ID: 964589058

View in Genome Browser
Species Human (GRCh38)
Location 3:158340611-158340633
Sequence CTTACAGTTCCACATGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27734
Summary {0: 1791, 1: 5734, 2: 7090, 3: 7321, 4: 5798}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964589058_964589065 11 Left 964589058 3:158340611-158340633 CCCCAGCCATGTGGAACTGTAAG 0: 1791
1: 5734
2: 7090
3: 7321
4: 5798
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589058_964589064 10 Left 964589058 3:158340611-158340633 CCCCAGCCATGTGGAACTGTAAG 0: 1791
1: 5734
2: 7090
3: 7321
4: 5798
Right 964589064 3:158340644-158340666 CCTCTTTCTGTTCCCAGTGTCGG 0: 1
1: 2
2: 89
3: 674
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964589058 Original CRISPR CTTACAGTTCCACATGGCTG GGG (reversed) Intronic
Too many off-targets to display for this crispr