ID: 964599778

View in Genome Browser
Species Human (GRCh38)
Location 3:158486236-158486258
Sequence CTCAGTCAACACTAGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964599778_964599783 20 Left 964599778 3:158486236-158486258 CCTGACTTCTAGTGTTGACTGAG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 964599783 3:158486279-158486301 TAATGGTTGTTCAAAGGGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 152
964599778_964599781 14 Left 964599778 3:158486236-158486258 CCTGACTTCTAGTGTTGACTGAG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 964599781 3:158486273-158486295 TACAGTTAATGGTTGTTCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 140
964599778_964599779 3 Left 964599778 3:158486236-158486258 CCTGACTTCTAGTGTTGACTGAG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 964599779 3:158486262-158486284 CATTGACCTCTTACAGTTAATGG 0: 1
1: 0
2: 1
3: 8
4: 121
964599778_964599782 15 Left 964599778 3:158486236-158486258 CCTGACTTCTAGTGTTGACTGAG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 964599782 3:158486274-158486296 ACAGTTAATGGTTGTTCAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 163
964599778_964599784 29 Left 964599778 3:158486236-158486258 CCTGACTTCTAGTGTTGACTGAG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 964599784 3:158486288-158486310 TTCAAAGGGAGAGGTCATTATGG 0: 1
1: 0
2: 3
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964599778 Original CRISPR CTCAGTCAACACTAGAAGTC AGG (reversed) Intronic
902163012 1:14547360-14547382 CAAAGTCAAGACTAGAATTCAGG - Intergenic
903135496 1:21306933-21306955 CACAGTCAGGACTAGAAGCCAGG + Intronic
903739806 1:25552205-25552227 CTCTGTCAAGAGCAGAAGTCTGG - Intronic
907716038 1:56926961-56926983 ATGAGTCAACTATAGAAGTCAGG - Intergenic
907805735 1:57817589-57817611 CTCAGGCAACACTCAATGTCAGG + Intronic
916618471 1:166470272-166470294 CTCAGCAAACACTACAAATCAGG - Intergenic
918577122 1:186075718-186075740 GACATTCAACAATAGAAGTCTGG - Intronic
919451834 1:197781475-197781497 CTCAGTCAATATTAAAAGGCAGG - Intergenic
919464817 1:197914746-197914768 CTCAGTGAACGCAGGAAGTCTGG - Intronic
921124982 1:212169546-212169568 CTCAGTCCACACTTGAAGTGTGG + Intergenic
921570893 1:216776834-216776856 CTGAGGCAACACTAGAAGTGTGG + Intronic
1065379370 10:25074245-25074267 TTCATTCATCAATAGAAGTCAGG + Intergenic
1068556062 10:58460330-58460352 ATCAGTAAACACTACAAATCAGG + Intergenic
1071798732 10:89034107-89034129 CTCAGTTAACTCTAGATCTCAGG - Intergenic
1072084843 10:92068516-92068538 CAGATTCAACTCTAGAAGTCAGG - Intronic
1077165641 11:1135770-1135792 GTCAGTCAACACTAAAATTTAGG + Intergenic
1081886342 11:46500108-46500130 CTCAGCCAAGACTAGAACCCAGG + Intronic
1088859137 11:113783644-113783666 CTGAGTCAAGACTTGAAGCCAGG + Intergenic
1092783643 12:12009112-12009134 CTCTGTCAGCACTAGGAGGCAGG - Intergenic
1098216595 12:68226870-68226892 ATAAGTCAACACTAGAAATCTGG + Intergenic
1106472576 13:30070660-30070682 ATCAGCAAACACTAGCAGTCAGG + Intergenic
1106771194 13:32962178-32962200 CACAGTCACCACTAGAAAACAGG - Intergenic
1112933666 13:104772650-104772672 CTCTGTGAACACCAGAAGTAGGG - Intergenic
1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
1114097942 14:19351968-19351990 CTCAGCCAGCACTAAAAGTTGGG - Intergenic
1118259207 14:64232190-64232212 ATCAGTCACCACAAGTAGTCAGG - Intronic
1121485426 14:94310833-94310855 CTCAGTCATCACTTTAAGACTGG - Intronic
1128918872 15:71592783-71592805 CTCAGTCAGCACTGAAACTCAGG - Intronic
1137550732 16:49435796-49435818 CACAGTCAACATCAGGAGTCAGG + Intergenic
1138233494 16:55358889-55358911 TTCAGCAAACACTAGAAATCAGG - Intergenic
1146135294 17:30314950-30314972 CAGAGCCAACACTAGAACTCTGG + Intergenic
1149631576 17:58129591-58129613 TTCATTCAATACTAGAAGTGAGG - Intergenic
1150307460 17:64098390-64098412 CTCAGTCAGGACTAGAACCCAGG + Intronic
1150544765 17:66144085-66144107 CTCAGTAAACAATAAAAATCAGG - Intronic
1155267585 18:24108546-24108568 CGCAGTCAACACATGAAGCCTGG - Intronic
1155753303 18:29456672-29456694 ATCAGTCACCACTAGATGACAGG - Intergenic
1163326739 19:16608510-16608532 ATCAGTAAACACTATAAATCAGG + Intronic
1166730202 19:45054955-45054977 CTCAGTGATCACTAGAATTTTGG - Intronic
1167203548 19:48084658-48084680 CTCAGTAAACATTAGCAATCTGG - Intronic
1167318463 19:48780520-48780542 CTCAGTCAATATTAGAAGCATGG + Intergenic
930890944 2:56387118-56387140 AGCAGTCCACACTATAAGTCAGG - Intergenic
933122161 2:78552011-78552033 CTAAGTCAATACTTGAAGTGAGG + Intergenic
938105659 2:128528246-128528268 GTCAGTGAACACTACAAGTCAGG - Intergenic
939776535 2:146394334-146394356 CTCAGACAACAGTAGGAGGCAGG + Intergenic
940099701 2:150020519-150020541 CCCTGTCAACATAAGAAGTCTGG - Intergenic
941026937 2:160467117-160467139 CCCAGTGAAGACTATAAGTCAGG + Intronic
943180643 2:184536348-184536370 TTCCGTCAACACTACAAGCCAGG - Intergenic
944012042 2:194984164-194984186 CACAGTCAACATCAGAATTCTGG + Intergenic
946585874 2:221187175-221187197 CTTAATCAACACTAGACGTCAGG - Intergenic
946701301 2:222417022-222417044 CTCATTCACCACTAGAAGTTAGG - Intergenic
1168913603 20:1468879-1468901 CTCAGTAAACACTAGCTGCCAGG - Intronic
1169365230 20:4986718-4986740 GTCAGTCAAAACAAAAAGTCTGG + Intronic
1169669760 20:8083619-8083641 CTCAGGAAACACTAGTAGTGGGG - Intergenic
1173215444 20:41077695-41077717 CTCAGACAACACTACAACACAGG - Intronic
1177115568 21:17082139-17082161 CTCATTCATCACTAGATGTATGG + Intergenic
1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
949946608 3:9194696-9194718 CAAAGTCAACACTAGAACCCAGG + Intronic
950638626 3:14333555-14333577 CAAAGTCAGCACTAGAACTCAGG + Intergenic
954345323 3:49992394-49992416 GTTAGTATACACTAGAAGTCAGG + Intronic
957496472 3:80997797-80997819 CTAACTCAACTCTAGAAGTATGG - Intergenic
958905756 3:99940543-99940565 CTGAGCCAACACCAGAAGGCAGG + Intronic
963719844 3:148849824-148849846 CGAAGCCAACACTAGTAGTCAGG + Intronic
964291927 3:155190950-155190972 ATCAGCCAACACTAGAAGTCAGG + Intergenic
964599778 3:158486236-158486258 CTCAGTCAACACTAGAAGTCAGG - Intronic
977553662 4:98467699-98467721 CGCAGTCGACACTAGAGGGCAGG + Intergenic
979317776 4:119285441-119285463 CTCAGTTGATCCTAGAAGTCAGG + Intronic
979451400 4:120875214-120875236 CTCAGGCCACCCTAGAAGCCAGG + Intronic
980502479 4:133674131-133674153 CTGAGACATCACCAGAAGTCAGG - Intergenic
987349813 5:17011829-17011851 ATCCTTCAAGACTAGAAGTCAGG + Intergenic
991479487 5:67061928-67061950 ATCAGTCAACTCCAGGAGTCTGG - Intronic
997576234 5:134979806-134979828 CTCAGTAAAAACTGGAAGTTAGG + Intronic
999627897 5:153539510-153539532 CTCAGTAAAGACTAGAACCCAGG - Intronic
1004172602 6:13308467-13308489 GGCAGCCAACACTAGAAGACTGG + Intronic
1015370001 6:132439827-132439849 AACAGTCAACACTAGGAATCAGG - Intergenic
1016665714 6:146637640-146637662 CTCAGTCAACACTGGGTTTCAGG - Intronic
1017848828 6:158284722-158284744 CTCAGTCAATGCTAGAAAACTGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020404541 7:7817146-7817168 CTCAGTGAACACAAGACGTATGG - Intronic
1024477709 7:49831372-49831394 CTCTCTGAACACTAGAATTCAGG + Intronic
1028597158 7:92557786-92557808 TTCAGGCAGCACTGGAAGTCTGG + Intergenic
1032680692 7:134179890-134179912 CTCTGTCAGCACCAGAAGTCAGG + Intronic
1035352255 7:158255074-158255096 GTCACTCAACACCAGAAGACAGG - Intronic
1035596574 8:862793-862815 CTCAGTCAACACCAGACTTTGGG - Intergenic
1036767508 8:11558124-11558146 CTCAGCCAGCAGGAGAAGTCAGG + Intronic
1037270259 8:17119877-17119899 CTGAGTTAACAAAAGAAGTCAGG + Intronic
1037922514 8:22817385-22817407 ATCAGCAAACACTAGAAATCAGG + Intronic
1039772258 8:40699123-40699145 CTCAGTCAAGCCTAGGAGACAGG + Intronic
1039791346 8:40878265-40878287 CCCAGTCCTCACTTGAAGTCAGG + Intronic
1041549990 8:59089877-59089899 CCCAGCCAAAACCAGAAGTCTGG + Intronic
1041708774 8:60874456-60874478 CTCACACAACACTAGAAGGAAGG - Intergenic
1041829002 8:62131298-62131320 TTCTGTTAACACTAGAGGTCAGG + Intergenic
1042044244 8:64630254-64630276 TTCAGTCATCACCAGAAATCAGG + Intronic
1042044453 8:64633040-64633062 TTCAGTCATCACCAGAAATCAGG + Intronic
1044549577 8:93496718-93496740 ATCAGTAAACACTATAAATCAGG + Intergenic
1045112038 8:98945323-98945345 CTCAGTCAGGACTAGAAGGTGGG - Intronic
1045907560 8:107365952-107365974 CACAGTAAACACTAGAACCCAGG + Intronic
1047781487 8:128115231-128115253 TTCTGTCAACACTACAAGGCAGG - Intergenic
1048082300 8:131141778-131141800 CTAAGACAATACTAGAAGTAAGG - Intergenic
1050857812 9:10383636-10383658 CACATTCAACACTATAACTCTGG - Intronic
1051847902 9:21473560-21473582 CTCTGTCATGACTAGAAGACAGG - Intergenic
1053306815 9:36990298-36990320 TTGAGTCAGCACTAGAACTCGGG + Intronic
1188581485 X:31719117-31719139 CTCATATAAAACTAGAAGTCAGG - Intronic
1189913212 X:45831819-45831841 CAGAGCCAACACTAGAACTCAGG + Intergenic
1193709839 X:84865912-84865934 CACCTTCAACACTAGATGTCAGG + Intergenic
1196872539 X:120126407-120126429 CTTTGTCAGCACTAGAATTCTGG - Intergenic