ID: 964589354

View in Genome Browser
Species Human (GRCh38)
Location 3:158342544-158342566
Sequence CTCTTTCTGTTCCCAGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2525
Summary {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964589347_964589354 11 Left 964589347 3:158342510-158342532 CCCCAGCCATGTGGAACCATAAA 0: 1
1: 53
2: 434
3: 3040
4: 7087
Right 964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG 0: 5
1: 83
2: 160
3: 868
4: 1409
964589351_964589354 -5 Left 964589351 3:158342526-158342548 CCATAAATCCAATTAAACCTCTT 0: 1
1: 34
2: 28
3: 57
4: 366
Right 964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG 0: 5
1: 83
2: 160
3: 868
4: 1409
964589346_964589354 14 Left 964589346 3:158342507-158342529 CCTCCCCAGCCATGTGGAACCAT 0: 52
1: 398
2: 4758
3: 7200
4: 8065
Right 964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG 0: 5
1: 83
2: 160
3: 868
4: 1409
964589350_964589354 5 Left 964589350 3:158342516-158342538 CCATGTGGAACCATAAATCCAAT 0: 1
1: 21
2: 265
3: 1859
4: 3171
Right 964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG 0: 5
1: 83
2: 160
3: 868
4: 1409
964589348_964589354 10 Left 964589348 3:158342511-158342533 CCCAGCCATGTGGAACCATAAAT 0: 1
1: 49
2: 416
3: 3104
4: 7182
Right 964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG 0: 5
1: 83
2: 160
3: 868
4: 1409
964589349_964589354 9 Left 964589349 3:158342512-158342534 CCAGCCATGTGGAACCATAAATC 0: 1
1: 43
2: 406
3: 2952
4: 6602
Right 964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG 0: 5
1: 83
2: 160
3: 868
4: 1409
964589344_964589354 28 Left 964589344 3:158342493-158342515 CCATGATTCTGAGGCCTCCCCAG 0: 927
1: 5460
2: 6455
3: 4087
4: 2288
Right 964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG 0: 5
1: 83
2: 160
3: 868
4: 1409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964589354 Original CRISPR CTCTTTCTGTTCCCAGTTTC AGG Intronic
Too many off-targets to display for this crispr