ID: 964612919

View in Genome Browser
Species Human (GRCh38)
Location 3:158632903-158632925
Sequence AATGAGATTATGGAGTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964612919_964612923 20 Left 964612919 3:158632903-158632925 CCAGTCTACTCCATAATCTCATT No data
Right 964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964612919 Original CRISPR AATGAGATTATGGAGTAGAC TGG (reversed) Intergenic