ID: 964589059

View in Genome Browser
Species Human (GRCh38)
Location 3:158340612-158340634
Sequence TCTTACAGTTCCACATGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23113
Summary {0: 12, 1: 2037, 2: 6082, 3: 7328, 4: 7654}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964589059_964589065 10 Left 964589059 3:158340612-158340634 CCCAGCCATGTGGAACTGTAAGA 0: 12
1: 2037
2: 6082
3: 7328
4: 7654
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589059_964589064 9 Left 964589059 3:158340612-158340634 CCCAGCCATGTGGAACTGTAAGA 0: 12
1: 2037
2: 6082
3: 7328
4: 7654
Right 964589064 3:158340644-158340666 CCTCTTTCTGTTCCCAGTGTCGG 0: 1
1: 2
2: 89
3: 674
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964589059 Original CRISPR TCTTACAGTTCCACATGGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr