ID: 964589057

View in Genome Browser
Species Human (GRCh38)
Location 3:158340608-158340630
Sequence ACAGTTCCACATGGCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28635
Summary {0: 3882, 1: 6620, 2: 7728, 3: 6299, 4: 4106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964589057_964589065 14 Left 964589057 3:158340608-158340630 CCTCCCCAGCCATGTGGAACTGT 0: 3882
1: 6620
2: 7728
3: 6299
4: 4106
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589057_964589064 13 Left 964589057 3:158340608-158340630 CCTCCCCAGCCATGTGGAACTGT 0: 3882
1: 6620
2: 7728
3: 6299
4: 4106
Right 964589064 3:158340644-158340666 CCTCTTTCTGTTCCCAGTGTCGG 0: 1
1: 2
2: 89
3: 674
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964589057 Original CRISPR ACAGTTCCACATGGCTGGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr