ID: 964591902

View in Genome Browser
Species Human (GRCh38)
Location 3:158374070-158374092
Sequence CTATGTGCATATAATAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964591902_964591904 11 Left 964591902 3:158374070-158374092 CCAACTTTATTATATGCACATAG 0: 1
1: 0
2: 1
3: 21
4: 208
Right 964591904 3:158374104-158374126 TTTATGTTTTTTGAATACAAGGG 0: 1
1: 0
2: 7
3: 82
4: 1248
964591902_964591903 10 Left 964591902 3:158374070-158374092 CCAACTTTATTATATGCACATAG 0: 1
1: 0
2: 1
3: 21
4: 208
Right 964591903 3:158374103-158374125 TTTTATGTTTTTTGAATACAAGG 0: 1
1: 0
2: 23
3: 543
4: 9134
964591902_964591905 12 Left 964591902 3:158374070-158374092 CCAACTTTATTATATGCACATAG 0: 1
1: 0
2: 1
3: 21
4: 208
Right 964591905 3:158374105-158374127 TTATGTTTTTTGAATACAAGGGG 0: 1
1: 0
2: 1
3: 43
4: 703
964591902_964591906 13 Left 964591902 3:158374070-158374092 CCAACTTTATTATATGCACATAG 0: 1
1: 0
2: 1
3: 21
4: 208
Right 964591906 3:158374106-158374128 TATGTTTTTTGAATACAAGGGGG 0: 1
1: 1
2: 6
3: 74
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964591902 Original CRISPR CTATGTGCATATAATAAAGT TGG (reversed) Intronic
901487946 1:9578297-9578319 CTATGCGGAGATAATAAAGAAGG + Intronic
905627221 1:39497218-39497240 CTCTGTGGATATATTAAAGCAGG + Intronic
909025654 1:70478854-70478876 GTGTCTGCATAGAATAAAGTAGG + Intergenic
909212635 1:72843952-72843974 CTATGTGCATAGGAGAAATTTGG - Intergenic
909603444 1:77484574-77484596 CTAAGTGCAAATAATCAACTTGG + Intronic
910045450 1:82908477-82908499 CTACCTGCATATAATATAGTAGG + Intergenic
910083380 1:83370307-83370329 CTATGCGCAAATGATAAATTTGG + Intergenic
910749115 1:90608851-90608873 CTATTTGGATATAGTAAACTTGG - Intergenic
910794752 1:91086521-91086543 TTATGTGGATATAAACAAGTTGG + Intergenic
911865033 1:103007458-103007480 CAATATGCATATAATAAACATGG + Intronic
916442115 1:164837502-164837524 CTACGTGAATATAATAAATGTGG + Intronic
916834363 1:168527660-168527682 CCATATGCATCTAATAAAATTGG + Intergenic
916995829 1:170299668-170299690 CTTTGTGCATATAATACTTTTGG + Intergenic
917928163 1:179806117-179806139 CTATATGTATTTTATAAAGTGGG + Intronic
918293415 1:183131996-183132018 ATATGTACATATAATAAAGTAGG + Intronic
920224944 1:204431639-204431661 CTCTGTGCAGATAGTAAAGGGGG + Intronic
920613308 1:207464092-207464114 CTTTTTGCATGGAATAAAGTTGG - Intronic
921023336 1:211256676-211256698 CTAGGTGCATATTTTAAATTTGG - Intergenic
922366539 1:224869968-224869990 CAATGTGCATATAATTAATATGG - Intergenic
922629791 1:227094676-227094698 GTATGTGCATTTGATAAATTTGG - Intronic
924896715 1:248345738-248345760 CTCTGTAAATATATTAAAGTTGG - Intergenic
1063570326 10:7209682-7209704 ATATGTGCATAAAATAAATCTGG + Intronic
1065305110 10:24361109-24361131 CTATGTGCCTAGAAAAAAATAGG - Intronic
1068201672 10:53791392-53791414 CTTTTTGCACATAATAATGTAGG + Intergenic
1068228028 10:54132406-54132428 CTATGGCCATAAAATGAAGTGGG + Intronic
1070017565 10:72549077-72549099 ATATGTGAATTTAATAATGTGGG + Intronic
1070714173 10:78706764-78706786 CTATGGGCCTATAATCTAGTAGG - Intergenic
1071276086 10:84056482-84056504 CTATGTGCTTATCAAAAAATTGG - Intergenic
1071841640 10:89477778-89477800 ATATGTACATATAATATTGTTGG - Intronic
1073674090 10:105625852-105625874 AGATGTGAATCTAATAAAGTTGG - Intergenic
1074294185 10:112167942-112167964 ATATGTGCATATTTTAAATTGGG - Intronic
1076739356 10:132475122-132475144 CTAGGTTCATAAAATTAAGTGGG + Intergenic
1077389150 11:2291477-2291499 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389247 11:2291960-2291982 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389291 11:2292174-2292196 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389357 11:2292504-2292526 CTCTGTGAATATACTGAAGTAGG - Intergenic
1077389367 11:2292560-2292582 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077857322 11:6141762-6141784 CTATGTACAAATAAAAAAATAGG - Intergenic
1079410876 11:20186409-20186431 TTAGGTTCATTTAATAAAGTTGG + Intergenic
1079879788 11:25911940-25911962 ATATGTATATATAATAAATTAGG - Intergenic
1081818535 11:45968209-45968231 CTCTGTGCAGAGAATAAATTGGG - Intronic
1086284925 11:85236730-85236752 CTGTGTGCATATAACAAATGAGG + Intronic
1087246141 11:95839852-95839874 CTAGGTGTATAAAATAAAGATGG + Intronic
1087548155 11:99610901-99610923 CTATGTGCTTAGAAAAAAGCGGG + Intronic
1087792842 11:102425372-102425394 TTATGTGCAAATAATAAAGATGG + Intronic
1087943797 11:104134053-104134075 CTATCAGCCAATAATAAAGTAGG + Intronic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1088622170 11:111696904-111696926 CTAAATGCATATAGTGAAGTGGG - Intronic
1090607971 11:128443684-128443706 CTATATTCATATTAAAAAGTAGG - Intergenic
1093108105 12:15114086-15114108 CTAAATGCACAAAATAAAGTTGG + Intronic
1093734996 12:22610949-22610971 ATATGTGCATATATAAATGTAGG - Intergenic
1094408130 12:30140596-30140618 CTATGTCTTTATATTAAAGTGGG - Intergenic
1099112773 12:78583034-78583056 CTATGTTCAAATAAGAAAGGGGG + Intergenic
1099293092 12:80796500-80796522 CTATGGGAATATATTAAAGTTGG + Exonic
1100191375 12:92196499-92196521 ATATCTACATATAGTAAAGTAGG + Intergenic
1100912765 12:99384116-99384138 CTATATACAGATAATACAGTGGG - Intronic
1104276876 12:127337053-127337075 CTGTGGCCATATAATAAAATAGG - Intergenic
1109810392 13:67506514-67506536 CTTTGTGCATATAAACAAGTAGG - Intergenic
1111347577 13:86979746-86979768 CTATGTGCATTTAATTGACTTGG + Intergenic
1112600088 13:100846750-100846772 CTATGTGCAAAGAATAATGGGGG - Intergenic
1113296332 13:108963270-108963292 CTATGTGCATGTATTTAGGTAGG + Intronic
1113298611 13:108990259-108990281 CTTTGTGCATATCATAAGGAGGG + Intronic
1114610690 14:24038102-24038124 TTATGTCCATATATTAAAGTTGG + Intergenic
1114816893 14:25969572-25969594 CAATGTGTATAGAAAAAAGTAGG - Intergenic
1114860990 14:26522101-26522123 CAATGTGCATATAATATTTTAGG + Intronic
