ID: 964599533

View in Genome Browser
Species Human (GRCh38)
Location 3:158481799-158481821
Sequence GAGTTCATCCAAATAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964599533_964599536 13 Left 964599533 3:158481799-158481821 CCATTTTCTATTTGGATGAACTC 0: 1
1: 0
2: 4
3: 25
4: 305
Right 964599536 3:158481835-158481857 CATTTAAATGATAATAATGTGGG 0: 1
1: 0
2: 6
3: 79
4: 550
964599533_964599535 12 Left 964599533 3:158481799-158481821 CCATTTTCTATTTGGATGAACTC 0: 1
1: 0
2: 4
3: 25
4: 305
Right 964599535 3:158481834-158481856 TCATTTAAATGATAATAATGTGG 0: 1
1: 0
2: 3
3: 60
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964599533 Original CRISPR GAGTTCATCCAAATAGAAAA TGG (reversed) Intronic
900220574 1:1507151-1507173 GAAGTCATCCAAACTGAAAAGGG - Intergenic
900835793 1:5002983-5003005 GAGTTGCTCTAAATAGAAAATGG - Intergenic
904224483 1:29004336-29004358 AAATTCATCCACACAGAAAATGG - Intronic
906673097 1:47673592-47673614 GACTACATCCTAAGAGAAAAGGG - Intergenic
907293971 1:53437911-53437933 GTGTTCATCTCAATAGAAATCGG - Intergenic
907841269 1:58160013-58160035 GAGTTCTTCCAAAGAGAAAAAGG + Intronic
908486551 1:64599880-64599902 GACTTCATCCAGATAGACAAAGG + Intronic
915930126 1:160055088-160055110 GAATTCAACCTAATAGTAAAAGG - Intronic
916032100 1:160885807-160885829 CAATTCATAGAAATAGAAAAAGG + Intergenic
916240634 1:162635336-162635358 GAGCTCATGCGAATTGAAAATGG - Intronic
917606828 1:176640012-176640034 GAGCTCATACAAGAAGAAAAGGG + Intronic
919541953 1:198858264-198858286 CAGTTCATGCACATAGAAAGTGG + Intergenic
919960617 1:202464420-202464442 GAACTCATCCAAACACAAAACGG - Intronic
921140562 1:212301534-212301556 GATTTCATTAAAATTGAAAATGG - Intronic
921407381 1:214795835-214795857 AAAGGCATCCAAATAGAAAAAGG - Intergenic
921574861 1:216822993-216823015 GAGTTTACCCAATTAGAAAAGGG + Intronic
921759226 1:218893166-218893188 AAGTTCATGCAATTAGATAATGG - Intergenic
921827335 1:219687960-219687982 GAGTTCTGGCAAATAGAAAGTGG - Intronic
922879695 1:228971364-228971386 GGAATCATCCAAAGAGAAAATGG - Intergenic
923327368 1:232892605-232892627 GAGTTCATATAAATGGAAGAAGG + Intergenic
924466353 1:244302197-244302219 GAGTAAAACCAAATAGAAAAAGG - Intergenic
1063501792 10:6561912-6561934 GAGTTCAAGCAAAAAGTAAAGGG + Intronic
1063529825 10:6820449-6820471 GACTTCAGTCAAAAAGAAAAAGG - Intergenic
1063750856 10:8945269-8945291 AAGCACATCTAAATAGAAAAAGG - Intergenic
1063895303 10:10675062-10675084 GAGCACATCAAAAAAGAAAAAGG - Intergenic
1065662226 10:28017896-28017918 GAGCTCAGCCAAAAAGACAAAGG - Intergenic
1065743113 10:28814884-28814906 GAGCTCATACAAGTAAAAAAAGG + Intergenic
1068298303 10:55104973-55104995 GAGCTCATCCCAATAGCAACAGG + Intronic
1069057554 10:63860504-63860526 GACTTCATCCAAAAAGAAGTTGG + Intergenic
1071251074 10:83820473-83820495 GAGGTATTCCAAAAAGAAAATGG - Intergenic
1072475216 10:95753470-95753492 AAGTTCATCCAAACTGAATATGG - Intronic
1073863585 10:107774760-107774782 AAGGGCATCCAAATAAAAAAGGG + Intergenic
1074177612 10:111025765-111025787 GAGTGCATCAAAATGGTAAAGGG - Intergenic
1074723794 10:116286839-116286861 GACTTCAGGAAAATAGAAAAGGG - Intergenic
1076187023 10:128458124-128458146 GAGTTCAGCCACAGTGAAAAGGG - Intergenic
1077739822 11:4833131-4833153 TGTTTCATCCAAATAGGAAATGG + Intronic
1079610082 11:22421887-22421909 TAAGTCATACAAATAGAAAATGG + Intergenic
1081384300 11:42453078-42453100 TACTTCATGCAAATAAAAAATGG - Intergenic
1085831556 11:79906458-79906480 GAGTTCAACCGAATAGCATAAGG - Intergenic
1085928854 11:81056352-81056374 GACTGCATCCACATAGAAAATGG - Intergenic
1086371432 11:86159220-86159242 AAGGTCATACAACTAGAAAATGG - Intergenic
1086668758 11:89520722-89520744 AAAATCATCCAAATAGGAAAAGG + Intergenic
1087349796 11:97017428-97017450 GAGTTTCTCCCAAAAGAAAATGG - Intergenic
1088108186 11:106228916-106228938 GAGACCATCCAAGTAGAAAGGGG - Intergenic
1088572405 11:111235258-111235280 GACTCCATCCAAAAAAAAAAAGG + Intergenic
1090580434 11:128153115-128153137 GAGCTCTGCCAAATGGAAAATGG - Intergenic
1090883913 11:130859571-130859593 GAGTTAATCCACATAGAGCACGG + Intergenic
1091028868 11:132165658-132165680 AAGATCATCCAAATAAAAGATGG + Intronic
1092024724 12:5231167-5231189 GAATTCTTCCATTTAGAAAAAGG + Intergenic
1093147767 12:15587314-15587336 AAGTTCATGCAACTAGAACATGG + Intronic
1093689769 12:22097497-22097519 AAGCACATCCAAATAGAAAGAGG - Intronic
1094366020 12:29682067-29682089 AAGGTGATCCAACTAGAAAATGG + Intronic
1095797825 12:46239691-46239713 GATTTCACCGAAGTAGAAAATGG - Exonic
1096862550 12:54540298-54540320 TAGTTTCTCCAACTAGAAAAAGG + Intronic
1098392034 12:69979733-69979755 CAGTTTATCCAAATATAAAATGG - Intergenic
1099305356 12:80947928-80947950 GATTTCATCCCAAGAGAAATGGG + Intronic
1099431836 12:82595396-82595418 AAGTTCAACCAAATAGAGAGGGG - Intergenic
1099763830 12:86956388-86956410 AAAGTCATCCAAATTGAAAAGGG - Intergenic
1100662953 12:96720236-96720258 GAGTTCAGCAAAAAGGAAAAAGG - Intronic
1102282332 12:111628172-111628194 CAGTTCACACAACTAGAAAAGGG + Intergenic
1104184675 12:126419090-126419112 AATTTCATCCACATAGAAAAGGG - Intergenic
1105589285 13:21776331-21776353 GATTCCATCCAAAAAAAAAAGGG - Intergenic
1106788370 13:33129751-33129773 CAGTGCATCCAAATACCAAATGG - Exonic
1106931238 13:34668060-34668082 GTGTGCAGCCAAATAAAAAAAGG - Intergenic
1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG + Intronic
1108869531 13:54966132-54966154 GAGGTCAGAGAAATAGAAAAGGG + Intergenic
1109302715 13:60605555-60605577 GACTTCATCTCAAAAGAAAAAGG + Intergenic
1109333565 13:60962739-60962761 AAGTACATCCAAATAGGAAGAGG - Intergenic
1109927503 13:69164005-69164027 CAGGTCATCCTAATAGCAAAAGG - Intergenic
1112863418 13:103863645-103863667 GAGTTAAGCAAAATAGAAATTGG - Intergenic
1112986689 13:105458456-105458478 GAATTTATCCAAAAAGAAAGGGG - Intergenic
1117815016 14:59588469-59588491 GAGTTCATTTATATATAAAATGG + Intergenic
1119330392 14:73789173-73789195 GAGTTCTGACAAATAGAATATGG + Intronic
1120516667 14:85479270-85479292 AAGGTGATCCAAAGAGAAAATGG - Intergenic
1122337398 14:101002849-101002871 GAGCTCACCCAGATGGAAAACGG - Intergenic
1123474342 15:20579215-20579237 GAGTCCCTCCAAATACAGAAAGG + Intergenic
1123643669 15:22421138-22421160 GAGTCCCTCCAAATACAGAAAGG - Intergenic
1123664950 15:22600764-22600786 GAGTCCCTCCAAATACAGAAAGG - Intergenic
1123734644 15:23174229-23174251 GAGTCCCTCCAAATACAGAAAGG + Intergenic
1123752815 15:23371872-23371894 GAGTCCCTCCAAATACAGAAAGG + Intergenic
1124285147 15:28395536-28395558 GAGTCCCTCCAAATACAGAAAGG + Intergenic
1124297549 15:28516078-28516100 GAGTCCCTCCAAATACAGAAAGG - Intergenic
1124318780 15:28695179-28695201 GAGTCCCTCCAAATACAGAAAGG - Intergenic
1124328340 15:28785608-28785630 GAGTCCCTCCAAATATAGAAAGG - Intergenic
1125064967 15:35471572-35471594 GTGTTCAGCCAAATAGTAGATGG - Intronic
1125878818 15:43174273-43174295 GATTTCATCCAAATTAAGAAGGG - Intronic
1127232255 15:57009418-57009440 TAGTTCATCCATATAAAAACAGG - Intronic
1128462061 15:67877833-67877855 GAGTGCATTCAAATATAATAAGG - Intergenic
1129275443 15:74442394-74442416 GAGTTCAGCTTTATAGAAAATGG - Intergenic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1129963787 15:79714913-79714935 GATTTGATCCAAAAAAAAAATGG + Intergenic
1130208746 15:81903037-81903059 AACTTCATCCCAATAGCAAAGGG - Intergenic
1130231595 15:82101485-82101507 CAGTTTATCAAAATATAAAATGG + Intergenic
1134901827 16:17945011-17945033 GTGTTCTTCCAAATACACAATGG + Intergenic
1135999999 16:27285261-27285283 GAGTTCATCCAAACAAAACTGGG + Intronic
1136528216 16:30847011-30847033 GAGTTATTACAAAGAGAAAATGG + Intronic
1139398025 16:66656181-66656203 GAGTTCATACAAATTAAGAAGGG + Intronic
1140698934 16:77563416-77563438 GATGTCATCCAAATGGAAATAGG - Intergenic
1140763004 16:78128732-78128754 GAGTTCATCCTTATAGCCAATGG - Intronic
1141519045 16:84565352-84565374 GAGGTCACCCAGATAGAAAGTGG - Intergenic
1141917197 16:87107411-87107433 GTGTTCATCCAGACAGAAACAGG + Intronic
1147895776 17:43750439-43750461 GACTTCATCTCAAAAGAAAAAGG - Intergenic
1149496421 17:57120965-57120987 GAGTTTGCACAAATAGAAAATGG - Exonic
1149573097 17:57689321-57689343 GAGTTAATAGAAAAAGAAAAGGG + Intergenic
1151615001 17:75204284-75204306 CAGTTAATCCTAATGGAAAACGG + Intergenic
1153568506 18:6444924-6444946 GAGTTCATCTTAATTGATAAAGG + Intergenic
1153856457 18:9152912-9152934 TATTTCATACAAAAAGAAAAAGG - Intronic
1155615599 18:27717466-27717488 TTGTTCATATAAATAGAAAAAGG + Intergenic
1159653218 18:71001683-71001705 ATGTTTATCCAAATAGAAAATGG + Intergenic
1159732968 18:72054669-72054691 GAGTGAATATAAATAGAAAAGGG - Intergenic
1160621384 18:80173614-80173636 GACTTCATCTAAAAAAAAAAGGG + Intronic
1161209702 19:3060038-3060060 GATTTCCTCCAAGTAGAAAGGGG - Intronic
1166019437 19:40012513-40012535 GAGGTCTTCCAAATAAGAAAGGG + Intronic
1168507615 19:56949703-56949725 GACCAAATCCAAATAGAAAATGG + Intergenic
926444017 2:12921964-12921986 GAATTCCTCAAAATAGAAACAGG + Intergenic
926955858 2:18299089-18299111 CAGTTTAACCAAATTGAAAAAGG + Intronic
927027125 2:19079882-19079904 GAATTAACCCATATAGAAAATGG + Intergenic
927124358 2:19999677-19999699 GACTTCATCAAGATAGACAAAGG - Intronic
927388635 2:22566648-22566670 GAGCTATTTCAAATAGAAAACGG + Intergenic
928867690 2:35936932-35936954 GAGTTCTTTCATATGGAAAATGG + Intergenic
928888424 2:36176878-36176900 GAGTTCTTTAAAATAGAACATGG - Intergenic
929028897 2:37632668-37632690 GAGTTCATGCAAAGACAGAAAGG + Intergenic
929551778 2:42897990-42898012 GAGATCAATGAAATAGAAAATGG - Intergenic
929717609 2:44328752-44328774 TAGTTGATCCAAAAAGCAAAAGG - Intronic
930150074 2:48050407-48050429 GAATTCATCCAGGTAGAAATTGG - Intergenic
930490920 2:52070687-52070709 GGGTTAATCTAAAGAGAAAATGG - Intergenic
930972802 2:57417942-57417964 TAGTTCATCCCAATAGTGAAAGG + Intergenic
933844890 2:86317242-86317264 AATTGCATCCAAATAGAAACAGG + Intronic
934021273 2:87955888-87955910 GAGTGAATCCAAAAAAAAAAAGG - Intergenic
934784243 2:96993172-96993194 AAGATCAGGCAAATAGAAAATGG - Intronic
935550831 2:104451930-104451952 AAGTTCATACAATTAGTAAATGG - Intergenic
935891535 2:107684196-107684218 GAGTTTATCCAAAGAGAATGTGG + Intergenic
936044510 2:109176250-109176272 GAGTTTAATAAAATAGAAAAGGG + Intronic
936546907 2:113399228-113399250 GAGTTCAGCAAGAGAGAAAAAGG - Intergenic
936830340 2:116637437-116637459 AAGAGCATCCAAATTGAAAAAGG + Intergenic
937797334 2:126039295-126039317 GAGTGCTTGTAAATAGAAAAAGG - Intergenic
938207701 2:129438238-129438260 GAGTTCTTGCAAAGACAAAATGG + Intergenic
938870707 2:135473189-135473211 AAGTTCATAGAAACAGAAAATGG - Intronic
940495426 2:154422276-154422298 GAATTCAGCCAAATATGAAAAGG + Intronic
940730940 2:157390659-157390681 AAGTTCATCCAAATAGGAAGAGG - Intergenic
941413122 2:165185507-165185529 TATTTTATCCCAATAGAAAAGGG - Intronic
941451029 2:165660359-165660381 TGGCTCATCCAAATAGAAAATGG + Intronic
941527392 2:166623138-166623160 AAGGTCATCCAAATTGGAAAGGG - Intergenic
941754958 2:169175037-169175059 AACTTCATAAAAATAGAAAAAGG + Intronic
941841307 2:170087618-170087640 GATCTCATCCAGAGAGAAAAGGG + Intergenic
941938705 2:171009968-171009990 GACTTCATCCCAAGAGCAAATGG + Intronic
942985293 2:182133948-182133970 GTGTTCATCCAAAGAGGAGATGG + Intergenic
944487169 2:200219007-200219029 GTGTTCATCAAAACAGAGAATGG + Intergenic
945323737 2:208458405-208458427 GATCTTATACAAATAGAAAATGG + Intronic
945328633 2:208514216-208514238 GAGAACATCCTAATACAAAATGG - Intronic
945613686 2:212039343-212039365 TAGTTCAACCATATATAAAAAGG - Intronic
945655951 2:212624365-212624387 AAAAGCATCCAAATAGAAAAGGG + Intergenic
945952595 2:216053950-216053972 AAGGTCATCCAAATAGAACTGGG - Intronic
946978995 2:225186416-225186438 GAAATCATCCAATTAGAAAACGG + Intergenic
947055909 2:226103512-226103534 AAGTTCATCCATATCGCAAATGG - Intergenic
948051887 2:234984842-234984864 CAGTCCATCCAAATAGAAGAGGG + Intronic
1168832976 20:857259-857281 GAGTTCATGCAAATGGAATCTGG + Intronic
1168931220 20:1625948-1625970 GAGTTCTCTCAAATATAAAATGG + Intergenic
1169475724 20:5929636-5929658 GAGTTCATCTAAAAAGAATCTGG - Intergenic
1170420464 20:16187272-16187294 TGGTTGATCCATATAGAAAATGG + Intergenic
1171281723 20:23905771-23905793 AAGAGCATCCAAATAGGAAAAGG - Intergenic
1172049116 20:32102881-32102903 GAGTTCTTACAAATAAAAGAGGG - Intergenic
1172755710 20:37282774-37282796 GAGTTCATCCAACTACAAAATGG + Intergenic
1173979239 20:47210469-47210491 AAGTTAATACAAATATAAAAAGG + Exonic
1174029335 20:47609265-47609287 GGTGTCATCCACATAGAAAAAGG - Intronic
1174241082 20:49135266-49135288 TAGTTCATCCAAATGGACGAGGG - Intronic
1174457516 20:50660115-50660137 GAGTACGTCCATATAGAAAGAGG + Intronic
1174992686 20:55528989-55529011 GAGTTTAGCAAAATATAAAAAGG + Intergenic
1176587849 21:8606948-8606970 TACTTCTTCAAAATAGAAAAGGG + Intergenic
1177327751 21:19614161-19614183 GTGTTAATCAAAATAGAGAATGG + Intergenic
1177594881 21:23225730-23225752 TAATTCATCCAAATTTAAAATGG + Intergenic
1178508547 21:33182838-33182860 GACGTCATCAAAATAGACAATGG - Intergenic
1180270681 22:10583947-10583969 TACTTCTTCAAAATAGAAAAGGG + Intergenic
1182943710 22:34302491-34302513 CTGTTCTTCCAAAGAGAAAATGG - Intergenic
1183047679 22:35233323-35233345 AAGTTCCTCCAAAGAGAAGAGGG + Intergenic
1183656231 22:39186427-39186449 GACTTCATCTAAAAAAAAAAAGG + Intergenic
1184451825 22:44587013-44587035 GAATGCATCCAAAGAGAAACTGG + Intergenic
1185310728 22:50152842-50152864 GGGTCCATCTGAATAGAAAATGG - Intronic
949197298 3:1327457-1327479 GAGAGAATTCAAATAGAAAATGG + Exonic
951293053 3:20898284-20898306 TAGCTGATCCAATTAGAAAATGG + Intergenic
951305815 3:21060235-21060257 AAGTGGATGCAAATAGAAAAGGG + Intergenic
951375412 3:21909174-21909196 AAGTTCGTCCAAATATAATACGG + Intronic
951567626 3:24027033-24027055 CAGTTTATCCAACTATAAAATGG - Intergenic
951657921 3:25029796-25029818 TATTTCATCCAAATGGGAAAAGG + Intergenic
953736934 3:45503053-45503075 GAGTTCCTACAAAAAAAAAAGGG - Intronic
955990872 3:64626022-64626044 AAGGTGATACAAATAGAAAATGG - Intronic
956092581 3:65683601-65683623 CAGATAATCCAATTAGAAAATGG + Intronic
956876580 3:73469799-73469821 CAGTGCATCCAATCAGAAAATGG - Intronic
958185970 3:90119511-90119533 GATTTCTACCTAATAGAAAAAGG + Intergenic
958433153 3:94065530-94065552 GAGTTGATCCAAGAAAAAAATGG - Intronic
959207214 3:103325022-103325044 AAAGGCATCCAAATAGAAAAAGG - Intergenic
960600068 3:119448269-119448291 TAGTTCATTCAGAAAGAAAATGG - Intronic
963012890 3:140790285-140790307 AAATAAATCCAAATAGAAAATGG + Intergenic
963308725 3:143684059-143684081 CAGTTACTCCAAATATAAAATGG - Intronic
963793686 3:149610048-149610070 GAGTTTATCCTAAGAAAAAAAGG + Intronic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964599533 3:158481799-158481821 GAGTTCATCCAAATAGAAAATGG - Intronic
964603426 3:158530098-158530120 GAGTTCAGGCAAGTAGAAAATGG - Intronic
964899444 3:161640386-161640408 GAGTTCATGTAGATAGAGAAAGG - Intergenic
965119648 3:164537234-164537256 GAGTTCACCCAATTAGAAAAAGG + Intergenic
965422052 3:168472766-168472788 CAGTACATGCAAATATAAAATGG + Intergenic
967101519 3:186219957-186219979 GAGTTCTTCCAAAGTGTAAATGG + Intronic
967421214 3:189275124-189275146 AAGTTCAGCTAAAAAGAAAAAGG - Intronic
967790514 3:193543776-193543798 AAGTTCTTCCAAAAAGAAACAGG + Intronic
968203398 3:196776416-196776438 TTGTTCTTCCAAATAAAAAAAGG - Intronic
968420276 4:478386-478408 GAGTGCATCTCTATAGAAAAGGG - Intronic
969305621 4:6324771-6324793 AAGTTCATCCACATAGTAAGAGG + Intronic
969608676 4:8215264-8215286 GAATTCCTCCAAATGGAACAGGG - Intronic
971981694 4:33759343-33759365 AAATTTATACAAATAGAAAAAGG - Intergenic
972157071 4:36177029-36177051 GAGTTCTTCCAAAAAAAAAGGGG + Intronic
973556064 4:52084072-52084094 GAGTCCATAGAAATAGAAATTGG + Intronic
973987535 4:56369621-56369643 TAGTTTATCAAAATAGAAAGTGG + Intronic
974965535 4:68756434-68756456 GAGTTGGTCCAAACTGAAAAGGG - Intergenic
975012558 4:69375751-69375773 AAAGTCATCCAAATAGAAAGAGG + Intronic
975026405 4:69554281-69554303 TAGGGCATCCAAATAGAAAGAGG + Intergenic
975949422 4:79750239-79750261 CAGATCATCCACACAGAAAATGG + Intergenic
977410603 4:96657250-96657272 AAGGGCATACAAATAGAAAAGGG + Intergenic
978079951 4:104580033-104580055 GATTCCTTCCAAATATAAAAAGG - Intergenic
981441719 4:144791340-144791362 AAGGTCATCCAAATAGGAAGAGG - Intergenic
982534333 4:156589978-156590000 GAGGTAATCCACATACAAAACGG - Intergenic
982672601 4:158339587-158339609 TAGTTTATCAGAATAGAAAAAGG - Intronic
983453737 4:167937036-167937058 TAGTTCAGTAAAATAGAAAATGG - Intergenic
986966347 5:13276659-13276681 GAGGTCATGCAAATAAATAATGG + Intergenic
987385734 5:17327445-17327467 GAGTTGATCCAAAGAGCAATAGG + Intergenic
987592466 5:19947943-19947965 AAATACATCCAATTAGAAAATGG + Intronic
987686568 5:21211717-21211739 TAGATCATGCAAATAGTAAATGG - Intergenic
988148763 5:27347743-27347765 AAGTTCAACAAAATGGAAAATGG + Intergenic
988164759 5:27572258-27572280 GAGTTCTACTATATAGAAAAGGG + Intergenic
988738240 5:34044195-34044217 TAATTCAGCCAAAAAGAAAATGG + Intronic
989301329 5:39897388-39897410 GATTTCATTAAAATAGATAATGG + Intergenic
989975083 5:50575649-50575671 GAGTTTATCCAAACATAAAAAGG + Intergenic
990626564 5:57619236-57619258 CACTACATGCAAATAGAAAAGGG + Intergenic
991419622 5:66427875-66427897 GTGTTCTTAAAAATAGAAAAAGG + Intergenic
991464380 5:66894791-66894813 GAGTTCCTCCAAAAAACAAAGGG - Intronic
991501465 5:67281206-67281228 AAGGTCATCCAAATAGTAATTGG - Intergenic
993118247 5:83743406-83743428 GAGATCATCCAAAAAGAATATGG - Intergenic
994569239 5:101492382-101492404 GAGTATATTCAAATAGAAAGAGG - Intergenic
994677504 5:102843669-102843691 AAATCAATCCAAATAGAAAATGG + Intronic
997221631 5:132171613-132171635 GAAATCAACAAAATAGAAAATGG + Intergenic
997622910 5:135311049-135311071 CATTTCATACAAATATAAAATGG + Intronic
997839392 5:137225236-137225258 AAGATCATCCAACCAGAAAATGG - Intronic
997955069 5:138272999-138273021 TTGTTCATCCAACTATAAAATGG - Intronic
998548482 5:143052743-143052765 ACTTTCATCCAAATAGAAAGAGG - Intronic
998717308 5:144899490-144899512 GACATCATGCAAATAGAATATGG - Intergenic
999085100 5:148881069-148881091 TAGTTCATGCAAAGAGAAATTGG - Intergenic
1000309907 5:160032427-160032449 GAATTCCTCCAAATAGGAAGGGG - Intronic
1000514278 5:162220487-162220509 GAGACCCTCCAAAAAGAAAAAGG + Intergenic
1000957767 5:167562661-167562683 GTGATCAGTCAAATAGAAAATGG + Intronic
1001054000 5:168434579-168434601 CAGGTCATCCAAGGAGAAAATGG + Intronic
