ID: 964589055

View in Genome Browser
Species Human (GRCh38)
Location 3:158340594-158340616
Sequence CTGGGGAGGCCTCAAAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19073
Summary {0: 151, 1: 5462, 2: 6800, 3: 4287, 4: 2373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964589055_964589064 27 Left 964589055 3:158340594-158340616 CCATGATTTTGAGGCCTCCCCAG 0: 151
1: 5462
2: 6800
3: 4287
4: 2373
Right 964589064 3:158340644-158340666 CCTCTTTCTGTTCCCAGTGTCGG 0: 1
1: 2
2: 89
3: 674
4: 890
964589055_964589065 28 Left 964589055 3:158340594-158340616 CCATGATTTTGAGGCCTCCCCAG 0: 151
1: 5462
2: 6800
3: 4287
4: 2373
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964589055 Original CRISPR CTGGGGAGGCCTCAAAATCA TGG (reversed) Intronic
Too many off-targets to display for this crispr