1115744063 14:36418172-36418194 CCAGGGGCATACAATAAAGTGGG - Intergenic
1116156032 14:41207103-41207125 CTAAATGCATGTAATAAAGTTGG - Intergenic
1116431563 14:44851714-44851736 TTATATGCATAAAATAAAATTGG - Intergenic
1117076558 14:52110769-52110791 CTATGTAAATATTATAAAGATGG + Intergenic
1118216044 14:63809451-63809473 CTATGATCCTATAATCAAGTGGG + Intergenic
1118664358 14:68050778-68050800 GTATTTGCATATAATAAAATGGG - Intronic
1120287874 14:82527830-82527852 AAATGTGCATATAATAGAGTGGG - Intergenic
1120366247 14:83574279-83574301 CTAAGTGAATATAATGTAGTAGG + Intergenic
1122002245 14:98668536-98668558 CTATGTACATAGCATAAGGTAGG + Intergenic
1123961559 15:25407604-25407626 CTTTTTACATATATTAAAGTAGG + Intronic
1124081559 15:26503090-26503112 TTATCTCCATATCATAAAGTTGG + Intergenic
1127101834 15:55573825-55573847 CTGTGTTCTTACAATAAAGTAGG + Intronic
1128424500 15:67526423-67526445 CCAAGTCCATATAATAAAGTTGG - Exonic
1129998096 15:80024136-80024158 CTATGTCAATATAAGAAAGCAGG - Intergenic
1131986886 15:98051725-98051747 CTCTGTGCCTATAATGTAGTAGG - Intergenic
1135801192 16:25498100-25498122 CCATGTGAATAGAAGAAAGTGGG - Intergenic
1136595862 16:31249388-31249410 TTATGTGCCTTAAATAAAGTGGG - Intergenic
1139023692 16:62785663-62785685 CTACATGCAAAAAATAAAGTTGG - Intergenic
1139202977 16:64997964-64997986 TTATGTGCATGTTATAAAGAAGG + Intronic
1140293887 16:73689400-73689422 CTATGTGCACAAAGTAAAGAGGG + Intergenic
1144135988 17:12295479-12295501 ATATATGCTTATAATATAGTTGG + Intergenic
1144347587 17:14363696-14363718 ATATGTGTATATAATAAAACTGG + Intergenic
1144353159 17:14418716-14418738 CTATATTCTTACAATAAAGTAGG - Intergenic
1147259782 17:39202570-39202592 CTGTGTGCAAATCAGAAAGTTGG + Intronic
1150240220 17:63625306-63625328 CTATGTGGCTATAAAAAATTGGG + Intronic
1152936316 17:83139433-83139455 CTGTATTCATAAAATAAAGTGGG - Intergenic
1155088481 18:22482335-22482357 TAATTTGCATATATTAAAGTGGG + Intergenic
1155135052 18:22982667-22982689 CTATGTGTATATATCCAAGTGGG + Intronic
1155835601 18:30579864-30579886 CTATGGTCATATATAAAAGTAGG - Intergenic
1159494584 18:69185594-69185616 TGATATGCATACAATAAAGTTGG - Intergenic
1160009266 18:75091343-75091365 CCATGTGCAAATAATGAAGTTGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164723452 19:30449636-30449658 CTCTGTTCATTAAATAAAGTCGG + Intronic
925536544 2:4924376-4924398 CTATGTGCATATATTTCTGTAGG + Intergenic
927418110 2:22901083-22901105 CTATGTGCATATGATTACATGGG + Intergenic
929342586 2:40839653-40839675 CTATGTGTACATAGAAAAGTTGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
938734162 2:134171344-134171366 CTGTGTGTATATATTAATGTAGG + Intronic
939300021 2:140324048-140324070 CTATGTGGATGTAATAAACCTGG + Exonic
941295548 2:163735073-163735095 CTACATGCATATAATTAAGGGGG + Intronic
941447367 2:165618501-165618523 CTCTATGCATTTCATAAAGTTGG + Intronic
942691472 2:178589779-178589801 GTTTGTGCAGAGAATAAAGTAGG - Exonic
945800994 2:214430586-214430608 CCATGTAGATATAATAAACTAGG - Intronic
945849968 2:214993564-214993586 CTATTTGAATATAATTAAGTGGG + Intronic
947549246 2:231034733-231034755 CTAAGTGGGTATAATAAACTGGG - Intergenic
1170019768 20:11824099-11824121 ATATGTTTATATAATAAAGAGGG - Intergenic
1170179020 20:13508021-13508043 CTACGTGCAAAAAATAAAATTGG + Intronic
1171121224 20:22570830-22570852 CTATTTGTGTAAAATAAAGTAGG - Intergenic
1171757422 20:29123751-29123773 CTATGGGCATCTTATGAAGTAGG + Intergenic
1175304882 20:57969119-57969141 CCATGTGCCTGGAATAAAGTGGG + Intergenic
1176719718 21:10383276-10383298 ATATTTGTATATAATAATGTTGG - Intergenic
1177638915 21:23821145-23821167 ATATGTGCATATACTAATCTAGG - Intergenic
1180300958 22:11036232-11036254 ATATTTGTATATAATAATGTTGG - Intergenic
1183660756 22:39219679-39219701 TAATTTGCATATAATTAAGTGGG + Intergenic
953575907 3:44113060-44113082 TTATGTCCTTAAAATAAAGTGGG + Intergenic
954084841 3:48236107-48236129 CTATCTGCCTAAAATAATGTAGG - Intergenic
956089225 3:65647371-65647393 CTAGGTTCATAAAATAAATTGGG - Intronic
957122909 3:76119725-76119747 GTATGTGCGTAAAATAAAGTAGG - Intronic
958469969 3:94504429-94504451 CTGTCTTCATATAATAAAGTTGG + Intergenic
958729377 3:97945141-97945163 ATATATGCATATAAAATAGTAGG + Exonic
959024823 3:101229196-101229218 CTCTGTGCATATCATAGACTAGG + Intronic
962454789 3:135555039-135555061 CTAAGTGCATATAGTAAACTTGG + Intergenic
962566264 3:136663345-136663367 CTATTTGCTTATTCTAAAGTAGG - Intronic
962740201 3:138357703-138357725 CCATGTGCATACAGTAAGGTTGG + Intronic
963554226 3:146766854-146766876 ATATTTTCATATAATAAAATAGG + Intergenic
964591902 3:158374070-158374092 CTATGTGCATATAATAAAGTTGG - Intronic
964728466 3:159839865-159839887 CTTTGTGCCTATAATATAATTGG + Exonic
972343108 4:38169996-38170018 CTATGGGCTTATAACAAAGAGGG + Intergenic
972390342 4:38607505-38607527 CTCTGTGAAAATGATAAAGTTGG - Intergenic
972919739 4:43923741-43923763 CTATCTGGATATAAAAATGTAGG - Intergenic
975187196 4:71417651-71417673 TTAACTGCATAAAATAAAGTGGG - Intronic
975864517 4:78713216-78713238 CTATTTGGATATAATATTGTTGG + Intergenic
976920042 4:90428509-90428531 CTGTATTCTTATAATAAAGTAGG + Intronic
977655953 4:99520933-99520955 CTATGAACATATTATTAAGTTGG - Intronic
978255973 4:106693304-106693326 CCATATGCCTATAAAAAAGTGGG + Intergenic
979601421 4:122590310-122590332 CTATATTCTCATAATAAAGTAGG - Intergenic
979801490 4:124914539-124914561 CTTTGTCCACATAATAAAATGGG - Intergenic
980082722 4:128361638-128361660 CTTTGTGCATAAAATATTGTTGG - Intergenic
980508363 4:133753596-133753618 CTATGTTATTATATTAAAGTGGG + Intergenic
980628164 4:135402975-135402997 CTAGGTGCATATAACAAATGCGG + Intergenic
981870744 4:149482782-149482804 CTGTCTTCATATAATAAATTTGG + Intergenic
981873369 4:149512871-149512893 CTATGTGAATATAACAAAGAGGG + Intergenic
986871718 5:12055453-12055475 ATATTTTCACATAATAAAGTGGG + Intergenic
988173160 5:27684995-27685017 ATATGTGCATATAAATGAGTAGG - Intergenic
989704857 5:44316967-44316989 CCATGTGCATATATTTAAGGGGG - Intronic
991000104 5:61774098-61774120 AAATCTGCATATATTAAAGTGGG - Intergenic
991150581 5:63363197-63363219 CTATATGCATATAATATTATGGG - Intergenic
992364273 5:76075847-76075869 CTATGTGCAAATAATCTATTTGG - Intergenic
992603517 5:78430750-78430772 TAATGTAAATATAATAAAGTAGG - Intronic
993838935 5:92852135-92852157 CTATGTAAAAGTAATAAAGTAGG + Intergenic
994128028 5:96191574-96191596 CTGTGAGGATATAATAAAGATGG + Intergenic
995196805 5:109379628-109379650 TTACCTGCATATAATAAAGAAGG - Intronic
996095477 5:119394476-119394498 CTGTGTATAAATAATAAAGTAGG + Intronic
997298051 5:132781786-132781808 GAATGTGAATTTAATAAAGTGGG - Intronic
997515475 5:134485736-134485758 ATATGTGAAAATAATAAAATTGG + Intergenic
999417078 5:151407676-151407698 CTCCGTGTATATAATACAGTGGG + Intergenic
1000680557 5:164178537-164178559 ATATGTGAATATAATCATGTGGG - Intergenic
1003358216 6:5395709-5395731 CTGTGTGCTTATAATAATTTTGG + Intronic
1003742437 6:8957194-8957216 CTATGTACCTCTAATAGAGTAGG - Intergenic
1005139896 6:22617985-22618007 CATTATGCATATTATAAAGTTGG - Intergenic
1005162502 6:22880232-22880254 CTATATGTAAATAATAAAGGTGG - Intergenic
1005197808 6:23309580-23309602 CTATGTTCTGATAATAAAGGAGG - Intergenic
1005243970 6:23860858-23860880 CTAGGTTCATATAATGAACTGGG - Intergenic
1006678086 6:35777908-35777930 CTATGTGCAGATACTAAGCTGGG - Exonic
1007893888 6:45327300-45327322 CTATGAGCTTAGAATAGAGTGGG - Intronic
1008149634 6:47934982-47935004 CTATGTTCACATAACAAAATAGG + Intronic
1008500731 6:52179751-52179773 CTATTTGCTTATAATGAATTAGG - Intergenic
1008522049 6:52371273-52371295 AGATGAGCATATAATAAAGCTGG - Intronic
1011570761 6:88731897-88731919 CTATATTCTTAAAATAAAGTAGG + Intronic
1012061362 6:94486982-94487004 ATATGTACATACAATAAATTTGG - Intergenic
1016725331 6:147358696-147358718 CTGTATTCATGTAATAAAGTAGG + Intronic
1020701941 7:11495676-11495698 TTATGTGCACATATTAAAGATGG + Intronic
1020947782 7:14636205-14636227 TTATGTGCATGTAATTAATTGGG + Intronic
1021049482 7:15965691-15965713 CTATGTGATTATAATAAAGATGG + Intergenic
1021088000 7:16446708-16446730 CAATGTGGATAAAACAAAGTAGG - Intergenic
1023156806 7:37259458-37259480 CTATCTGCATATTACAGAGTGGG + Intronic
1023786266 7:43711296-43711318 TGATGAGCACATAATAAAGTGGG - Intronic
1026712744 7:72757065-72757087 ATATGTACATATAACAATGTCGG + Intronic
1027300212 7:76826449-76826471 CTATGCGCAAATAATAAATTTGG + Intergenic
1030238811 7:107296316-107296338 CTATGTGCATGTACTAAAAAAGG - Intronic
1030841832 7:114363285-114363307 TTATGGGCATATAGTATAGTAGG - Intronic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1035953679 8:4052365-4052387 CTATTTTCATATAATATAATTGG + Intronic
1036135471 8:6156884-6156906 CCATGTACCTATAATAAACTAGG - Intergenic
1036502919 8:9329762-9329784 CTATGTGCATAAAGTAAATGTGG - Intergenic
1036657895 8:10689723-10689745 CTGTGTTCTTACAATAAAGTAGG + Intronic
1038353174 8:26799907-26799929 CAATGTGAAAAAAATAAAGTTGG + Intronic
1040797485 8:51301872-51301894 CAATTTTCATATAATAAAATGGG + Intergenic
1042983989 8:74563559-74563581 CTATTTGCATGTAATAAATATGG + Intergenic
1043044109 8:75299512-75299534 CCATGTGCACATAAAAAAGCAGG - Intergenic
1044083474 8:87914104-87914126 TTATGTTCATATGAGAAAGTTGG - Intergenic
1045806143 8:106164540-106164562 ATATGTGCATTTCATAAAATGGG - Intergenic
1050272497 9:3960806-3960828 CTATGTTCATATGAAAAACTTGG - Intronic
1050996485 9:12225830-12225852 ATTTGTGCTTATAATAAAATTGG + Intergenic
1051356324 9:16242611-16242633 CTATTTGCATATTCTAATGTGGG - Intronic
1052479925 9:29010526-29010548 ACATGTGCATTTAAGAAAGTTGG - Intergenic
1054338041 9:63826406-63826428 CTATGAGCATCTAGTGAAGTAGG - Intergenic
1055597511 9:77880636-77880658 CCATGTGCAATTAATGAAGTAGG - Intronic
1055707063 9:79017196-79017218 CTATGTGCAGATACTATACTAGG + Intergenic
1055764175 9:79643935-79643957 CTCTGTGCATATGAAAATGTGGG + Intronic
1058071572 9:100606070-100606092 TTTTGTACATATAAAAAAGTGGG + Intergenic
1058220890 9:102300618-102300640 ATATATGCATATAAATAAGTTGG + Intergenic
1058273049 9:102999879-102999901 TTATGTGTCTATAATAATGTGGG + Intronic
1059038205 9:110782655-110782677 CTTTCTGCTAATAATAAAGTTGG - Intronic
1059935561 9:119306861-119306883 GTATGTCCATAGAATAAAATGGG - Intronic
1061049758 9:128187806-128187828 ATATATACATATAATTAAGTTGG - Intronic
1185541097 X:903606-903628 ATATTTGTATATAATAATGTTGG + Intergenic
1185541157 X:904007-904029 ATATTTGTATATAATAATGTTGG + Intergenic
1187354141 X:18551175-18551197 CTATGTTCATATTATAGATTCGG - Intronic
1187358008 X:18596691-18596713 AAATGTGAATAGAATAAAGTAGG + Intronic
1187566002 X:20450210-20450232 CTATATATATATAATAAAGTTGG + Intergenic
1187984895 X:24799509-24799531 CTATGCTCAGATAATGAAGTTGG - Intronic
1189141253 X:38608580-38608602 CTATGTATATAAAATAAAGAAGG - Intronic
1189879074 X:45470670-45470692 CAAAGGGCATATAATAAATTAGG + Intergenic
1190443449 X:50498945-50498967 CTTTGTACATATAAGAAAGAAGG + Intergenic
1191855413 X:65621305-65621327 CTATATGAAAAGAATAAAGTTGG - Intronic
1192318824 X:70072659-70072681 CTATGTGCATTTTATTAAGTAGG - Intergenic
1193249280 X:79269232-79269254 CACAGTGCAAATAATAAAGTTGG + Intergenic
1193503659 X:82311247-82311269 CTACATGCACATAATGAAGTTGG - Intergenic
1193680223 X:84509633-84509655 CTATGTGAATAGACCAAAGTAGG + Intergenic
1194301999 X:92199873-92199895 ATATGTCCATTTAATTAAGTAGG - Intronic
1196001674 X:110793908-110793930 TTATGAGCAAATAAAAAAGTTGG + Intronic
1198471093 X:136947826-136947848 CTATGTGCAACTAATCAAGTAGG + Intergenic
1202250234 Y:22863812-22863834 TTATTTTCATATAAAAAAGTAGG + Intergenic
1202403223 Y:24497560-24497582 TTATTTTCATATAAAAAAGTAGG + Intergenic
1202467558 Y:25172521-25172543 TTATTTTCATATAAAAAAGTAGG - Intergenic