1001691480 5:173635866-173635888 GAGTTCATGCAGAAAGAAAGTGG - Intergenic
1001714697 5:173805730-173805752 GAGTACGTACAGATAGAAAAGGG - Intergenic
1001924034 5:175623192-175623214 TAGATCATCCAACTAGCAAATGG - Intergenic
1001943086 5:175754351-175754373 GAGTTTTTCCAAATATAAAGTGG + Intergenic
1003165233 6:3671607-3671629 GAGGACATCCAAAGAGAAACAGG + Intergenic
1004217253 6:13714167-13714189 GAGGTCAACCAATTAGAAAAAGG + Intergenic
1004397753 6:15261192-15261214 GAGGTCATCCCAATAAAGAAAGG + Intronic
1009891144 6:69684768-69684790 GAATTAATCCAAATAAAAACAGG + Intronic
1010922322 6:81698194-81698216 AAGTGCATCCAAAAAGATAAAGG - Intronic
1011446158 6:87443263-87443285 GAGTTTAAACAAATAGTAAAAGG - Intronic
1012758591 6:103265284-103265306 AAGGTCTTACAAATAGAAAAAGG - Intergenic
1013454973 6:110322381-110322403 AAGTTCCTCCAAATACAAAATGG + Intronic
1014530260 6:122550644-122550666 CAGTTCATTCAAATAGAAAAGGG - Intronic
1014665172 6:124228751-124228773 GACTTCATTGAAACAGAAAAAGG - Intronic
1015203523 6:130609208-130609230 GAGTTCATCCACATATACATAGG + Intergenic
1015273932 6:131365328-131365350 AAGTTCATCTGGATAGAAAAGGG + Intergenic
1017566909 6:155696736-155696758 GAATTCATCCAAATTTAGAAGGG + Intergenic
1017579293 6:155844573-155844595 CAGATCATCCCAACAGAAAACGG + Intergenic
1017934146 6:158989635-158989657 GAGTACAGCCAAAAACAAAATGG - Intronic
1017967641 6:159280368-159280390 GAGCTCATTTAAAAAGAAAAGGG + Intergenic
1018498734 6:164379264-164379286 GAGTTCAGGAAAGTAGAAAATGG - Intergenic
1020628565 7:10612736-10612758 TTGTTCCTCCAAATAAAAAAGGG + Intergenic
1020840112 7:13206365-13206387 AAGGACATCCAAATAGGAAAGGG - Intergenic
1021996448 7:26182690-26182712 GAGTTCTTTCAACTAGAAAGAGG + Intronic
1022427002 7:30278496-30278518 GAATTCATCCAGAAAGCAAAAGG - Intergenic
1023381888 7:39616351-39616373 GAGATCATCCAAAAAGAATGTGG + Intergenic
1023431539 7:40096786-40096808 GAGTCCATCAAAAAATAAAATGG - Exonic
1023469241 7:40496022-40496044 GAGTTCATAGCAATAGAAATAGG + Intronic
1024304039 7:47911592-47911614 GAGTTAATCCAAAAACAAAAAGG + Intronic
1026266932 7:68803412-68803434 GAGATCATTCAGAGAGAAAAAGG + Intergenic
1026527124 7:71163791-71163813 GAGTTGATGCAGATCGAAAAGGG + Intronic
1028150981 7:87371504-87371526 TATTTTATCCAAATACAAAAAGG - Intronic
1028569596 7:92271977-92271999 GATTTCATGGAGATAGAAAATGG + Intronic
1028980555 7:96963266-96963288 TAGTTTTTCCAAATAGAAATGGG - Intergenic
1031337889 7:120559457-120559479 AAGATCATCCAGGTAGAAAATGG + Intronic
1031588031 7:123556388-123556410 GAGCAAATCCAAATAGAGAACGG - Intronic
1031881570 7:127204568-127204590 GAGTGCATCTAACTAGCAAATGG - Intronic
1032774390 7:135095630-135095652 CAGTTCCCCAAAATAGAAAATGG + Intronic
1032823483 7:135546289-135546311 GAAATCAATCAAATAGAAAATGG - Intergenic
1033575178 7:142674718-142674740 GACCTCATCAAAATAAAAAATGG - Intergenic
1034297690 7:149988802-149988824 GTGTTCACCCAAATATATAAAGG - Intergenic
1034808333 7:154108051-154108073 GTGTTCACCCAAATATATAAAGG + Intronic
1034878674 7:154747442-154747464 GAGTTCATACAACCAGTAAATGG - Intronic
1036828159 8:11995949-11995971 CAGTTCAGCCAAAAAAAAAAAGG + Intronic
1037030092 8:14093956-14093978 TGGTTCATCCATATAGAATAGGG + Intronic
1037465133 8:19152326-19152348 CAGATAATCCAATTAGAAAAGGG - Intergenic
1038699639 8:29837403-29837425 GAGGTCATCCACATAGGAACGGG + Intergenic
1038701352 8:29852407-29852429 GAGTTCATCCAAATATTAATTGG + Intergenic
1040988196 8:53319278-53319300 AAGTTTATCCAATTAGAAATAGG + Intergenic
1041431303 8:57783573-57783595 GAGTTCATCCAAGAAGGGAAAGG - Intergenic
1041510097 8:58646761-58646783 GAGACCATCCAATTACAAAACGG - Intronic
1042748787 8:72135578-72135600 GATTCCATGCAAACAGAAAAAGG - Intergenic
1044388687 8:91622570-91622592 GAATTCATCCAAGAAGACAAAGG + Intergenic
1045095700 8:98795567-98795589 AAAGGCATCCAAATAGAAAAAGG + Intronic
1046006464 8:108492112-108492134 GAAATAATCCAATTAGAAAATGG + Intergenic
1047734389 8:127752696-127752718 GAGTCCATCTAAAAAAAAAAGGG + Intergenic
1048313883 8:133348044-133348066 AAGGTCATCCTATTAGAAAATGG + Intergenic
1050236233 9:3583792-3583814 GAAATCATCCAGTTAGAAAATGG - Intergenic
1050399607 9:5237913-5237935 TAGTTCTTCAAAATAGAAAATGG + Intergenic
1052888563 9:33673993-33674015 GACGTCATCAAAATAAAAAATGG - Intergenic
1058559313 9:106207645-106207667 CAAATCATCCAAATAAAAAACGG - Intergenic
1058745882 9:107990260-107990282 AAGGACATCCAAATAGAAAAAGG - Intergenic
1203617809 Un_KI270749v1:85132-85154 TACTTCTTCAAAATAGAAAAGGG + Intergenic
1186909500 X:14146880-14146902 AAGATCATACAACTAGAAAAGGG - Intergenic
1187434441 X:19254239-19254261 GAGTTGACCCAAATAGGAAGTGG + Intergenic
1188077741 X:25799401-25799423 GTGTTCATCAACTTAGAAAATGG - Intergenic
1191838946 X:65495747-65495769 GAATTCATTTAAATAGAAATTGG - Intronic
1192338237 X:70239631-70239653 GATTTCATCAAAATAGATGAGGG + Intronic
1193012292 X:76689741-76689763 GACTCCATCAAAAAAGAAAAAGG + Intergenic
1193535596 X:82711490-82711512 GATTTCATCCAAATAGAGTAGGG + Intergenic
1194362825 X:92975754-92975776 AAGTTCATCGAAATGAAAAAGGG - Intergenic
1194495160 X:94607302-94607324 GTGTTCATCAAAATAAAAAAAGG - Intergenic
1195955255 X:110321918-110321940 GTATTCATTCAAATATAAAAGGG - Intronic
1196872087 X:120121944-120121966 GAGTTTTTGCGAATAGAAAATGG + Intergenic
1197179676 X:123520891-123520913 GAGTGAAGCCAATTAGAAAACGG - Intergenic
1197930716 X:131692028-131692050 TAGATCTTCCAAATAAAAAATGG - Intergenic
1198171701 X:134112578-134112600 AAGAGCATCCAAAGAGAAAAAGG - Intergenic
1198302773 X:135347595-135347617 GAGTTCAGCAGAAGAGAAAAAGG - Intronic
1199123251 X:144083233-144083255 GAGTGAATCCAAAAAAAAAAAGG + Intergenic
1199159028 X:144586279-144586301 GCGTTCATCCAGATGGAAACAGG - Intergenic
1199521152 X:148737583-148737605 GAGTGCATCCAAATCGGTAAAGG - Intronic
1199550814 X:149059335-149059357 GAGCTCATCCATATATAAAATGG - Intergenic
1200395185 X:155981963-155981985 GAGTTCATACAGTTAGAAAGTGG + Intergenic
1200671073 Y:6091983-6092005 AAGTTCATCGAAATGAAAAAGGG - Intergenic
1201462104 Y:14238028-14238050 GTGTTCATAAAAATATAAAATGG - Intergenic
1202575049 Y:26315201-26315223 GAACTCATCCAAACACAAAACGG + Intergenic