ID: 964589065

View in Genome Browser
Species Human (GRCh38)
Location 3:158340645-158340667
Sequence CTCTTTCTGTTCCCAGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2437
Summary {0: 1, 1: 5, 2: 109, 3: 856, 4: 1466}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964589060_964589065 9 Left 964589060 3:158340613-158340635 CCAGCCATGTGGAACTGTAAGAC 0: 10
1: 1935
2: 5665
3: 7016
4: 7420
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589055_964589065 28 Left 964589055 3:158340594-158340616 CCATGATTTTGAGGCCTCCCCAG 0: 151
1: 5462
2: 6800
3: 4287
4: 2373
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589059_964589065 10 Left 964589059 3:158340612-158340634 CCCAGCCATGTGGAACTGTAAGA 0: 12
1: 2037
2: 6082
3: 7328
4: 7654
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589058_964589065 11 Left 964589058 3:158340611-158340633 CCCCAGCCATGTGGAACTGTAAG 0: 1791
1: 5734
2: 7090
3: 7321
4: 5798
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589057_964589065 14 Left 964589057 3:158340608-158340630 CCTCCCCAGCCATGTGGAACTGT 0: 3882
1: 6620
2: 7728
3: 6299
4: 4106
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466
964589061_964589065 5 Left 964589061 3:158340617-158340639 CCATGTGGAACTGTAAGACCAAT 0: 10
1: 1349
2: 2507
3: 4150
4: 6503
Right 964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG 0: 1
1: 5
2: 109
3: 856
4: 1466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964589065 Original CRISPR CTCTTTCTGTTCCCAGTGTC GGG Intronic
Too many off-targets to display for this crispr