ID: 964589060

View in Genome Browser
Species Human (GRCh38)
Location 3:158340613-158340635
Sequence GTCTTACAGTTCCACATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22046
Summary {0: 10, 1: 1935, 2: 5665, 3: 7016, 4: 7420}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964589060_964589064 8 Left 964589060 3:158340613-158340635 CCAGCCATGTGGAACTGTAAGAC 0: 10
1: 1935
2: 5665
3: 7016
4: 7420
Right 964589064 3:158340644-158340666 CCTCTTTCTGTTCCCAGTGTCGG 0: 1
1: 2
2: 89
3: 674
4: 890
964589060_964589065 9 Left 964589060 3:158340613-158340635 CCAGCCATGTGGAACTGTAAGAC 0: 10
1: 1935
2: 5665
3: 7016
4: 7420
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964589060 Original CRISPR GTCTTACAGTTCCACATGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr