715 8:72103498-72103520 TGTACGTTTTAGAATCTGAGGGG - Intronic
1045516035 8:102862338-102862360 TGTTAATTACAGAATCTAGGTGG + Intronic
1047794091 8:128236225-128236247 TGTGATTTGCAGAATCTGGCTGG - Intergenic
1051098077 9:13489474-13489496 TGGGAGTTACAGACTTTGGGGGG + Intergenic
1051362510 9:16293833-16293855 TGTGAGTGTGTGAATCTGGGAGG - Intergenic
1052228136 9:26114625-26114647 TATGAGTTATAGAATATGAGAGG + Intronic
1058293996 9:103282486-103282508 TGTTGGTTATAGTATCTAGGTGG - Intergenic
1058743512 9:107967566-107967588 TGTGAGTAATAGAATGTGCCAGG - Intergenic
1059615452 9:115945988-115946010 GGTTAGTTACAGAATCTGAGTGG - Intergenic
1061172823 9:128970958-128970980 TGTGAGTTTAAGGCTCTGGGTGG + Exonic
1061288404 9:129637323-129637345 TGTGAGTAACAGAACCTGGAAGG + Exonic
1186492831 X:9987931-9987953 TGTTAATGAGAGAATCTGGGTGG + Intergenic
1187340596 X:18417795-18417817 TGTTAATTGTAGAATCTAGGTGG - Intergenic
1188239754 X:27771359-27771381 TCTGAAGTATAGAATATGGGAGG + Intergenic
1189055301 X:37693421-37693443 TGTTAATTGTAGAATCTAGGTGG - Intronic
1189379384 X:40491041-40491063 TGTGAGTTGTGGGATCTGGAGGG + Intergenic
1190446247 X:50527410-50527432 TCTGTATTAAAGAATCTGGGAGG - Intergenic
1190837019 X:54110522-54110544 TATTAATTATAGAATCTAGGTGG + Intronic
1190896720 X:54626191-54626213 TGTGAGTATTAGAGACTGGGAGG - Intergenic
1192034463 X:67546980-67547002 GGGGAGTTGAAGAATCTGGGAGG - Intronic
1194399027 X:93420395-93420417 GGTGAGTTATAAAAACTGGCAGG + Intergenic
1194567532 X:95510992-95511014 TGTGAGTTTTTGAATCTATGTGG - Intergenic
1195049772 X:101086516-101086538 TTTGATTTATTGAATCTGAGGGG + Intronic
1196239642 X:113327398-113327420 TGTAAATTATAGATTCTGAGTGG - Intergenic
1196981603 X:121220416-121220438 TGTAAATTATAGAATCTTGGTGG + Intergenic
1198258912 X:134948991-134949013 TGCAAGTTAAAGAATCTCGGAGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic